ID: 1179447626

View in Genome Browser
Species Human (GRCh38)
Location 21:41444063-41444085
Sequence CTTTTCAGGGGACCACAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 135}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179447616_1179447626 7 Left 1179447616 21:41444033-41444055 CCAGCAAGCCCCCAGACAATGTG 0: 1
1: 0
2: 0
3: 17
4: 133
Right 1179447626 21:41444063-41444085 CTTTTCAGGGGACCACAGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 135
1179447615_1179447626 24 Left 1179447615 21:41444016-41444038 CCTAGAATTCTGCATTTCCAGCA 0: 1
1: 1
2: 13
3: 121
4: 749
Right 1179447626 21:41444063-41444085 CTTTTCAGGGGACCACAGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 135
1179447618_1179447626 -1 Left 1179447618 21:41444041-41444063 CCCCCAGACAATGTGGATATTCC 0: 1
1: 0
2: 2
3: 8
4: 110
Right 1179447626 21:41444063-41444085 CTTTTCAGGGGACCACAGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 135
1179447619_1179447626 -2 Left 1179447619 21:41444042-41444064 CCCCAGACAATGTGGATATTCCT 0: 1
1: 0
2: 0
3: 11
4: 172
Right 1179447626 21:41444063-41444085 CTTTTCAGGGGACCACAGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 135
1179447621_1179447626 -4 Left 1179447621 21:41444044-41444066 CCAGACAATGTGGATATTCCTTT 0: 1
1: 0
2: 0
3: 23
4: 300
Right 1179447626 21:41444063-41444085 CTTTTCAGGGGACCACAGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 135
1179447620_1179447626 -3 Left 1179447620 21:41444043-41444065 CCCAGACAATGTGGATATTCCTT 0: 1
1: 0
2: 1
3: 20
4: 200
Right 1179447626 21:41444063-41444085 CTTTTCAGGGGACCACAGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179447626 Original CRISPR CTTTTCAGGGGACCACAGTC AGG Intronic
900117820 1:1035985-1036007 CTTTGCAGAGGAACACAGACGGG + Intronic
900922866 1:5684709-5684731 CTTTTGAGGGGCACACAGTCTGG - Intergenic
901493500 1:9608547-9608569 ATTTTCAGGGCACCCCAGCCTGG + Intronic
902580226 1:17403342-17403364 CTTTGCAGGGGAACACAGTGGGG - Intergenic
903288011 1:22289073-22289095 CTGTTCAGAGGCCAACAGTCTGG + Intergenic
904208607 1:28871306-28871328 CTTGTAAGGGGCCCCCAGTCTGG + Intergenic
905110839 1:35593379-35593401 CTTTTGAGGGCCCCACAGTCTGG + Intronic
905214378 1:36396613-36396635 CTGGTCAGGGGCCCACACTCTGG + Intronic
908408922 1:63843351-63843373 CTTTTAAGGGGAGCAGACTCAGG + Intronic
908996503 1:70162370-70162392 CTGTTCTGGGGACCACACTTTGG - Intronic
910778225 1:90897817-90897839 CTTTTCCTGGGACCCCACTCTGG + Intergenic
912600758 1:110930955-110930977 CTTTTGATGGTACCACAGGCTGG - Intergenic
918087595 1:181258782-181258804 CTTCTCAAGGGTGCACAGTCAGG - Intergenic
924236456 1:242003265-242003287 CTTTTGAGGGGAGCAGTGTCTGG + Intergenic
1062896361 10:1106253-1106275 CTTGCCAGTGGACCACAGTGGGG - Intronic
1073395716 10:103215702-103215724 CTTTGCAGGGGTCCATGGTCAGG - Intergenic
1073717901 10:106128712-106128734 CTGTTCAGGGCACCTAAGTCAGG + Intergenic
1074363253 10:112839219-112839241 CTCCTCAGGGGCTCACAGTCTGG + Intergenic
1078371148 11:10746493-10746515 ATTTTGAGGGGAACACAGTACGG - Intergenic
1083053149 11:59794756-59794778 CTTATCAAGAGACCACTGTCTGG + Intronic
1084762505 11:71283007-71283029 CATTCCTGAGGACCACAGTCTGG - Intergenic
1084850472 11:71935543-71935565 CTTTCGAGGAGAACACAGTCTGG - Intronic
1085192396 11:74639108-74639130 CTGGTCTGGGGACCACACTCTGG - Intronic
1088772127 11:113045349-113045371 CTTCTCAGCGGGTCACAGTCAGG + Intronic
1089200372 11:116721037-116721059 CTGTGCTGAGGACCACAGTCGGG - Intergenic
1094280782 12:28735502-28735524 CTTTCCATAGAACCACAGTCTGG - Intergenic
1096556598 12:52407822-52407844 CTACTCTGGGGCCCACAGTCAGG - Intergenic
1101555462 12:105804884-105804906 CTTTTCAGGGGATCAGGGTTGGG - Intergenic
1102188045 12:110965126-110965148 CTTTTCAGGGAACCAGGGTCGGG - Intergenic
1102353788 12:112215189-112215211 CTTTTCCTGGGAGCACAGTGCGG - Intronic
1102703045 12:114856558-114856580 CTTTTCAGGGAGGCAGAGTCAGG - Intergenic
1106195436 13:27490338-27490360 CATATCTGGGAACCACAGTCAGG + Intergenic
1106554485 13:30798093-30798115 CGTGTCAGGGGCCCACAGACAGG + Intergenic
1117290186 14:54324741-54324763 AATTTCATGGGCCCACAGTCAGG + Intergenic
1118530272 14:66696720-66696742 CCTTTCAGGGGACCACAAATTGG - Intronic
1120856409 14:89216541-89216563 CTCCTCATGGGACCACACTCAGG + Intronic
1122011422 14:98752346-98752368 CTTTTCATGGGAACAAAGTTGGG - Intergenic
1124866783 15:33500136-33500158 CTTTCAAGGGACCCACAGTCTGG + Intronic
1128775199 15:70315079-70315101 TTTGTCATGGGACCAGAGTCAGG + Intergenic
1130760886 15:86818511-86818533 ATTTTCCAGGGACCACAGTTGGG - Intronic
1133315889 16:4883804-4883826 CCTCTCCAGGGACCACAGTCTGG + Exonic
1133426113 16:5691071-5691093 CTCTTCAGAGAGCCACAGTCAGG - Intergenic
1133603208 16:7360304-7360326 GTTTTCAGTTGACCACAGTTTGG - Intronic
1134640812 16:15827894-15827916 TTGTTCAGGTGACCACAGACTGG - Intronic
1135900624 16:26456274-26456296 TTTTTCACGTGACCCCAGTCTGG + Intergenic
1140475216 16:75236507-75236529 ATTATCAGGGGACCAAATTCTGG + Intronic
1143290694 17:5825817-5825839 CTTCACTGGTGACCACAGTCAGG - Intronic
1148230522 17:45930719-45930741 TTTTTCAGGGGATGACAGGCAGG - Intronic
1151384725 17:73748056-73748078 CTTTACAGAGGAACAAAGTCAGG - Intergenic
1151492890 17:74443253-74443275 CTTGCCAGGGGGCCACAGGCTGG + Intronic
1160692070 19:464729-464751 CTTTTTATGGGATCCCAGTCTGG - Intronic
1163185070 19:15632017-15632039 CTTTTCAGGGGCCCATAGATTGG + Intronic
1163477836 19:17537368-17537390 GTTTTCAGGAGACCATACTCAGG + Exonic
1164645300 19:29854928-29854950 TTTTTCAGGAGAGGACAGTCAGG + Intergenic
1165634558 19:37329758-37329780 CTCTTCAGTGGACTACAGTGTGG + Intronic
1166921192 19:46230202-46230224 CCTTCCAGGGGACCCCAGGCTGG + Intronic
925981298 2:9179554-9179576 CTTTCCAGGGGGCCCCTGTCTGG - Intergenic
927013091 2:18927039-18927061 ATTTCCAGGGGAACACAGCCAGG - Intergenic
928197436 2:29225703-29225725 CTTTTCAGGGGACCATGAGCAGG + Intronic
931701326 2:64911482-64911504 CTCTTCAGGGGAGCAGAGTGAGG - Intergenic
932144628 2:69306857-69306879 CTTTCCCGGGGGCCACAGTCGGG - Intergenic
938526744 2:132141149-132141171 TTTTCCAGGGTTCCACAGTCTGG - Intergenic
941721819 2:168820477-168820499 TTTGTCAGGAGACCACTGTCTGG + Intronic
946688972 2:222296925-222296947 CAACACAGGGGACCACAGTCTGG + Intronic
946845193 2:223852722-223852744 CTTTACATGGGAACACATTCTGG - Intergenic
947281526 2:228460689-228460711 ATTTGCAGTGGAGCACAGTCAGG - Intergenic
1169673984 20:8133309-8133331 CTTTTCAGGGACCCTCACTCCGG - Intronic
1170447712 20:16446665-16446687 CTTTTTAGGTTACCAAAGTCTGG - Intronic
1171847911 20:30288990-30289012 CTGTTCAGGGGACAGCAGCCTGG + Intergenic
1172023639 20:31933604-31933626 CTTTTCAGGAGCCCACAGCCAGG + Intronic
1172035071 20:32004781-32004803 CTATTCTGGAGACCACAGTTTGG - Intergenic
1172130543 20:32651963-32651985 CCTTTAAGGGGACCCCAGTCTGG + Intergenic
1172324474 20:34023830-34023852 CTTTGGAGGGGACCTCAGTGTGG + Intronic
1172436496 20:34932313-34932335 CTTTGCAGGGGCTCACAGTCTGG - Intronic
1177450986 21:21266178-21266200 CTTTTCTGGGGATGACAGTGGGG + Intronic
1178793998 21:35726686-35726708 CATTTCTGGGGCTCACAGTCTGG - Intronic
1179044331 21:37831242-37831264 CTTTTCAGAGGAGCACAGACAGG + Intronic
1179136002 21:38680361-38680383 CATTTCAAAGGACCACAGACTGG + Intergenic
1179412210 21:41170569-41170591 CATTTCAGGGCAACACAGGCAGG - Intronic
1179447626 21:41444063-41444085 CTTTTCAGGGGACCACAGTCAGG + Intronic
1180857203 22:19056019-19056041 CCTATGAGGGGACCACCGTCGGG + Intronic
1182183918 22:28381726-28381748 CTCTTAAGGGTACCACAGTTTGG + Intronic
1182923942 22:34105233-34105255 CCCTTCAGGGGACAACTGTCAGG + Intergenic
1183352644 22:37342740-37342762 CTCCTCAGGGGCCCACAGACTGG - Intergenic
951822477 3:26827728-26827750 CTTTTCTGGGCTCCACAGGCAGG - Intergenic
952006752 3:28850146-28850168 CTTTCCAGGGCACCTCTGTCAGG + Intergenic
952159688 3:30681297-30681319 GATTTCAAGGGAGCACAGTCTGG + Intronic
954334170 3:49906507-49906529 CCTTACAGGGGACCTCAGCCTGG - Intronic
959008767 3:101050160-101050182 CTTTCCAGGGAAGCCCAGTCAGG - Intergenic
961145887 3:124592923-124592945 CCTTTCTGGTGACCACAGTGAGG + Intronic
961922320 3:130440520-130440542 ATTTTCAGTGGTCCACAGTAGGG - Exonic
962095502 3:132288424-132288446 CTTTTCATGGGGCCTCAGTGAGG + Intergenic
962283457 3:134068745-134068767 CTTTTCAGGAGACACCAGGCTGG + Intronic
966899836 3:184473261-184473283 CTTTTCAGGGCAGCACACTCAGG + Intronic
969697613 4:8743974-8743996 CTTGGCAGGGGTGCACAGTCAGG + Intergenic
974795219 4:66740355-66740377 TTTATCAGAGGACCACAATCTGG - Intergenic
978697757 4:111603162-111603184 AATTTGAGGGGAACACAGTCTGG + Intergenic
985570544 5:642468-642490 CTTTTCTGTGGGACACAGTCAGG + Intronic
985933721 5:3079146-3079168 GTTTTCAGAGGACCGCTGTCTGG + Intergenic
986327588 5:6688068-6688090 TTTTTCAGTTGACCACAGTTGGG - Intergenic
989794846 5:45455195-45455217 ATTTTCAAGGGAACACAGTTTGG + Intronic
990990777 5:61681591-61681613 CATTTCATGTGACCACATTCTGG - Intronic
992019195 5:72605710-72605732 GTTTTCTGGGGCTCACAGTCAGG - Intergenic
998252768 5:140563889-140563911 CTTGTGGGGGGACCACAGTCTGG - Exonic
999428226 5:151505425-151505447 CATTTCAAGGGACAACAGCCTGG + Exonic
1001385093 5:171331988-171332010 CCTTTCAAGTGACCACAGTGTGG + Intergenic
1006176557 6:32125926-32125948 CATTTCAGGGAACCACAGCAAGG - Intronic
1008596067 6:53043361-53043383 GCTTTCAGGAGAACACAGTCTGG - Intronic
1012350439 6:98243737-98243759 CTTTTAAGTGTACCACAATCTGG + Intergenic
1012694620 6:102363177-102363199 CTTTATAGGGGAACAGAGTCTGG + Intergenic
1012771814 6:103447347-103447369 CTGTTCTGGGGACCACATTTTGG + Intergenic
1013945541 6:115717977-115717999 CTCTTCAAGGCACCACTGTCAGG + Intergenic
1014560599 6:122885300-122885322 CTTTCCAGGGCACCACACTGAGG + Intergenic
1017942105 6:159061943-159061965 CATTACAAGGGACCACAGACTGG - Intergenic
1017949186 6:159121407-159121429 CTTCTCAGGGCACCTCTGTCTGG - Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1020413740 7:7922285-7922307 CTTTCCAGGAGACCGCATTCCGG + Intronic
1022249979 7:28597710-28597732 CTCATCAGGGGCCCAAAGTCAGG - Intronic
1023179060 7:37462858-37462880 CTTTTCGGGAGGCCAAAGTCAGG - Intergenic
1023705497 7:42937340-42937362 TGTTTCAGGTGACCACATTCAGG - Exonic
1026967695 7:74450848-74450870 CTTCTCATTGGACCACAGTGTGG - Intergenic
1030225597 7:107146829-107146851 GTGTTCAGGGGACCACACTCTGG - Intronic
1033855198 7:145552584-145552606 CTTCACAGGGGAGCAAAGTCGGG + Intergenic
1034940963 7:155230050-155230072 ATTTTCATGGGAACACAGCCAGG + Intergenic
1035165630 7:156988087-156988109 CGTTTAAGGGCACCACATTCTGG - Intergenic
1035495250 7:159319804-159319826 CTGTTCAAGGGATCACAATCAGG - Intergenic
1036182629 8:6598298-6598320 CTTTTCAGAGTCTCACAGTCAGG + Intronic
1038048016 8:23783453-23783475 CTTTTCTGGTTACCACAGTAGGG + Intergenic
1038144859 8:24886055-24886077 CCTTTCAGTGGACAACAGTAAGG + Intergenic
1042222319 8:66485933-66485955 CTTCTCAGAGGCCCACAGCCCGG + Intronic
1042951150 8:74202023-74202045 CTGGTCAGGAGACCACAGCCAGG + Intergenic
1044573710 8:93746794-93746816 CTTTTCAGGCGACCACATCTTGG - Intergenic
1048075092 8:131061468-131061490 CTCTTCTGGGGACAAGAGTCAGG + Intergenic
1048989165 8:139751279-139751301 CTTTTCAGGGGTCCAGAGGCTGG + Intronic
1049767885 8:144363373-144363395 CTACTCAGGGGACCACCCTCTGG - Intergenic
1050131766 9:2420334-2420356 CTTTTCAGAGGACTACACTGAGG - Intergenic
1050279731 9:4037910-4037932 CTTTTCAGCTGCCCACATTCAGG + Intronic
1052303047 9:26974909-26974931 CTTTTAAGGGGAAGAGAGTCGGG + Intronic
1053055895 9:34992889-34992911 CCTCTCAGGGGTCCTCAGTCTGG + Intronic
1053510653 9:38685315-38685337 CTTTTCAGAGGAGCATACTCAGG - Intergenic
1055817822 9:80228371-80228393 CTTTTCAAGGGACCAAATTTTGG + Intergenic
1056600368 9:88042371-88042393 CTTTTAAGGGGAAGAGAGTCAGG + Intergenic
1059793018 9:117661253-117661275 CTTTTCAAGGGTCCCAAGTCTGG + Intergenic
1060295831 9:122342465-122342487 CATTCCTGGAGACCACAGTCTGG - Intergenic
1060451822 9:123750005-123750027 CTTTTCAGAGGACACCAGCCTGG - Intronic
1189077598 X:37933490-37933512 TCTTTCAGGGAACCACAGACAGG - Intronic
1190479553 X:50862362-50862384 CTTTTCAAGGTACCACAGTATGG - Intergenic
1190802901 X:53808389-53808411 TGTTTCAGGTGACCACATTCAGG - Intergenic
1194969845 X:100331458-100331480 CTTTTTAGGGGATCACACACAGG - Intronic
1201322722 Y:12717881-12717903 CTTTTCAGTAGACCATAGTGGGG + Intronic