ID: 1179445105

View in Genome Browser
Species Human (GRCh38)
Location 21:41425652-41425674
Sequence CCAGGGTGGAAACGGGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 244}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179445105_1179445118 18 Left 1179445105 21:41425652-41425674 CCACACACCCGTTTCCACCCTGG 0: 1
1: 0
2: 2
3: 26
4: 244
Right 1179445118 21:41425693-41425715 ACTCCAGGGAGGCCTAGAAGTGG 0: 1
1: 0
2: 0
3: 16
4: 213
1179445105_1179445123 26 Left 1179445105 21:41425652-41425674 CCACACACCCGTTTCCACCCTGG 0: 1
1: 0
2: 2
3: 26
4: 244
Right 1179445123 21:41425701-41425723 GAGGCCTAGAAGTGGGCAAGGGG 0: 1
1: 0
2: 0
3: 22
4: 238
1179445105_1179445121 24 Left 1179445105 21:41425652-41425674 CCACACACCCGTTTCCACCCTGG 0: 1
1: 0
2: 2
3: 26
4: 244
Right 1179445121 21:41425699-41425721 GGGAGGCCTAGAAGTGGGCAAGG 0: 1
1: 0
2: 2
3: 28
4: 335
1179445105_1179445122 25 Left 1179445105 21:41425652-41425674 CCACACACCCGTTTCCACCCTGG 0: 1
1: 0
2: 2
3: 26
4: 244
Right 1179445122 21:41425700-41425722 GGAGGCCTAGAAGTGGGCAAGGG 0: 1
1: 0
2: 3
3: 24
4: 313
1179445105_1179445114 4 Left 1179445105 21:41425652-41425674 CCACACACCCGTTTCCACCCTGG 0: 1
1: 0
2: 2
3: 26
4: 244
Right 1179445114 21:41425679-41425701 GCCAGATGAGCCAGACTCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 204
1179445105_1179445119 19 Left 1179445105 21:41425652-41425674 CCACACACCCGTTTCCACCCTGG 0: 1
1: 0
2: 2
3: 26
4: 244
Right 1179445119 21:41425694-41425716 CTCCAGGGAGGCCTAGAAGTGGG 0: 1
1: 0
2: 2
3: 19
4: 230
1179445105_1179445116 7 Left 1179445105 21:41425652-41425674 CCACACACCCGTTTCCACCCTGG 0: 1
1: 0
2: 2
3: 26
4: 244
Right 1179445116 21:41425682-41425704 AGATGAGCCAGACTCCAGGGAGG 0: 1
1: 0
2: 1
3: 17
4: 208
1179445105_1179445113 3 Left 1179445105 21:41425652-41425674 CCACACACCCGTTTCCACCCTGG 0: 1
1: 0
2: 2
3: 26
4: 244
Right 1179445113 21:41425678-41425700 GGCCAGATGAGCCAGACTCCAGG 0: 1
1: 0
2: 1
3: 17
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179445105 Original CRISPR CCAGGGTGGAAACGGGTGTG TGG (reversed) Intronic
900160930 1:1223497-1223519 CAGGTGAGGAAACGGGTGTGGGG - Intronic
900637688 1:3674034-3674056 CCTGGTTGGTAACAGGTGTGTGG + Intronic
900712821 1:4125221-4125243 CCAGCATGGACAGGGGTGTGCGG + Intergenic
900783154 1:4631046-4631068 CCAAGGAGGAAACGGGGCTGGGG + Intergenic
901320112 1:8334877-8334899 ACAGGATGGAAACGGGTGCGAGG - Intronic
902145192 1:14392733-14392755 CCTGGGCGGAGGCGGGTGTGGGG + Intergenic
902332584 1:15737898-15737920 GCAGAGAGGACACGGGTGTGGGG - Intronic
902606047 1:17569942-17569964 CCAGAGTGGAAAGAGGTCTGGGG - Intronic
902606964 1:17574133-17574155 CCAGGGTGGAAGGGGGAGTAGGG - Intronic
902843115 1:19087966-19087988 CTAGGGTGGGAGAGGGTGTGTGG - Intronic
902992605 1:20199678-20199700 CCAGTGTGTAAACGGGGGTGTGG + Intergenic
903325080 1:22564658-22564680 CCAGGGAGCTAACGGGTGTGTGG - Intronic
903939885 1:26922193-26922215 TCAAAGTGGAAACGGGGGTGGGG - Intronic
905126646 1:35720012-35720034 CCAGGGTGCAAAAGAGTGAGGGG - Intergenic
906999253 1:50833384-50833406 ACAGGGTGGTAAGGTGTGTGGGG + Intronic
907863116 1:58372676-58372698 CGAGGGAGGAACCTGGTGTGGGG + Intronic
909379524 1:74982370-74982392 CAAGGGAGGAAACTGGTGGGAGG + Intergenic
909473700 1:76058251-76058273 CCACGGTGGAAAACAGTGTGGGG + Intergenic
911386212 1:97178571-97178593 CAAGGGTGGAACCTGGTGAGAGG - Intronic
912062037 1:105686155-105686177 GCAGAGTGGCAAAGGGTGTGTGG + Intergenic
912432712 1:109637669-109637691 CGAGGGTGGAACAGGGTGTGAGG + Intergenic
919006653 1:191908170-191908192 CCTGGGAGGAAACTGGTGGGAGG - Intergenic
919028174 1:192203689-192203711 TCAGGGAGGAAACTGGTGGGAGG - Intergenic
919986754 1:202681088-202681110 CCAGGGTGGGACCAGGGGTGGGG - Intronic
920654855 1:207867778-207867800 CCAGGGTGGTGACGGTTTTGCGG - Intergenic
922345895 1:224696097-224696119 CCAGGCTGGAATGGGGTGGGTGG + Intronic
922988726 1:229886811-229886833 CCAGGGTGGATGCGGGTCTTTGG + Intergenic
923928997 1:238671722-238671744 ACAGGTTGGAAAGGGTTGTGGGG + Intergenic
923968598 1:239173284-239173306 CAAGGGAGGAACCTGGTGTGAGG + Intergenic
1062819440 10:523251-523273 CTCAGGTGGAAACGAGTGTGTGG - Intronic
1065204303 10:23343298-23343320 GCAGGGTGGGAGCGGGTGTGGGG + Intronic
1067666909 10:48286835-48286857 TCAAGGAGGAAAAGGGTGTGTGG + Intergenic
1068874912 10:61985555-61985577 CCAGGGTGTTAATGGGTATGAGG + Intronic
1070811884 10:79302218-79302240 TCAGGGTGGGGACGGGGGTGAGG + Intronic
1071434240 10:85632216-85632238 TCAGGGTGGAAAAGGGTGGAGGG - Intronic
1072415860 10:95246236-95246258 CCAGGGAAGAAGCGGGTGTGAGG + Intronic
1074311683 10:112327938-112327960 CCAGGGAGGAATGGGGTGGGGGG + Intergenic
1079078894 11:17400230-17400252 CCAGGGTGGAGACGTGTGGGAGG + Intronic
1081612041 11:44568575-44568597 CCAGGGAGGATAGGGGTGAGAGG + Intronic
1083695096 11:64437379-64437401 CTGGGGTGGGGACGGGTGTGAGG - Intergenic
1084691625 11:70730593-70730615 CCAGGGTAGGAATGGATGTGAGG - Intronic
1085449649 11:76624160-76624182 TCAGGGAGGAAATGGGAGTGGGG - Intergenic
1085817227 11:79752097-79752119 CCAGGGAGGCAACTGGTGAGAGG + Intergenic
1089556891 11:119320035-119320057 ACAGGGTGGAAAAGGGTAGGGGG + Intronic
1089643885 11:119865370-119865392 CCAGGGTGGAGACAGGAGTCAGG + Intergenic
1089740623 11:120579439-120579461 CCAGGGTGGACATAGGGGTGCGG + Intronic
1090122039 11:124039896-124039918 CCAGGGTGGGACCTGGGGTGGGG - Intergenic
1091794063 12:3287344-3287366 CCAGGGTGGAGGCAGGCGTGAGG + Intergenic
1092980033 12:13785420-13785442 CCAGCCTGGAAAAGGGTGTTTGG - Intronic
1093464207 12:19433703-19433725 CGTGGGTGGAAAGGGGTGGGAGG + Intronic
1093711912 12:22336900-22336922 CCAGGGTGGGACCTGGTGAGAGG - Intronic
1095559838 12:43551912-43551934 CCAGGGTGGAACCATGTGGGTGG - Exonic
1097395301 12:59066171-59066193 CCTAGGTGGAAACAGGTATGAGG - Intergenic
1101462281 12:104908372-104908394 CCTGGGTGGAAAAGGGGGAGAGG + Intronic
1102187240 12:110958372-110958394 CCAGGGTGGAGACTGAGGTGAGG - Intergenic
1102915650 12:116750091-116750113 CCATGGTGGAAATGGTGGTGGGG - Exonic
1103086063 12:118062015-118062037 GCAGGGTGAAAACCGGAGTGGGG + Intronic
1103204273 12:119116149-119116171 CCAGGGTTGAAACAGATGAGAGG - Intronic
1103843683 12:123886532-123886554 CCAGGGTGCAAGTGAGTGTGTGG + Intronic
1107341011 13:39405803-39405825 CCAGGGTGAAAACAGGCATGTGG + Intronic
1108791940 13:53980203-53980225 AGAGGTTGGAAAAGGGTGTGAGG + Intergenic
1109247340 13:59971427-59971449 CCAGGAGGGAAATGGGTATGTGG + Intronic
1109879445 13:68451563-68451585 CCTGGGAGGAAACTGGTGGGAGG + Intergenic
1112081705 13:95979415-95979437 CCAGGGATGAAACGGGTGAAGGG - Intronic
1112806166 13:103165934-103165956 CCAGGGTCGGAAGGGATGTGAGG - Intergenic
1113440132 13:110322368-110322390 CCAGGAGGGAACCGGGTGTCTGG + Intronic
1114611456 14:24044072-24044094 TCAAGGTGGAACCTGGTGTGAGG - Intergenic
1118198477 14:63650227-63650249 CCAGGCTGGAATGGAGTGTGAGG - Intergenic
1118257228 14:64215719-64215741 CCCTGGTGGAAAGGGGTGGGGGG + Intronic
1120704575 14:87733858-87733880 CAAGGATGGAAAGGTGTGTGAGG - Intergenic
1121092263 14:91190888-91190910 CAAGGGTGGAAACGGGAGACTGG + Intronic
1122204320 14:100141131-100141153 CCTGGCTGGAGACAGGTGTGGGG - Intronic
1122617952 14:103033840-103033862 CCAGTGAGGAAACTGCTGTGTGG - Intronic
1123700049 15:22907604-22907626 CCACAGTGGAAACGGACGTGTGG + Intronic
1124190771 15:27574545-27574567 CCAGGGAGGAAGCGGGTACGAGG - Intergenic
1125883091 15:43210057-43210079 CCAGGATGGGACTGGGTGTGGGG + Intronic
1126689350 15:51275928-51275950 TCAGGCTGGAATCTGGTGTGGGG - Intronic
1132731541 16:1364858-1364880 CCAGGGTGGTCACGGGTGCTGGG + Intronic
1134849882 16:17470928-17470950 CCAGCGGGGACAGGGGTGTGGGG - Intergenic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1139088390 16:63616488-63616510 GCAGAGTGGCAAGGGGTGTGTGG + Intergenic
1139650973 16:68361846-68361868 CCAGTGTGGGAGCGGGTGGGTGG + Intronic
1141009633 16:80385521-80385543 CCTGGGTGGAAACGCCAGTGTGG + Intergenic
1141618770 16:85225373-85225395 CCGAGGAGGGAACGGGTGTGGGG + Intergenic
1142697744 17:1643211-1643233 GCGGGGTGGAAACTGGTGAGCGG - Intronic
1143992556 17:10978816-10978838 CCAGTGTGGAAGCAGGTGGGGGG + Intergenic
1144394857 17:14834214-14834236 CCAAGGTGGTGACGGGTGGGGGG - Intergenic
1146290892 17:31606378-31606400 CCAGGGTGGGATGAGGTGTGAGG + Intergenic
1146634444 17:34493662-34493684 CCAGGGCAGAATCAGGTGTGAGG + Intergenic
1147587146 17:41659149-41659171 CCTGGGTGGGAGTGGGTGTGGGG - Intergenic
1147971772 17:44222017-44222039 CTAGGGTCGAGGCGGGTGTGGGG + Intergenic
1148536260 17:48441605-48441627 CCTGGGTGGAGACAGTTGTGTGG - Intergenic
1148697959 17:49572442-49572464 CCAGGGTGCAAATGGGTGCAGGG + Intergenic
1148879218 17:50712854-50712876 CCAGGGAGGAAGCTGGTGGGAGG - Intergenic
1149154808 17:53615029-53615051 CCAGGGTGGAAAGGAGGGAGTGG + Intergenic
1149486743 17:57048067-57048089 CGAGGATGGAAAGGGGTGAGGGG + Intergenic
1149638309 17:58187128-58187150 CCAGGGTGAAAAAGGGTGTGTGG + Intergenic
1149640550 17:58199808-58199830 CCAGGGGGCAAATGGGGGTGAGG + Intronic
1150658171 17:67054076-67054098 CCTGGGTGGAAAGGGGTCTGGGG + Intronic
1151821805 17:76500868-76500890 CCAAGGTGGAAACAGGTGCGGGG - Intronic
1152250254 17:79208778-79208800 CCAGGGTGGAGATGGGAGTGAGG - Intronic
1152609580 17:81309095-81309117 CCAGCCTGGAGTCGGGTGTGGGG - Intergenic
1154505218 18:15031657-15031679 CCTGGGAGGAACCGGGTGGGAGG - Intergenic
1155939656 18:31790767-31790789 CCAGGGTGGCAGCAGGAGTGAGG + Intergenic
1156450722 18:37264935-37264957 GAAGAGTGGAAATGGGTGTGTGG + Intronic
1157614300 18:48977665-48977687 CCAGGGAGGAATGGGGGGTGAGG - Intergenic
1159442239 18:68496306-68496328 CCAGGGTGGGAAGGTGTGGGAGG + Intergenic
1160155307 18:76429240-76429262 CCCAGGAGGAAACAGGTGTGTGG + Intronic
1160985701 19:1837594-1837616 CCTGGGTGGAGTCTGGTGTGGGG - Intronic
1161057548 19:2198283-2198305 AGAGGGAGGAGACGGGTGTGGGG + Intronic
1161261183 19:3338693-3338715 CCAGGGTGGCACAGGGTGGGCGG + Intergenic
1161852714 19:6746034-6746056 CCAGGGGGGAGAGGGGTGGGGGG - Intronic
1162560991 19:11418260-11418282 CCTGGGTGGAAAAGAGTGTGTGG - Intronic
1164627915 19:29741594-29741616 TCAGGGTGGAAATGGATGAGGGG + Intergenic
1164706671 19:30325125-30325147 CCAGGCTGGAAAGGGCTTTGTGG + Intronic
1164908316 19:31985475-31985497 CCAGGGTGGAGTCAGGTGAGGGG + Intergenic
1167683496 19:50940886-50940908 CCAGGGTAGAAACGGGAGGTAGG - Intergenic
925200977 2:1967706-1967728 CCAGGGTGGAAGAGGATGGGGGG + Intronic
925360466 2:3277242-3277264 CGTGGGTGGAGACAGGTGTGGGG - Intronic
926327287 2:11796496-11796518 ACAGGGTGGAGACGAGTGTGCGG + Intronic
926492720 2:13544500-13544522 CCAGGGAGGGACCGGGTGAGAGG + Intergenic
926999253 2:18775280-18775302 GCAGGGTGGTAACAGGTGGGGGG - Intergenic
927513150 2:23657052-23657074 CTAGGGTGGAAATGGGGGTTTGG + Intronic
928165056 2:28965059-28965081 CCATTGTGGAAGAGGGTGTGGGG - Intronic
929501520 2:42494356-42494378 CCAGTGTGGACTCGGGTGCGGGG + Intergenic
931092439 2:58900418-58900440 CCAGGCAGGAAACGCGTGTGCGG - Intergenic
932569867 2:72932961-72932983 ACAGGGAGGAAGCGGGTCTGAGG - Intronic
932743202 2:74307825-74307847 CCAGGGTGGCATGGGGTCTGGGG - Intronic
936278510 2:111119878-111119900 CCAGGGAGGAAAGGGATGGGTGG + Intronic
936443359 2:112575414-112575436 CCAGGGTGGAATCCGTTTTGGGG + Exonic
937155590 2:119716543-119716565 CCAGGGGAGAAATGGGTGTAAGG + Intergenic
938194407 2:129314252-129314274 CCGAGGTGGGAAGGGGTGTGGGG + Intergenic
938480666 2:131658908-131658930 CCAGGGTGGAGCCGGGTGAGAGG + Intergenic
938504408 2:131861914-131861936 CCTGGGAGGAACCGGGTGGGAGG - Intergenic
940910403 2:159205076-159205098 CCAATTTGGAAACAGGTGTGAGG - Intronic
943301423 2:186207380-186207402 CCAGGGAGGAACCAGGTGGGAGG - Intergenic
944936993 2:204579753-204579775 CCAGGGTGGACCCCTGTGTGGGG + Intronic
945043981 2:205765738-205765760 TCAGGGTGGGAAGGGGTGTGAGG + Intronic
947435587 2:230069301-230069323 CCAGGGTGGAAACAAGAATGAGG - Intergenic
948570969 2:238916888-238916910 CCACTGTGGAAACAGGAGTGGGG + Intergenic
948604156 2:239123990-239124012 CCAGGGAAGCAACGGGGGTGGGG + Intronic
1169066308 20:2695997-2696019 CCAGGGAGGAAGCGGGTGGAGGG - Intronic
1169149520 20:3278225-3278247 CCAGGGTGCATAGGGGTGGGAGG + Intronic
1170515922 20:17130378-17130400 CCAGGGTATAAACAGGTGCGAGG - Intergenic
1170663440 20:18364334-18364356 CCATGGTGGAAAGGGGGCTGTGG - Intergenic
1170963942 20:21049847-21049869 CAAGGGTGGAATCCTGTGTGAGG + Intergenic
1171481934 20:25460873-25460895 CCAGTGTGGACACAGGTGCGGGG - Intronic
1171973893 20:31581630-31581652 CCAGGGTGCAAATGGGGCTGGGG - Intergenic
1171974486 20:31585683-31585705 CCATGATGGAAGCGGGTGAGGGG + Intergenic
1172409272 20:34709830-34709852 CAAGGGTGGAATAGGGGGTGGGG + Intronic
1172763693 20:37339511-37339533 TCAGGGTGGAAAGAGGGGTGGGG - Intergenic
1173657908 20:44713870-44713892 CCAGGGTGGAGATGGGGGTCTGG - Intergenic
1173676703 20:44842154-44842176 CCAGGGTGGTAACGTCTTTGAGG - Intergenic
1175928211 20:62481089-62481111 CCAGGGTGGAGACTGGGGGGAGG - Intergenic
1176290585 21:5042414-5042436 ACAGGCTGGAGTCGGGTGTGGGG + Intergenic
1176792629 21:13337416-13337438 CCTGGGAGGAACCGGGTGGGAGG + Intergenic
1177404446 21:20646665-20646687 ACAGAGTGGAGAGGGGTGTGTGG - Intergenic
1177992030 21:28048320-28048342 CCTGGGAGGAACCGGGTGGGAGG + Intergenic
1178914234 21:36698112-36698134 GCAGCCTGGAAATGGGTGTGCGG - Intergenic
1179445105 21:41425652-41425674 CCAGGGTGGAAACGGGTGTGTGG - Intronic
1179502300 21:41817959-41817981 CCTGGGAGGCAAGGGGTGTGGGG - Intronic
1179712693 21:43272440-43272462 CCAGGGTGGAAGGTGGGGTGTGG + Intergenic
1179866670 21:44221227-44221249 ACAGGCTGGAGTCGGGTGTGGGG - Intergenic
1182898983 22:33882438-33882460 TGAGGGTGGAACTGGGTGTGGGG - Intronic
1184683526 22:46085665-46085687 CCAGGGTGGCACCGGGTGAGTGG + Intronic
1184783482 22:46660443-46660465 CCAGGGTGGGTAGGTGTGTGAGG + Intronic
1185337194 22:50275983-50276005 TCAGGGTGGAAAAGGGGCTGTGG + Intronic
949329752 3:2908577-2908599 TCAAGGTGGAAATGGGTCTGAGG - Intronic
949670547 3:6395162-6395184 CCAGGACTGAAACGGGTGAGTGG - Intergenic
950411361 3:12840109-12840131 CTGGGATGGAAATGGGTGTGGGG - Intronic
951663988 3:25101828-25101850 CCAGGGTGGAAGAGGATATGGGG - Intergenic
952507582 3:34021447-34021469 GCAAGGGGGAAACAGGTGTGCGG - Intergenic
953326729 3:42017777-42017799 ACAGGGTGGAATGGGGTGGGAGG + Intronic
954143028 3:48620160-48620182 CCTGAGGGGAAATGGGTGTGAGG - Intergenic
954457784 3:50609337-50609359 CCAGGGTGGGAACTGGAGTGTGG - Intronic
954662772 3:52234899-52234921 CCACTCTGGAAATGGGTGTGAGG - Intronic
954698461 3:52439821-52439843 CCAGGCTGGAGAGGGGTGTGGGG - Intronic
957712743 3:83884533-83884555 CCAGGGAGGAAACCGGTGGTAGG - Intergenic
958157290 3:89771284-89771306 CCAGTGTGGACTCGGCTGTGGGG + Intergenic
958584354 3:96068310-96068332 GCAGAGTGGCAAGGGGTGTGTGG + Intergenic
959689117 3:109179337-109179359 CCAGGGTGTGTACGTGTGTGTGG + Intergenic
960583680 3:119301552-119301574 GTAGGGTGGAAGCAGGTGTGAGG + Intronic
961768647 3:129231881-129231903 CCAGGGTGGCACAGGGTGGGAGG + Intergenic
961780344 3:129317033-129317055 CCAGGGTGGGACAGGGTGGGCGG + Intergenic
961794064 3:129397007-129397029 CTGGGATGGAAATGGGTGTGGGG - Intergenic
963302161 3:143610696-143610718 CCTGTGTGGAAAGGGGTCTGGGG - Intronic
966240811 3:177753627-177753649 TCAGGGTGAAGATGGGTGTGGGG + Intergenic
966949274 3:184801557-184801579 CCAGGCTGGAAACGTGAGTCAGG - Intergenic
967628206 3:191710767-191710789 CCAGGGTGGGTGGGGGTGTGGGG + Intergenic
968846141 4:3042641-3042663 TCAGAGTGGAAATGGGGGTGGGG - Intergenic
969507932 4:7599610-7599632 CCTGAATGGAACCGGGTGTGTGG - Intronic
970626826 4:17895308-17895330 AGAGGCTGGAAAAGGGTGTGGGG - Intronic
971711035 4:30112987-30113009 CGAGGGTGGGAACGAGTGGGAGG - Intergenic
975499549 4:75069603-75069625 CCTGGGTGCAAAGGGGTGAGAGG + Intergenic
977858591 4:101927324-101927346 CCAGGGTGGGACCAGGTGGGAGG - Intronic
983523582 4:168736700-168736722 CCTGGGTGGAGATGGCTGTGAGG + Intronic
984550403 4:181152662-181152684 CAAGGGTGGAACCTGGTGGGAGG - Intergenic
985975758 5:3418017-3418039 GCAGGGTGGAAAGACGTGTGTGG - Intergenic
986197482 5:5551422-5551444 CAAGGGTGGAACCTGGTGGGAGG - Intergenic
990348379 5:54891189-54891211 CCAAGGAGAAAAAGGGTGTGGGG + Intergenic
993617910 5:90136142-90136164 ACAGAGTGGAGAGGGGTGTGTGG + Intergenic
995141153 5:108737089-108737111 CCAGGGTGGGACCTGGTGGGAGG - Intergenic
996401630 5:123069229-123069251 CCAGGGAGTAAACGGGTGTGTGG + Intergenic
996856238 5:128010567-128010589 TCAGGTTGGAAACAGGTATGAGG - Intergenic
998061181 5:139119895-139119917 CCAGGTTGGCAAGGGGTGGGTGG + Intronic
999363610 5:151006792-151006814 CCAGGGTGGAAATGGGAGCAGGG - Intergenic
1000334110 5:160229290-160229312 TCAGGATGGCAACGGGTTTGAGG - Intronic
1000367758 5:160506774-160506796 CCAGGCAGGAAACGGTTGTGGGG - Intergenic
1001939460 5:175730167-175730189 CCAGGGTGGAAATGGTAGAGCGG - Intergenic
1004525658 6:16404893-16404915 CCAGGCTAGAAACAGGTGAGTGG - Intronic
1005007952 6:21309126-21309148 GCAGTGTGGAAAGGGGAGTGGGG - Intergenic
1006642868 6:35497532-35497554 CCAGGGCGGAGCCGGGTCTGGGG - Intergenic
1007735981 6:43982425-43982447 CCAGAGTGGAAACTGGTTGGAGG + Intergenic
1007756710 6:44104198-44104220 GCAGGGTGGAAAAGGGTGAGAGG + Intergenic
1010776928 6:79897791-79897813 GCAGGGAGGAAACAGGTCTGTGG - Intergenic
1011630643 6:89320716-89320738 GAAGGGTGGAAGCGGGGGTGAGG + Intergenic
1011713656 6:90081406-90081428 CCTGGTTGGTTACGGGTGTGGGG - Intronic
1016913837 6:149226169-149226191 CCAGGGTGGAGACTGTTGTTTGG + Intronic
1017195401 6:151694955-151694977 CCAGGGTGGAAGTGTGGGTGGGG + Intronic
1017519145 6:155186299-155186321 CCCTGGTGGAAACGGTTCTGAGG + Intronic
1017782858 6:157729997-157730019 CCAGGGCTGGAATGGGTGTGGGG + Intronic
1018699166 6:166413102-166413124 CCAGGGTGGCATGGGGTGGGGGG - Intronic
1019287836 7:232372-232394 CCAGGGAGGAGACGGCTCTGTGG - Intronic
1019346012 7:531211-531233 CCAGGGTGGCAGGGGGTGGGGGG + Intergenic
1019519916 7:1455959-1455981 GAAGGGAGGAAACGCGTGTGAGG - Intronic
1022834972 7:34104665-34104687 CTAGGGTTGAAACGTGGGTGTGG + Intronic
1023890857 7:44391026-44391048 CCAGGGTGGACAGGGCTGTGAGG + Intronic
1026955296 7:74372900-74372922 CCAGGGTGGACACGGTGGGGGGG - Intronic
1033648563 7:143323085-143323107 CCAGGGTGGAGGAGGGTGGGAGG - Intronic
1033820287 7:145126530-145126552 CAAGGGTGGAACCAGGTGGGAGG + Intergenic
1034489727 7:151386827-151386849 GCAGTGTGGACACAGGTGTGTGG - Intronic
1034967265 7:155399049-155399071 CCAGGAGGGAAAAGGGTGGGAGG + Intergenic
1035023904 7:155814483-155814505 CCAGGGTGGCAACCCGTGTGGGG - Intergenic
1035728560 8:1839666-1839688 CTGGTGTGGAAACTGGTGTGGGG + Intronic
1036392550 8:8336895-8336917 GGAGGGGGGAAAGGGGTGTGGGG - Intronic
1038443192 8:27585905-27585927 ACAGGGTGGAAGAGGGTGTGGGG - Intergenic
1038443200 8:27585928-27585950 ACAGGGTGGAAGAGGGTGTGGGG - Intergenic
1038895537 8:31777795-31777817 CCAGGTTGGCAGGGGGTGTGTGG + Intronic
1039901676 8:41757370-41757392 CCAGGAAGGGAACAGGTGTGTGG - Intronic
1042316111 8:67427715-67427737 CAAGGGTGGAAACGGGCCTTGGG - Intronic
1042493961 8:69435341-69435363 CAAGGGAGGAAACTGGTGGGAGG - Intergenic
1046679324 8:117151020-117151042 GCAGGTTGGAAACGCCTGTGTGG - Intronic
1048325569 8:133436551-133436573 TGAGGGTGGACAAGGGTGTGGGG - Intergenic
1048692927 8:136988723-136988745 GCAGAGTGGAGAGGGGTGTGTGG + Intergenic
1048976929 8:139678378-139678400 CTAGGGTGGACACGGGGCTGTGG - Intronic
1049326918 8:142026352-142026374 TCAGGGTGCAAACTGGGGTGTGG + Intergenic
1049404462 8:142445575-142445597 CCAGGATGGAAGCTCGTGTGTGG + Intergenic
1049720369 8:144112810-144112832 CCACGGGGGAAAGGGGTGTGTGG - Intronic
1049989591 9:978249-978271 CCTGGATGGAAACGGATGGGTGG - Intronic
1052168193 9:25358957-25358979 CCAGGGAGGAACCGGGTTGGAGG - Intergenic
1052957482 9:34264580-34264602 GCAGGGTATAAACAGGTGTGAGG + Intronic
1053200969 9:36151439-36151461 CAAGGGTGGGGAAGGGTGTGGGG - Intronic
1053284722 9:36842780-36842802 CCAGGGTGGCAAGGGGGCTGCGG - Intronic
1055091319 9:72366376-72366398 CCGGGGTGGGAGCGGGGGTGGGG + Intergenic
1056285953 9:85088350-85088372 CCAGGGAGGTAACAGGTGGGTGG - Intergenic
1057991590 9:99776261-99776283 CCTGGGAAGAAAAGGGTGTGTGG + Intergenic
1058037881 9:100273118-100273140 TCAGGGTGGAAGTGGGGGTGTGG + Intronic
1059165932 9:112076494-112076516 CCTGGGTGGAAACCGATTTGGGG + Intronic
1059255030 9:112922137-112922159 CCAAGGTCGACACTGGTGTGAGG - Intergenic
1061165480 9:128919777-128919799 CCAGGGTGGGGGCGGGAGTGGGG - Intergenic
1061632177 9:131879300-131879322 TCAGGGTGGGCACGGGTGGGGGG + Intronic
1062345105 9:136110927-136110949 CCTGGGTGGAGACGGGTGGGAGG - Intergenic
1187683860 X:21796807-21796829 CAAGGGTTGAAAAGGATGTGGGG + Intergenic
1192209852 X:69120908-69120930 CCTGGGTGGAAACAGATGTCTGG + Intergenic
1193084631 X:77438195-77438217 CCAGCATGGGAAAGGGTGTGTGG + Intergenic
1195211557 X:102655496-102655518 CCAGTGTGGAATCTGGTGTTGGG + Exonic
1196069880 X:111509052-111509074 CCAGGGTGGAAATAGGAGTAGGG + Intergenic
1196339877 X:114583909-114583931 CCATGGTGGAGATGGGGGTGGGG - Intergenic
1196688552 X:118533540-118533562 CCAGTGTGGAAAATGATGTGTGG + Intronic
1197863554 X:130995442-130995464 CCAGGGTGGACATGGGAGAGAGG - Intergenic
1199372432 X:147066554-147066576 CCAGGGTGGGACAGGCTGTGAGG - Intergenic
1200085943 X:153605165-153605187 CCAGGGTGGCATGGGGTCTGGGG - Intergenic
1201241335 Y:11959447-11959469 CCAGGCTGGAAATGAGGGTGGGG + Intergenic