ID: 1179444728

View in Genome Browser
Species Human (GRCh38)
Location 21:41423260-41423282
Sequence CAGCAAATGGCAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 592
Summary {0: 1, 1: 5, 2: 33, 3: 119, 4: 434}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179444720_1179444728 30 Left 1179444720 21:41423207-41423229 CCAGAGGGGTGGACATCAGTGGT 0: 1
1: 0
2: 10
3: 48
4: 208
Right 1179444728 21:41423260-41423282 CAGCAAATGGCAGTGGTGGATGG 0: 1
1: 5
2: 33
3: 119
4: 434

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179444728 Original CRISPR CAGCAAATGGCAGTGGTGGA TGG Intronic
901988173 1:13092171-13092193 CAGCAACAGGCACTAGTGGAAGG - Intergenic
901993639 1:13134596-13134618 CAGCAACAGGCACTAGTGGAAGG + Intergenic
902840419 1:19070639-19070661 CAGCAAAGGGCAGGGGTTGGTGG + Intergenic
903071302 1:20728087-20728109 CTGCAAAGGGCAGGGGGGGAAGG + Intronic
903751559 1:25624752-25624774 AAGAAGATGGCAGAGGTGGAAGG - Intronic
904566735 1:31432799-31432821 CAGAAAATGGGAGTGGGGGTAGG + Intronic
904684471 1:32250498-32250520 CAGCCCCTGGCAGAGGTGGAGGG - Intergenic
906098002 1:43237035-43237057 CTGCAGGTGGCAGGGGTGGAGGG + Intronic
906881324 1:49594519-49594541 CAGGGACTGTCAGTGGTGGATGG - Intronic
906972229 1:50527759-50527781 CATCAAATGACACTGTTGGATGG - Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907554635 1:55333718-55333740 CAGGAAATGGGGGTGGTGAACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907602967 1:55788546-55788568 CAGCAAAAAGCCATGGTGGACGG + Intergenic
907679664 1:56551364-56551386 CAGGACTTGGCAGAGGTGGAAGG - Intronic
907869574 1:58431223-58431245 GAGCTAATGCCAGTGATGGAAGG + Intronic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
910515107 1:88052428-88052450 CAGCAAAAGGGAGTGGTCAATGG - Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
910892550 1:92032782-92032804 CATCACATGGCAGAGGAGGAAGG + Intronic
911633767 1:100211525-100211547 CAGACAAGGGCAGTGGGGGAGGG - Intronic
913173900 1:116256664-116256686 GAGCAGATGACAGTGGAGGAAGG - Intergenic
913439406 1:118882054-118882076 CAGTGAATGGCTGTGGTGGTTGG + Intergenic
915509847 1:156380800-156380822 CAGCAAATGGCAGCTATTGAAGG - Intronic
916183834 1:162111925-162111947 CAGTCCATGGCAGTGGTGGTTGG + Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917525175 1:175782040-175782062 GAGAAAAAGGCAGTGGGGGAGGG - Intergenic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919260443 1:195186558-195186580 CAAGAAATGGTAGTGGTGGTGGG - Intergenic
919684024 1:200465030-200465052 CAGCACATGGCAGTTGTGCAGGG - Intergenic
919821752 1:201477454-201477476 CAGAAAATGGCACAGCTGGAAGG - Intergenic
919845633 1:201640421-201640443 CAGCAAGTGGGAGTGGGGGATGG + Intronic
920056653 1:203197790-203197812 CAGCAAGTGGCAGAGCTGAATGG - Intergenic
920420261 1:205828386-205828408 CAGCAAATGCCAGTGGATCAAGG + Exonic
920441833 1:205985837-205985859 CAATAAATGGGAGTGGTGGTGGG - Intronic
920614999 1:207483257-207483279 CATCAGATGGCACTGGTGGCAGG - Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921048746 1:211495854-211495876 CAGCAAAGGGGAAAGGTGGAAGG - Intergenic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922820236 1:228479556-228479578 CTGTAAATGACAGTGGAGGAGGG - Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923902044 1:238336576-238336598 CAGCCAATGGCATTGGAGAAGGG + Intergenic
924826286 1:247542398-247542420 CAGCATATGGAAAAGGTGGAAGG + Intronic
1064346438 10:14536984-14537006 TAGAAAATGGCAGAGGAGGAGGG + Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065551428 10:26871817-26871839 TATCAAATGGCATTGGTTGAGGG - Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1066754887 10:38701076-38701098 CAGCACAGGGCAGTGATGCATGG + Intergenic
1068725703 10:60300338-60300360 CAGAGAATGGCAGTGGAAGAGGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1070664186 10:78331943-78331965 CAGCAAAGGCCAGGGGTGCAAGG + Intergenic
1070711891 10:78689061-78689083 CAGCACCAGGCAGAGGTGGAGGG - Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071327418 10:84530674-84530696 TGGCAAATGGCAGTTGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072188856 10:93064821-93064843 CAGAGAAGGGCAGTGGGGGAAGG - Intronic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1072931519 10:99667698-99667720 CAGCAAATTGGAATGGTGGGTGG + Intronic
1073204529 10:101761908-101761930 GAGCAAATGCCAGGGGTGGGGGG + Intergenic
1074164610 10:110864046-110864068 CTGCAAAGTGCAGTGGTGGCCGG + Intergenic
1074766313 10:116702471-116702493 CAGCAAATATCAGTGGAGGCCGG - Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075758502 10:124836415-124836437 AATCAAATGGCAGTGGTGTAAGG - Exonic
1075882122 10:125861761-125861783 CAGCAAAGGGAAATAGTGGATGG - Intronic
1076014830 10:127019172-127019194 GGGCAAATGGCAGGGTTGGATGG + Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077201877 11:1311846-1311868 CAGAATATGGCAGTGGTGATGGG + Intergenic
1079250449 11:18783181-18783203 CAGCAGATGGCAGTGGGAAATGG + Intronic
1079456874 11:20643911-20643933 AAGCAAATGTCAGGAGTGGAGGG + Intronic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1079933258 11:26590806-26590828 CTGCAAATGGCAGTGGTGGACGG + Intronic
1080122926 11:28698088-28698110 CAGCAAATAGCAGTTGAGGCTGG - Intergenic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1081037663 11:38169598-38169620 AAGCAAATGGGAGAGGAGGAGGG - Intergenic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1084137866 11:67200619-67200641 CAGCTAAAGGCTGAGGTGGAAGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085294119 11:75421120-75421142 CTGATAATGGCAGTGGAGGAGGG - Intronic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085763564 11:79262657-79262679 CAGCAAGTGGCAGAGGTGCTTGG + Intronic
1087430696 11:98050188-98050210 ATGGAAATGGAAGTGGTGGAGGG + Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088790371 11:113220356-113220378 TACCAAATGGAAGTGGTTGAGGG - Intronic
1088819659 11:113446539-113446561 TAGGAAGTGGCAGTGGAGGATGG + Intronic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089461246 11:118655683-118655705 CAGCCAAGGTCAGGGGTGGAGGG + Exonic
1089697904 11:120227053-120227075 CAGCACAGAGCAGTGGAGGAGGG + Intronic
1090978380 11:131695000-131695022 CACCAGAGGGCAGTGTTGGACGG + Intronic
1091402023 12:186922-186944 CAGCAGAGGGCAGTGGTTGGGGG - Intergenic
1091812358 12:3409949-3409971 CAGCAACTGGGAGGCGTGGATGG + Intronic
1091822595 12:3487402-3487424 CAGCAAAAGGAAGTGTTGGTTGG + Intronic
1092756297 12:11766528-11766550 CAGCTAATGGCGGGGGTGGGAGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094123759 12:27000892-27000914 AAGCAGATGGGAGTGGGGGATGG - Intronic
1094426199 12:30320002-30320024 CACCAAATGGGAGGAGTGGAAGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095552470 12:43459166-43459188 CAGCAAACAGCAGTGGTAGGCGG - Intronic
1096004519 12:48158148-48158170 CAGCACATGGTGGTGGTGCATGG + Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096370414 12:51064476-51064498 CTGCAACTGGCAGTCGGGGAGGG + Exonic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097533338 12:60834029-60834051 CAGCAGATGGCAGGGCTGGGTGG - Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098611883 12:72468756-72468778 CAGCAACAGGCAGTGGCGGCTGG - Intronic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1101555299 12:105803059-105803081 CGGCAAGTAACAGTGGTGGATGG + Intergenic
1102981728 12:117247051-117247073 CACCAAATGGGAGTGACGGATGG + Intronic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1104916445 12:132267258-132267280 CAGCTTGTGGCAGGGGTGGATGG + Intronic
1105442697 13:20428760-20428782 CTGCAGATGGCAGGGGTGGCAGG + Intronic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1108557253 13:51606010-51606032 TGGCAAAAGGCAGTGTTGGATGG + Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109018787 13:57056963-57056985 GAGCAAATGTCAAGGGTGGACGG - Intergenic
1109212258 13:59548065-59548087 CAGCAACTGGGAGAGGTAGATGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1109998289 13:70159163-70159185 GAGAGAATGGAAGTGGTGGAGGG - Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113605975 13:111606426-111606448 CACCAAATGGCAGTGCTGGGGGG + Intronic
1114325672 14:21586687-21586709 CAGAAATTGGCAGTGGGAGATGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1116740324 14:48746699-48746721 CAACAAACAACAGTGGTGGATGG - Intergenic
1116991168 14:51278231-51278253 CAGGAAATGGCGGTGGTGGTGGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117517236 14:56513970-56513992 CAGTAAATTGAAGTGGTGGGGGG + Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120306178 14:82773453-82773475 CAGCAACTGGCAGTGGTAACTGG - Intergenic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1120597067 14:86453513-86453535 CAGCAAATGAAGGCGGTGGATGG + Intergenic
1121221972 14:92292372-92292394 CACCAAAGGGCAGTGTAGGATGG + Intergenic
1121556390 14:94840973-94840995 TACCAAATGACAGAGGTGGAAGG - Intergenic
1122199447 14:100113634-100113656 CAGCAAGTGTGAGGGGTGGAGGG + Intronic
1122910530 14:104825812-104825834 CAGGAAATGGCTGGGGCGGAGGG + Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1124722506 15:32122163-32122185 CAGCACATCGCAGTGGGTGAGGG + Intronic
1125025119 15:35021929-35021951 CAGATAATGGCAGTGGTGAGTGG - Intergenic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126511969 15:49487898-49487920 AAGTAAATGGCAGTGGAGTAGGG - Exonic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1127964968 15:63916509-63916531 CAGCGAAGGGGAGGGGTGGAGGG - Intronic
1128059967 15:64729155-64729177 CAGCAGCTGGCAGGGGTTGAGGG + Intergenic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128582855 15:68820983-68821005 CAGCCAATGGCAGTGGCGGCGGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1131775351 15:95790298-95790320 CAGAAAATGCAAGTGGTAGAAGG - Intergenic
1132320991 15:100925240-100925262 AAGCAAATGTCACTGATGGACGG - Intronic
1132604955 16:789781-789803 AAGCAAATGGCAGGGGTGAGGGG - Intronic
1133282219 16:4673290-4673312 CAGCACCTGGCAGAGGGGGAGGG - Intronic
1135961259 16:26996313-26996335 CAGTAAGTGCCAGAGGTGGAGGG - Intergenic
1136509239 16:30725589-30725611 GAGTCAATGGCACTGGTGGAAGG - Intronic
1136727799 16:32375762-32375784 CAGCACAGGGCAGTGATGCATGG - Intergenic
1137038513 16:35588506-35588528 CAGCAAGTGGCAGTGCTGATTGG + Intergenic
1137039126 16:35593336-35593358 CAGCTGATGTCAGGGGTGGAGGG + Intergenic
1138025304 16:53517637-53517659 CAGCAAGTGGCCATGCTGGAAGG - Intergenic
1138154793 16:54693204-54693226 TTGCAAATTGCAGTGGTGGAGGG - Intergenic
1138212921 16:55178351-55178373 TAGGATATGGCAGTGGAGGAAGG - Intergenic
1138799695 16:60012885-60012907 CAGCAAATGGAAGGGGTGAGGGG + Intergenic
1139296643 16:65907191-65907213 AAACAATTGGCAGTGGTGCAGGG + Intergenic
1139504596 16:67392658-67392680 CAGGAGGTGGCAGTGGAGGAGGG - Intronic
1139731856 16:68952624-68952646 GAGAACTTGGCAGTGGTGGAAGG + Intronic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1202998636 16_KI270728v1_random:141992-142014 CAGCACAGGGCAGTGATGCATGG + Intergenic
1203130233 16_KI270728v1_random:1678396-1678418 CAGCACAGGGCAGTGATGCATGG + Intergenic
1143165508 17:4895445-4895467 CAGCAGATGGATGTGCTGGAGGG + Exonic
1144068512 17:11645823-11645845 CACCTAATAGCAGAGGTGGAAGG - Intronic
1144306426 17:13972961-13972983 CAGAAAAGGGCAGTGGTTTATGG - Intergenic
1145759750 17:27419414-27419436 CACCTGAGGGCAGTGGTGGAAGG + Intergenic
1148250571 17:46075944-46075966 CATAAAATGGGAGTGCTGGAGGG - Intronic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148439601 17:47704893-47704915 GAGCAAATGGCAGAGCTGGCAGG - Intronic
1148661296 17:49335395-49335417 CATTAAATGTCAGTCGTGGAAGG - Intronic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149563137 17:57623692-57623714 CTGCTAATGGAAGTGGTGGCTGG + Intronic
1150211547 17:63444788-63444810 CATTAGATGGCATTGGTGGAGGG - Intronic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151869058 17:76824245-76824267 CATCAAATGGCAGGGAGGGAGGG - Intergenic
1152167128 17:78717076-78717098 CAGCACGTGGCAGTGGGGGAGGG - Intronic
1152218475 17:79048118-79048140 CAGCACAGCGCAGGGGTGGAAGG - Exonic
1152839971 17:82561170-82561192 GAGCTGATGGCACTGGTGGATGG + Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153724041 18:7937142-7937164 CACCAAATGGCAGGGCTGCAAGG + Intronic
1154169015 18:12037425-12037447 CAGCAAAATGGAGTGGTGGGAGG - Intergenic
1154487485 18:14885301-14885323 AAGTAAATGGCAGTGGGGTAGGG + Intergenic
1155035011 18:22018758-22018780 AAGCCACTGGCAGTGGTGGTGGG + Intergenic
1155655006 18:28182076-28182098 CAGCAACTGGGAGAGGTGAAAGG - Intergenic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1156331308 18:36126480-36126502 CAGAACATGCCAGTGGTAGAAGG - Exonic
1156393211 18:36672519-36672541 GTTCAAATGGCAGTGGTGTAGGG + Intronic
1156465705 18:37346892-37346914 CAGCATTGGGGAGTGGTGGACGG + Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158669376 18:59461251-59461273 CAGCAAGGGCCAGTGGTGGCGGG - Intronic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1160874213 19:1289787-1289809 CAGCAGAGGGCAGAGGTGAACGG + Intronic
1162063159 19:8109134-8109156 CTGCTAATGGCGGTGGTGGGGGG - Intronic
1163421026 19:17213692-17213714 CAGCACATGCCAGAGGTTGAGGG + Intronic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164509503 19:28885847-28885869 AAGCAAATGGCAGTGGAGAAGGG - Intergenic
1164690626 19:30208424-30208446 CAGCAAGTGGCAGGGGTGAGGGG + Intergenic
1164856395 19:31527868-31527890 CAGCAAAATGCAGTTGTAGAGGG - Intergenic
1165093342 19:33397678-33397700 CAGCAAAGCCCAGTGGTGGGTGG + Intronic
1167445225 19:49533646-49533668 CAGCACAGGGCAGGGCTGGAGGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168210106 19:54884063-54884085 CTGCAAGTGGCAGGGGTGGGTGG + Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
928123762 2:28602359-28602381 CAGAAGATGGTGGTGGTGGAGGG - Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928674557 2:33637542-33637564 CAGCCAAATGCAGTGGTGGCAGG + Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929213932 2:39390585-39390607 CAGCAAGAGGCACTGGAGGAAGG + Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929695741 2:44113754-44113776 TTGAATATGGCAGTGGTGGAAGG - Intergenic
929824043 2:45296187-45296209 AAGGAAAGGGCAGAGGTGGAAGG - Intergenic
930570314 2:53077811-53077833 CAGCAACTGGGAGGGGTAGATGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
934318171 2:91945311-91945333 CAGCACAGGGCAGTGATGCATGG + Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
935958000 2:108397862-108397884 CAGCAAAAGGTGGTGGTGGTGGG - Intergenic
936065578 2:109329564-109329586 CAGCAAGTTTCAGAGGTGGAAGG + Intronic
936292462 2:111236764-111236786 CTGCAAATGGCTGTGGGGGGTGG + Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937076085 2:119107939-119107961 CAGAAAGTGGCAGTGGAGAAAGG + Intergenic
937352286 2:121173635-121173657 TAGGATATGGCAGTGGGGGAAGG + Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
937905060 2:127049124-127049146 CAGCCACTGGCAGGAGTGGATGG - Intronic
937913490 2:127087615-127087637 CAGCCAAGGGCAGTGCAGGACGG + Intronic
938035702 2:128033142-128033164 TGGCAAATGGCAGAGGTGGTGGG + Intergenic
938603890 2:132872553-132872575 CAGCCAAGGGCTGGGGTGGAGGG + Intronic
938692367 2:133803628-133803650 CAGTAAATGGCAGGGGAGGTGGG - Intergenic
939067121 2:137496944-137496966 CAGCAAATTGCAGAAGTGGAAGG + Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939494109 2:142907501-142907523 TGGCAAATAGCAGTTGTGGATGG + Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941335058 2:164231720-164231742 CATCAAATGGCAGTAGGAGATGG - Intergenic
942179486 2:173366495-173366517 CAGAAAAAGGCATTGGTGAAGGG + Intronic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942830304 2:180232054-180232076 TGGCGAATGGCAGTGGTGGATGG - Intergenic
942892045 2:181002093-181002115 CAGCAAATGCTAGGTGTGGAAGG - Intronic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
943263597 2:185697382-185697404 CATCAAATGGAAGTTGTGCATGG + Intergenic
943345946 2:186737132-186737154 TAGGGAATGGCAGAGGTGGATGG + Intronic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
946759829 2:222982657-222982679 TCGCAAATGGGAGTGGGGGAAGG - Intergenic
947610918 2:231524709-231524731 CAGAAACTGGCAGTGGTGGCAGG + Exonic
947758946 2:232589139-232589161 CAGCGAGAGGCAGTGCTGGATGG - Intergenic
948445567 2:238030228-238030250 CAGAAAATGACAATGGTGGCTGG - Intronic
948981143 2:241495480-241495502 CAGCACACTGCAGGGGTGGAAGG + Exonic
1168976911 20:1973667-1973689 CTGCCAGTGGTAGTGGTGGATGG - Intergenic
1170231204 20:14048937-14048959 CAGCAAGTGGGAGTGGAGCAAGG + Intronic
1170447834 20:16448039-16448061 CAACAATTGGCAGTGGAGGTAGG - Intronic
1170953025 20:20953808-20953830 CAGCAAATTGCTGCAGTGGAAGG + Intergenic
1170961361 20:21028599-21028621 TAGCAAATGGCAGCAGTGGGAGG - Intergenic
1171187892 20:23136614-23136636 CAGCAAGCCGCAGAGGTGGACGG + Intergenic
1171355681 20:24543829-24543851 CTGCAGATGGCAGTGCTGGTGGG + Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172240234 20:33408261-33408283 CTGCAAAAGGCACTGGTGGAGGG + Exonic
1172827767 20:37805035-37805057 CAGCAGCTGGCAGGGGTGGCAGG - Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173899969 20:46580580-46580602 CAGTAAAAGCCAGAGGTGGAAGG + Intronic
1174216484 20:48920552-48920574 TAGGAAATGGAAGGGGTGGAGGG - Intergenic
1174772801 20:53317083-53317105 TAGCAAAAGGCAGTGGTCCAAGG + Intronic
1174846091 20:53944603-53944625 ATGAAAATGGCAGTGGTGGCCGG - Exonic
1175544289 20:59768377-59768399 CAGCAAATGGCAATTATTGATGG - Intronic
1175976542 20:62713155-62713177 CAGAAAATGGCAATGATGAAAGG - Intronic
1176793794 21:13354033-13354055 AAGTAAATGGCAGTGGGGTAGGG - Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177320495 21:19513712-19513734 CTATAAATGGCAGGGGTGGATGG - Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177833770 21:26169483-26169505 CTGGAAAGGGCAGTGGCGGATGG - Intronic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179444728 21:41423260-41423282 CAGCAAATGGCAGTGGTGGATGG + Intronic
1179666092 21:42913544-42913566 GAGCACAGGGCACTGGTGGAGGG + Intergenic
1179943969 21:44658214-44658236 CTGCAGAGGGCAGTGGTGCAGGG - Exonic
1180306347 22:11128995-11129017 CAGCACAGGGCAGTGATGCATGG + Intergenic
1180544866 22:16491178-16491200 CAGCACAGGGCAGTGATGCATGG + Intergenic
1180834456 22:18922869-18922891 CACCAAATGGCTGTGGAGCAAGG - Exonic
1181633893 22:24165462-24165484 CACCACATGGCACTGCTGGATGG - Intronic
1182352458 22:29706552-29706574 CAGCAAATGGGTGTGGGGGCTGG + Intergenic
1182685781 22:32121048-32121070 CTGCCAGTGGCAGGGGTGGAGGG - Intergenic
1184191454 22:42897941-42897963 GAGCAAATGGCAATGAGGGAGGG + Intronic
1184791703 22:46704029-46704051 TAGCAAATGCCACTGGGGGAGGG - Intronic
1203284545 22_KI270734v1_random:148168-148190 CACCAAATGGCTGTGGAGCAAGG - Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950111879 3:10423886-10423908 GTGCAAAGGGCAGTGGTGGTGGG + Intronic
950186336 3:10947938-10947960 GAGCAAAGGGCACTGGTGGAAGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951140107 3:19148428-19148450 CAGCAGCTGGCGGGGGTGGAGGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
951578789 3:24140403-24140425 CATCAAATGGCAGTAGAGGCTGG + Intronic
951699579 3:25481763-25481785 AAGCAAATGGAAGTGGTAAAAGG - Intronic
952556502 3:34537560-34537582 CAGAAAGAGGCAGTGGTGCAGGG + Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
953769743 3:45771068-45771090 CAGCAACTGGTGGTGGTGTAGGG + Intronic
954106415 3:48412039-48412061 CAGCAGGTGGCAGAGGTGTATGG + Intronic
954365963 3:50146339-50146361 CTCCAAATGTCAGTGGTAGAGGG + Intergenic
954624798 3:52016572-52016594 CAGGAATTGGCACTGTTGGAAGG - Intergenic
954700427 3:52447930-52447952 CAGGAAGGGGCAGTGGGGGAAGG - Intergenic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
956025928 3:64983213-64983235 CAACAACTGGCAGTGCTGGAGGG - Intergenic
956068713 3:65424562-65424584 CAGCAAAAGCCAGTGGGAGATGG + Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957211012 3:77258671-77258693 CAGCAAAAGGAAGTGTTGAAAGG - Intronic
957296912 3:78344277-78344299 CGGCAAACCCCAGTGGTGGATGG + Intergenic
957557721 3:81782297-81782319 CAGCAAACAACAATGGTGGATGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958061257 3:88484496-88484518 CAGTATATGGGAGTGGAGGATGG + Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
959326135 3:104938774-104938796 CACAATTTGGCAGTGGTGGAAGG + Intergenic
959406341 3:105966161-105966183 CAGCGATCGGCAGTGGTTGACGG - Intergenic
959456651 3:106571239-106571261 CAGAAAATGGCAGGGGAGGAGGG + Intergenic
959745363 3:109770034-109770056 CAGCATCTGGCAGTTCTGGAAGG - Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960057543 3:113285874-113285896 CAGCAAATGGAATTTGTGAATGG - Intronic
960255172 3:115504002-115504024 CAGAAAATGGGGGTGGTGGATGG - Intergenic
960432034 3:117581083-117581105 GAGCAAATGGGGGTGGGGGAAGG - Intergenic
961118866 3:124356170-124356192 AAGCCAATGGCAGGGGTCGAGGG - Intronic
961325423 3:126106538-126106560 CATCAACAGGCCGTGGTGGAAGG + Intronic
961435268 3:126912449-126912471 CAGCAGCTGGCTGTGGTGGGAGG + Intronic
961749009 3:129084756-129084778 CAGCACATGGCAGAGGAGGCCGG - Intergenic
962314610 3:134351233-134351255 CAGTGAATGGCAATGGGGGATGG + Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963315967 3:143759182-143759204 CAGGAAATAGCAGTGTTAGATGG - Intronic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
963822005 3:149907683-149907705 CAGCATATAGCATTGCTGGAAGG + Intronic
965030964 3:163367469-163367491 CAGCAAATGAGAGGGGTGGGGGG - Intergenic
965113041 3:164451556-164451578 CAACAAATAGCAGGGGTGGGTGG + Intergenic
967023799 3:185546276-185546298 CAGCAGGTGGCAGTTGTGGTGGG + Intronic
967804948 3:193707537-193707559 CAGCAAATGGCAGTGATACCTGG + Intergenic
969148023 4:5141406-5141428 CAGGCAATGGGAGTGGTGCAAGG + Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
970354267 4:15236598-15236620 CAGCCAATGGAAGAGGTGCATGG - Intergenic
970437305 4:16048093-16048115 AACCAAATGGGAGTGCTGGAAGG - Intronic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
971250079 4:24967251-24967273 CAGCAAATGGTATTGATGGGTGG - Intronic
971381656 4:26104119-26104141 TAGGAAATGGCAGAGCTGGAAGG + Intergenic
972726052 4:41747051-41747073 CAGGAAGTGCCTGTGGTGGAAGG - Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974115357 4:57572146-57572168 CATCTCATGGCAGAGGTGGAAGG + Intergenic
974477163 4:62398188-62398210 CAGCAAATTACATTGGTGAAAGG - Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975957820 4:79863079-79863101 CAGCAAATTGCAGTGGCATATGG + Intergenic
976189289 4:82473690-82473712 CAGCAATCAGCAGTGGTAGATGG - Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
976787896 4:88843214-88843236 CAGGAAATGGCAGTTCTGCAGGG + Intronic
976899970 4:90160593-90160615 AATCAAATGGCAGTTGTAGAAGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
977950658 4:102966598-102966620 CAGCACAGGGCAGTGATGCATGG + Intronic
978110921 4:104963479-104963501 CTGGAAATGGCAGCAGTGGATGG + Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979724346 4:123942550-123942572 CAGCAAATGGGGGTGGGGGCGGG - Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
981107498 4:140897559-140897581 GAGTAAATGGCAGGGCTGGAGGG - Intronic
982056853 4:151559415-151559437 CAGCACAGGGCAGTGGGGGCTGG - Intronic
982406593 4:155027305-155027327 CAGCAAAAGGCAGTGGGTGGCGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983354960 4:166645231-166645253 CATCACATGGCAATGGAGGAAGG + Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
984365393 4:178792990-178793012 GAGCAAAAAGCAGAGGTGGAGGG - Intergenic
984392397 4:179152663-179152685 CAAGAAATTGCAGTGATGGAAGG + Intergenic
984832476 4:183988336-183988358 CAGCAAGTGGCTGTGATGTACGG + Intronic
984929616 4:184835169-184835191 GTGCAAATGGAAGTGGAGGATGG - Intergenic
985226354 4:187765516-187765538 CAGCTAACAGTAGTGGTGGATGG - Intergenic
985451003 4:190062470-190062492 CAGCAGTTGGCAGTGCTGCACGG + Intergenic
986332176 5:6725570-6725592 CAGCAAATGGCAGTGTAAGATGG - Intronic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988782146 5:34532153-34532175 CAGCTGTTGGCAGTGGCGGATGG + Intergenic
988806144 5:34742622-34742644 CAGCAAACTGCAGTAGTGTATGG - Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
991290608 5:65030855-65030877 CCGGAAACGGCAGTGGTGGATGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992414630 5:76540470-76540492 CAGTAAGTGGCAGTGGTAGTGGG + Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994163521 5:96583875-96583897 CAGCAAGTGGTAGTGGTAGAGGG + Intronic
994511817 5:100713542-100713564 TAGAAAATGGCAGTGGTTGCAGG - Intergenic
995187265 5:109285033-109285055 CAGCAAAAAGCAGTGCTAGAAGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
996185880 5:120474690-120474712 AAAAAAATGGAAGTGGTGGATGG - Intronic
996849656 5:127937998-127938020 CAGCAGGGGGCAGGGGTGGAGGG - Intergenic
997214287 5:132097435-132097457 CAGCAAATCTCAGTGGTGTGGGG + Intergenic
999141365 5:149364567-149364589 CTGCAGATGGCTGCGGTGGAGGG - Intronic
999370100 5:151049707-151049729 CAGCCAGTGCCAGTGGTAGAAGG - Intronic
999880505 5:155858641-155858663 AAGCAAATGAAAGTGGTGTATGG + Intergenic
1001247788 5:170117987-170118009 CAGGGAATGGCGGTGGGGGAAGG + Intergenic
1001403658 5:171461181-171461203 CAGCAGAGGGCAGTGGGGAAGGG + Intergenic
1003183941 6:3814199-3814221 CTGGTAATGGCAGTGGTGGGTGG - Intergenic
1004001532 6:11601199-11601221 CAGGGAATGAGAGTGGTGGAAGG - Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005282338 6:24287294-24287316 GAGCAAATGGCAGGGGAGGAGGG - Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005362146 6:25041012-25041034 TAGCAATAGGCAGTGGTAGAGGG - Intronic
1005610934 6:27524424-27524446 CAGCCAAGCCCAGTGGTGGAAGG + Intergenic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1006146021 6:31960217-31960239 CAGAAAATGGCAGAGGAAGACGG + Exonic
1006511123 6:34521709-34521731 CAGGCAACGGCGGTGGTGGATGG + Intronic
1006569730 6:34992289-34992311 CATCAAATGCCAGAGCTGGAAGG - Intronic
1006739248 6:36295444-36295466 CAGGTAAGGGCAGTGTTGGAGGG + Intronic
1006877230 6:37308377-37308399 CAGCAAAAAGCAGTGGAGAAAGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1010346301 6:74814991-74815013 CAGCAACTGGAAGGGGTAGATGG - Intergenic
1010388918 6:75313880-75313902 CAACAATTGGAAGTGGTCGAAGG - Exonic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1011560565 6:88609610-88609632 AACAAAATGGCAGGGGTGGATGG + Intergenic
1012263408 6:97113401-97113423 CAGGAAATGTCAATGGTGGGAGG - Intronic
1012417230 6:99024168-99024190 CAGCAAATGGTATTGATGGGTGG + Intergenic
1012666871 6:101982158-101982180 CAGCAAATAGAATTGGTGGGTGG + Intronic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1012935909 6:105366915-105366937 CAGGTGATGGCAGTGGTGGGTGG + Intronic
1012964185 6:105655791-105655813 CACTAAAAGGCAGTGGTGAAGGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014752414 6:125270019-125270041 CAGCAAATGGTATTGATGGGTGG - Intronic
1015460106 6:133480927-133480949 CAAGAAATGGGAGAGGTGGAAGG + Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1018171160 6:161144154-161144176 CAGCAAGTGGAAGTGGTGCATGG - Intronic
1018481995 6:164200297-164200319 CAGAAAACTGCATTGGTGGATGG + Intergenic
1018789259 6:167134041-167134063 CAGAGCATGGCAGGGGTGGAGGG - Intronic
1018999994 6:168742106-168742128 CAGCAAATGGCCTAGTTGGAGGG - Intergenic
1019254959 7:43750-43772 CAGCAAATGGCAGACGTGGTAGG + Intergenic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021380630 7:19961833-19961855 CAACAAATGACATTGGTGGCAGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1021946625 7:25734025-25734047 CTGCAAATGAGAGTGGTGGTTGG - Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023024174 7:36035999-36036021 CAGCAAATGGCATAAGTGAAGGG + Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024517119 7:50268489-50268511 CAGCAGATGGCAGTGGTTGCTGG - Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1026562443 7:71461763-71461785 CAGGAAAAGGCAGAGGAGGAGGG - Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029361119 7:100089214-100089236 CTGGAGATGGCAGTGGGGGACGG - Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030372421 7:108715319-108715341 ACACAAATGGCTGTGGTGGAAGG + Intergenic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030564663 7:111138387-111138409 CAGGAAATGCCAGTGCTGGAGGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031127449 7:117791199-117791221 GAGCAAAAGGCAATGGTGGTAGG + Exonic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031350326 7:120722914-120722936 CAGCAAGTGAGAGTGGTGGCTGG + Intronic
1031518415 7:122731054-122731076 CAGCAAATGGTGGTGGGGGTGGG + Intronic
1031832123 7:126640687-126640709 CAGAAAATGACAGGGATGGAAGG - Intronic
1032558469 7:132862508-132862530 CAGCAAGTCACACTGGTGGAGGG + Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034598457 7:152223007-152223029 CTGCAAATGGCAGTGCTAGCAGG + Intronic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034950084 7:155291094-155291116 CAGCAGATAGCAGTGGCAGAGGG - Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035034966 7:155888841-155888863 CAGACAATGCAAGTGGTGGAGGG + Intergenic
1035726512 8:1827642-1827664 CAGGAAATGGCAATGATGGAAGG - Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037953009 8:23030919-23030941 CAGAAGCTGGCAGTGGTGGCTGG + Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1043522545 8:81061927-81061949 CAGCAAATGGGAGGGATGGGAGG + Intronic
1044212005 8:89561365-89561387 CACCAAAAGGCAGTGGTAAAAGG - Intergenic
1044807372 8:96021821-96021843 CAGCTCATGGAATTGGTGGAAGG + Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046836514 8:118807698-118807720 CTGCACATGGTAGTGATGGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048256177 8:132906775-132906797 CAGCAATTGGCACTGCTGCATGG - Exonic
1048473187 8:134721315-134721337 CAGCAGTTGGCACTGGTAGAAGG - Intergenic
1048568940 8:135634043-135634065 CAGCAACTGACAGGGGTTGAGGG - Intronic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1050112052 9:2227368-2227390 CTGCAAGTGGCAATAGTGGAAGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1052260826 9:26514501-26514523 CAGCAGATGCCAGTTGTAGAAGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053620842 9:39814122-39814144 AAGTAAATGGCAGTGGGGTAGGG + Intergenic
1054263320 9:62893320-62893342 AAGTAAATGGCAGTGGGGTAGGG - Intergenic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1055950370 9:81724561-81724583 GAGCAACTGGAAGAGGTGGAGGG + Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1057051483 9:91927486-91927508 TAGCAAATGGAGGTGGTGAATGG - Intronic
1057307845 9:93922369-93922391 CAGCAAGTGGCAGGGGTGACAGG + Intergenic
1058999118 9:110329913-110329935 CAGGAAATGGAAGGGGAGGAGGG + Intronic
1059175780 9:112169048-112169070 CACCAAATTCCAGAGGTGGAAGG + Intronic
1059228866 9:112698664-112698686 CACCAAATGGCAGTGGGGTCAGG - Intronic
1060242400 9:121915092-121915114 CAGTCACTGGCAGTGGTGGTGGG + Intronic
1060306806 9:122421067-122421089 TAGCTAATGGCAGTCATGGAGGG - Intergenic
1061996649 9:134189589-134189611 CAGAAATTGAGAGTGGTGGAGGG + Intergenic
1062011836 9:134271447-134271469 TAGAAAATGGCAGAGGTGAAGGG + Intergenic
1062326930 9:136016973-136016995 CAGCAAGGGGCAGTGGGGCATGG + Intronic
1185824987 X:3241422-3241444 CAGCCAATGGAAGAGGTGCATGG + Intergenic
1187240550 X:17509142-17509164 CAGCAAATGGTGGTGTTGGGAGG + Intronic
1187366279 X:18668064-18668086 CAGAAAATAGCATTGTTGGAAGG + Intronic
1187792962 X:22970781-22970803 CAGCAAGTGACAGAGGTTGAGGG + Intergenic
1188073401 X:25745708-25745730 CAGCAAATGACAGTTGTGGCTGG - Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1189843605 X:45109288-45109310 CATTAAATGGCAGAAGTGGAAGG + Intronic
1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG + Intergenic
1190286888 X:48967285-48967307 CAGCAGATGGTAGGGGTTGAGGG - Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192282216 X:69699064-69699086 TAGGAAAAGGCAGTGGCGGAGGG + Intronic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1195077386 X:101339973-101339995 CAGAAAATGGCTGAGGTGGGAGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1195869709 X:109473197-109473219 CAGCAACAGGAAGTGGAGGAGGG - Intronic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1196848931 X:119919068-119919090 CAGGAAATGAGACTGGTGGAGGG + Intronic
1197545332 X:127816606-127816628 CGGGAAATGGCAGTAGTGGACGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1201185728 Y:11400393-11400415 CAGCACAGGGCAGTGATGCATGG + Intergenic
1201254319 Y:12092011-12092033 CAGCAAATGAAAGAGGTGCATGG - Intergenic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic