ID: 1179442229

View in Genome Browser
Species Human (GRCh38)
Location 21:41403352-41403374
Sequence GGTGACTAGCAAGTGAACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179442229_1179442236 30 Left 1179442229 21:41403352-41403374 CCAGAGTTCACTTGCTAGTCACC 0: 1
1: 0
2: 2
3: 9
4: 76
Right 1179442236 21:41403405-41403427 GTTGGATATTCACTGTCATTTGG 0: 1
1: 0
2: 1
3: 8
4: 115
1179442229_1179442234 12 Left 1179442229 21:41403352-41403374 CCAGAGTTCACTTGCTAGTCACC 0: 1
1: 0
2: 2
3: 9
4: 76
Right 1179442234 21:41403387-41403409 TGTTTAACCTTGAGAGAAGTTGG 0: 1
1: 0
2: 1
3: 10
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179442229 Original CRISPR GGTGACTAGCAAGTGAACTC TGG (reversed) Intronic
900161656 1:1226967-1226989 GCTCACCACCAAGTGAACTCAGG + Intronic
900933013 1:5748381-5748403 GGGGACTAGCATGTGAGCCCAGG - Intergenic
909381750 1:75006376-75006398 GGTGACTAGCATCTGAAGTGGGG + Intergenic
915273679 1:154773498-154773520 GGTGACTAGCATCGGAAGTCAGG + Intronic
921185700 1:212667568-212667590 ACTGACCAGCAAGGGAACTCTGG - Intergenic
923373940 1:233341219-233341241 GGTGACCAGCTAGTGCACTGTGG + Intronic
1073633685 10:105175520-105175542 GGCTACTAACAAGTCAACTCTGG - Intronic
1077182162 11:1221633-1221655 GGTGACCAGCAACTCCACTCTGG - Intergenic
1082607577 11:55260717-55260739 TGTAACTAGCAAGTGTATTCAGG + Intergenic
1086140728 11:83496262-83496284 GGTGGGTATCAAGTGAACTTTGG - Intronic
1086669643 11:89531449-89531471 AGTGACTACCAAGTTCACTCAGG - Intergenic
1086703043 11:89921851-89921873 TGTAACTAGCAAGTGTACTCAGG - Intergenic
1087539553 11:99498357-99498379 TGTGACTAACAAGTTAACTGTGG - Intronic
1096430448 12:51538734-51538756 GCTGAATATCAAGTGACCTCAGG - Intergenic
1097895487 12:64821188-64821210 ACTGACTGGTAAGTGAACTCAGG + Intronic
1102001058 12:109558408-109558430 GGTGTCTAGAAAGTGACCTCAGG - Intronic
1102466788 12:113134984-113135006 GGGGCCTAGCAAGGGAACCCTGG - Intronic
1103369298 12:120406657-120406679 GCAGACCAGCAAGTGAAATCTGG + Intergenic
1104247002 12:127053157-127053179 GGTTGCTAACAAGTGAAGTCAGG + Intergenic
1110597942 13:77339537-77339559 GGTTACTAGCAAGTATACTCAGG - Intergenic
1123970948 15:25507469-25507491 GGTGACTGACATGGGAACTCAGG - Intergenic
1124666069 15:31593926-31593948 ATTGACTTGCAAGTTAACTCTGG - Intronic
1125126148 15:36223381-36223403 GTGGACCAGCAAATGAACTCAGG + Intergenic
1133447720 16:5876449-5876471 GGTGCTTAGAAAGTGAAGTCAGG + Intergenic
1134214012 16:12301874-12301896 TGTGACTATCAAGTGTATTCGGG - Intronic
1135052807 16:19206150-19206172 GGTGACTAGGAGTTGAATTCTGG + Intronic
1140621581 16:76740610-76740632 GGCCACTGGCAAATGAACTCTGG - Intergenic
1143992616 17:10979494-10979516 GTTGAGTAGCCTGTGAACTCAGG - Intergenic
1144541006 17:16143112-16143134 GTTGTCTAGCAAGTGAACCTGGG - Intronic
1144936245 17:18901338-18901360 GCAGACTAGCAAGGGACCTCAGG - Intronic
1155437081 18:25824597-25824619 GGTGACCAGCAAGTGACCACTGG + Intergenic
1159082475 18:63751257-63751279 GGTGATTTGCAAGTGAACTCTGG + Intergenic
1165375692 19:35440100-35440122 GGTGATACGCAAATGAACTCAGG + Intergenic
1167799766 19:51732571-51732593 TGTGACTGGCATGTGAAGTCGGG - Intergenic
1168285222 19:55328422-55328444 TGTGAATAGCCACTGAACTCTGG - Intronic
1168568396 19:57443249-57443271 GGTGAAGTGCACGTGAACTCCGG - Intronic
926042766 2:9687939-9687961 TGTGAATAGCAACTGCACTCCGG + Intergenic
929434691 2:41919408-41919430 GGTAAATTGCAAGTTAACTCTGG - Intergenic
929949917 2:46400921-46400943 TGTGACTAGCATCTGAAGTCGGG - Intergenic
936041782 2:109155391-109155413 GGAGAATGGCAGGTGAACTCAGG - Intronic
936981275 2:118267612-118267634 GATGGCTCGCAAGTGACCTCAGG - Intergenic
937558536 2:123191263-123191285 TGTGACTAGTAATTGAATTCAGG + Intergenic
939646870 2:144710714-144710736 TATGACTAGGAAGTGAACTCTGG + Intergenic
947424652 2:229972525-229972547 AGTGACCAGCAAGTGAACAGAGG + Intronic
948219398 2:236257722-236257744 GTTGACCAGCAAGTGAACACAGG + Intronic
1169663686 20:8009448-8009470 TGTGATTAGCAAGTAACCTCTGG - Intronic
1171940730 20:31326581-31326603 GGTGACCAGCAACTGAAGCCTGG - Intergenic
1173598313 20:44274599-44274621 GGTGTCCAGCAAGTCAACTTAGG - Intronic
1177297483 21:19195468-19195490 GGTGACTATCAAATGAAATAAGG - Intergenic
1179442229 21:41403352-41403374 GGTGACTAGCAAGTGAACTCTGG - Intronic
1182360707 22:29744833-29744855 GGTGACTCTGAAGTGTACTCAGG + Intronic
1183224666 22:36541373-36541395 GGTGACATGCCAGTGAGCTCTGG - Intergenic
950144766 3:10641053-10641075 GATGACTAGCAATTGAACTCAGG + Intronic
950679326 3:14574163-14574185 GGTGACGAGCAAGTGCACGAAGG + Intergenic
950897302 3:16464900-16464922 AGTGACTCGCAAGTTAACTTTGG + Intronic
953169468 3:40494213-40494235 GGTGTCTAACAATTCAACTCTGG - Intergenic
955073476 3:55591346-55591368 TGTGACTGGGAAGTGAAGTCTGG + Intronic
955735099 3:62030588-62030610 GTTGACCAGCAAGTGAGCACTGG + Intronic
964586108 3:158304006-158304028 GTTGAATAGCAAAAGAACTCTGG + Intronic
965520943 3:169667817-169667839 AGTGTCTTGCAAGTAAACTCAGG - Intergenic
968207678 3:196818581-196818603 GGTCTCTAGCTACTGAACTCAGG + Intronic
970025174 4:11616295-11616317 GATAACTGGCAAGTGAACACAGG - Intergenic
971144026 4:23957081-23957103 TGTGATTAGCATGTGAACTTGGG - Intergenic
972430447 4:38976357-38976379 GGTGACTGCCAAGTGGCCTCTGG + Intronic
977999950 4:103546084-103546106 GATGGTTAGCATGTGAACTCTGG + Intergenic
981260654 4:142714756-142714778 GTTGACTTGAAAGTGAACTCTGG - Intronic
985424192 4:189812549-189812571 GGGGAATAGCAAGTGATCACTGG - Intergenic
985522046 5:378517-378539 GAGGACAAGCCAGTGAACTCAGG - Intronic
986134156 5:4958751-4958773 GGTGACGAGCAAGTGATTCCAGG + Intergenic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
996489867 5:124081303-124081325 GGAGACTAGCAAGAGAGTTCAGG - Intergenic
1013199297 6:107877202-107877224 GGTGACTAAATAGTGAACTGAGG - Intronic
1013219519 6:108065588-108065610 GGTCACTAGCTAGTGACCTTGGG + Intronic
1014199187 6:118589732-118589754 GGTGTATAGCAAGTGAAAGCAGG + Intronic
1020744940 7:12068810-12068832 GGTGATAATCAAATGAACTCGGG + Intergenic
1022589108 7:31643866-31643888 GGTGACCAGTTAGTGAACACAGG - Exonic
1030488065 7:110196347-110196369 GGTGACTAGCAAAGGATCACAGG - Intergenic
1032088263 7:128895009-128895031 GGTGATTTGCTAGTGAACTCTGG - Intronic
1033128745 7:138727239-138727261 GGTGAATAGCCACTGCACTCTGG + Intronic
1042657904 8:71120370-71120392 TGTGACTTGCAAGTGAAGTAGGG + Intergenic
1055871538 9:80886474-80886496 GGTTACTAGCCAGTGTACTGTGG + Intergenic
1056496125 9:87157125-87157147 GGGGACTAGCAAGTACCCTCTGG + Exonic
1187690435 X:21860729-21860751 TGTGACTAGCAACTGAGCTGGGG + Intronic
1190457212 X:50638017-50638039 AGAGACTAGCACTTGAACTCAGG + Intronic
1190937391 X:55008955-55008977 GGTGACCAACAAGTGACCTATGG + Exonic
1196812586 X:119640530-119640552 GGTCACTAGCAAGCTAACTCTGG - Intronic
1199593978 X:149492521-149492543 GGTGACTAGAAAGTTAGGTCCGG + Intronic
1201554453 Y:15254161-15254183 GGTGACATGCAACTGAACTTGGG - Intergenic