ID: 1179451801

View in Genome Browser
Species Human (GRCh38)
Location 21:41473249-41473271
Sequence GAGACCTGCTCAAGGTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1040
Summary {0: 1, 1: 3, 2: 45, 3: 221, 4: 770}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179451792_1179451801 13 Left 1179451792 21:41473213-41473235 CCATTTAAACACAAGGATGCCGG 0: 1
1: 0
2: 1
3: 3
4: 81
Right 1179451801 21:41473249-41473271 GAGACCTGCTCAAGGTCACAGGG 0: 1
1: 3
2: 45
3: 221
4: 770
1179451791_1179451801 14 Left 1179451791 21:41473212-41473234 CCCATTTAAACACAAGGATGCCG 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1179451801 21:41473249-41473271 GAGACCTGCTCAAGGTCACAGGG 0: 1
1: 3
2: 45
3: 221
4: 770
1179451798_1179451801 -6 Left 1179451798 21:41473232-41473254 CCGGGGCTGCAAGGGTTGAGACC 0: 1
1: 0
2: 0
3: 16
4: 117
Right 1179451801 21:41473249-41473271 GAGACCTGCTCAAGGTCACAGGG 0: 1
1: 3
2: 45
3: 221
4: 770
1179451790_1179451801 15 Left 1179451790 21:41473211-41473233 CCCCATTTAAACACAAGGATGCC 0: 1
1: 0
2: 2
3: 13
4: 138
Right 1179451801 21:41473249-41473271 GAGACCTGCTCAAGGTCACAGGG 0: 1
1: 3
2: 45
3: 221
4: 770

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179451801 Original CRISPR GAGACCTGCTCAAGGTCACA GGG Intronic
900814287 1:4831463-4831485 GAGACCTGAACATGGTCTCAGGG - Intergenic
900850776 1:5141217-5141239 GTGACTCGCTGAAGGTCACAGGG + Intergenic
900885899 1:5415212-5415234 GTGACTTGCTCAAGGTCACAGGG - Intergenic
901104145 1:6742256-6742278 ATGACCTGCCCAAGGGCACATGG + Intergenic
901148959 1:7087642-7087664 GTGACTTGCCTAAGGTCACATGG - Intronic
901530753 1:9851063-9851085 GAGCCCTGCTCCAGGTCACCTGG - Intronic
901797718 1:11690502-11690524 GCGACTTGCTCGAGGTCATAGGG + Intronic
901839700 1:11946154-11946176 GGGACTTGCCCCAGGTCACATGG + Intronic
901931698 1:12600068-12600090 GTAACTTGCTCAAGGTCACACGG + Intronic
902179873 1:14679753-14679775 GAAACATGCCCAAGGTCACTTGG + Intronic
902217464 1:14943664-14943686 GTGACCTGCTCAAGATCACTTGG + Intronic
902376380 1:16031956-16031978 GTGACTTGCTCAAGGTCACACGG - Intronic
902377252 1:16035587-16035609 GTGACTTGACCAAGGTCACAAGG - Intergenic
902381347 1:16053885-16053907 GTGACTTGCCCAAGGTCACACGG - Intronic
902382430 1:16058842-16058864 GTGACTTGACCAAGGTCACAAGG - Intronic
902431034 1:16363323-16363345 GAGACTTGCCCAAGGTCACAAGG + Intronic
902525313 1:17053661-17053683 TTGAATTGCTCAAGGTCACATGG - Intronic
902554770 1:17240441-17240463 GCAACCTGCTCAAGTGCACAAGG - Intronic
902671669 1:17978857-17978879 ATTACCTGCTCAAGGTCACATGG - Intergenic
902775082 1:18669483-18669505 GTGACTTGCTAGAGGTCACACGG - Intronic
902795171 1:18796168-18796190 GTGACTGGCCCAAGGTCACACGG - Intergenic
903010131 1:20323985-20324007 GTCACCTGCCCAAGGTCACATGG + Intronic
903024092 1:20414741-20414763 GAGACCTCCTCAGGCTGACATGG - Intergenic
903049436 1:20589724-20589746 ATGACTTGCCCAAGGTCACACGG + Intronic
903186457 1:21632053-21632075 GTGACCCGCCCAAGGTCACATGG + Intronic
903239621 1:21974228-21974250 GGGACTTGCTCAAGGTCACCTGG + Intergenic
903243429 1:21999156-21999178 GGGACTTGCTCAAGGTCACCTGG + Intergenic
903284199 1:22266997-22267019 GTGACTTGCCCAAGGCCACAAGG + Intergenic
903334823 1:22617821-22617843 GTGACTTGCCCAAGGTCACACGG + Intergenic
903418938 1:23204503-23204525 GTGACTTGCCCAAGATCACATGG + Intergenic
903422385 1:23227293-23227315 GACACTTGCCCAAGGTCTCACGG + Intergenic
903461237 1:23522242-23522264 GTGACTTGCTTAAGGTCTCACGG + Intronic
903496240 1:23769514-23769536 GTGACATGCTCAAGTCCACATGG - Intergenic
903569377 1:24293206-24293228 GTAATCTGCTCAAGGTCACAGGG - Intergenic
903703896 1:25270717-25270739 GTGACTTGCTCAAGGTCACAGGG - Intronic
903723345 1:25422607-25422629 GTGACTTGCTCAAGGTCACAGGG + Intronic
903739531 1:25550677-25550699 GGGACCTGTGCAAGGTAACATGG - Intronic
903742202 1:25564875-25564897 GTGACTTGCCCAAGGTCTCACGG + Intronic
903768544 1:25749879-25749901 GACACCTGCTCCAGGTCTCACGG + Intronic
903892859 1:26581456-26581478 GCAACTTGCCCAAGGTCACATGG - Intergenic
903925913 1:26830321-26830343 GTAATCTGCCCAAGGTCACATGG - Intronic
903976816 1:27155442-27155464 GTAACTTGCTCAAGGTCACACGG - Intronic
904046817 1:27614239-27614261 GTGACTTGCCCAAGGCCACATGG + Intronic
904172292 1:28599776-28599798 GTGACCTGTCCAAGGTCACTAGG - Intronic
904208401 1:28869952-28869974 ATGACATGCCCAAGGTCACAAGG - Intergenic
904483223 1:30807150-30807172 GTGCCCTCCCCAAGGTCACACGG + Intergenic
904565811 1:31427732-31427754 GAGGCCTAGCCAAGGTCACATGG + Intronic
904583985 1:31569003-31569025 GTGACTTGCTCAAGGTCACATGG + Intergenic
904752477 1:32749532-32749554 GTGACTTGCTCAAGTTCACATGG + Intronic
904753573 1:32755500-32755522 GGAATCTGCTCAAGGTCACCAGG - Intronic
904767881 1:32864337-32864359 AGCACCTGCCCAAGGTCACAAGG + Intronic
904807569 1:33142569-33142591 GAGACTTGCTCAGGGTCACATGG + Intergenic
905002800 1:34686430-34686452 TTGAACTGCTCAAGGTCACCGGG + Intergenic
905002858 1:34686744-34686766 GTGACATACTCAAGGTCACATGG - Intergenic
905690626 1:39940260-39940282 GTGACCTGCCTAAAGTCACATGG + Intergenic
905772639 1:40648246-40648268 AGGACCTGCTCAGGATCACATGG - Intronic
905850154 1:41267995-41268017 GTGACTTGCTTAAGGTCACTGGG - Intergenic
905894264 1:41534933-41534955 GTGACTTGCCCAAGGTCACCTGG - Intronic
906041164 1:42788755-42788777 GATACTTGCTCAAAGTCACATGG - Intronic
906072740 1:43029023-43029045 GCTACCTGCCCCAGGTCACACGG - Intergenic
906138037 1:43514218-43514240 GCCACCTGCTCAAGGCCAGAAGG + Intergenic
906238613 1:44227804-44227826 GGAACTTGCTCAAGTTCACATGG - Intronic
906539485 1:46574242-46574264 GTGACTTGCCCAAGATCACATGG + Intronic
906774025 1:48512485-48512507 GGGACTTGCCCAAGGCCACAGGG + Intergenic
906805349 1:48775349-48775371 GAGACTTGCCCAGGGTCTCATGG - Intronic
907262950 1:53235305-53235327 GGAACTTGCCCAAGGTCACATGG + Intronic
907285690 1:53378128-53378150 TAGAGCTGCTCAGGGTCTCAGGG - Intergenic
907309472 1:53531043-53531065 GTGACCTGCCCAAGGTCACAGGG + Intronic
907329043 1:53659496-53659518 AGGACTTCCTCAAGGTCACATGG + Intronic
907393571 1:54174484-54174506 GACACTTGCCCAAGGTCACCTGG + Exonic
907490245 1:54804864-54804886 GTGACTTGCTCAAGATCCCACGG + Intergenic
907557795 1:55359805-55359827 GTGAATTGCACAAGGTCACATGG + Intergenic
907783355 1:57587758-57587780 GAGACTTGCCCAAGGCCACTAGG + Intronic
908255318 1:62298607-62298629 GTGACTTACCCAAGGTCACACGG - Intronic
908323815 1:63003873-63003895 GTCACCTGCTCACGGTTACATGG - Intergenic
908358509 1:63345236-63345258 GTGACTTGCTCAAAGGCACATGG - Intergenic
910106331 1:83634848-83634870 ATGACTTGCTCAAGGTCGCATGG + Intergenic
910432898 1:87176303-87176325 GAAACTTGCTCAAGGCGACATGG + Intergenic
911046742 1:93635024-93635046 GAGACCAGCCCAAGCACACAGGG + Intronic
911237385 1:95425907-95425929 GAGACCAGCTTCAGGTCCCACGG - Intergenic
911244497 1:95501733-95501755 GTGACTTGCTCAGAGTCACATGG - Intergenic
912391434 1:109305979-109306001 GTGACTTGTCCAAGGTCACAGGG + Intronic
912420526 1:109539534-109539556 GCAACTTGCCCAAGGTCACACGG + Intergenic
912570053 1:110614812-110614834 AGGACCTGCTCAAGGTTGCATGG + Intronic
912951723 1:114124857-114124879 GCAATCTGCTCAAGGTCACCAGG - Intronic
913044073 1:115058466-115058488 GTAACTTGCTCAAGGTCACAAGG + Intronic
913112342 1:115667571-115667593 GGGACCTGCTCAAGGTCACAGGG + Intronic
913186736 1:116375214-116375236 GTGACTTGCTCAAGGTCAAACGG + Intronic
913201545 1:116498717-116498739 AAGGCTTGCTCAAGGTCACATGG + Intergenic
913681450 1:121189594-121189616 GAGGCTTGTCCAAGGTCACACGG + Intronic
914033281 1:143977231-143977253 GAGGCTTGTCCAAGGTCACACGG + Intergenic
914156165 1:145090736-145090758 GAGGCTTGTCCAAGGTCACACGG - Intronic
914433180 1:147638343-147638365 GTCACTTGCTCAAGGTCATATGG + Intronic
915538351 1:156551437-156551459 GGGATTTGCTCAAGGTCACATGG + Intronic
915651154 1:157311786-157311808 GCGACCTGTGAAAGGTCACATGG + Intergenic
915725214 1:158012366-158012388 GTGACTTGCACAAGGTCACACGG - Intronic
915960207 1:160260250-160260272 GTAACTTGCTCAAGGTCACATGG + Intronic
916939263 1:169662820-169662842 GAGTTCTGCTCATGGCCACAGGG - Intronic
917437865 1:175039292-175039314 GTAACTTGCTCAAGGTCCCAGGG - Intergenic
917476951 1:175377101-175377123 AAAACCTGCCCAAGTTCACAAGG - Intronic
917630726 1:176888838-176888860 GTAACTTGCCCAAGGTCACATGG - Intronic
918105874 1:181414750-181414772 GTGACTTTCTCAAGGTCACGTGG + Intronic
918854915 1:189739790-189739812 GAGAATTCCTCAAGGTCAAAAGG - Intergenic
919679577 1:200420826-200420848 GAAAACTGCCCAAAGTCACAGGG - Intergenic
919688702 1:200508830-200508852 GCAACGTGTTCAAGGTCACAGGG - Intergenic
919777672 1:201204944-201204966 GTGACCTGTCCAAGGTAACATGG + Intronic
919954205 1:202396302-202396324 GTAACATGCCCAAGGTCACATGG - Intronic
920200242 1:204255804-204255826 GAGAACTCCTCAAGGGCAGAGGG - Intronic
920346504 1:205309087-205309109 GAGATTTGCCCAAGGCCACAAGG - Intronic
920468764 1:206208112-206208134 GAGGCTTGTCCAAGGTCACACGG + Intronic
920678878 1:208057973-208057995 GTGACTTGCTCAAAGTCACCTGG + Intronic
920689208 1:208132897-208132919 GCAACTTGCCCAAGGTCACATGG + Intronic
920872920 1:209808927-209808949 GTGATTTACTCAAGGTCACATGG + Intergenic
921167976 1:212520826-212520848 ATGACTTGCCCAAGGTCACAAGG + Intergenic
921315129 1:213883191-213883213 AAGATCTGCCCAAGTTCACACGG - Intergenic
921795141 1:219334211-219334233 GAGGGTTGCTCAAAGTCACAAGG - Intergenic
921964604 1:221075166-221075188 GTAACTTTCTCAAGGTCACAAGG - Intergenic
921991746 1:221374132-221374154 GAAACTTGCTCAAGGTGACCTGG + Intergenic
922077861 1:222265839-222265861 GATAAAAGCTCAAGGTCACAGGG - Intergenic
922109167 1:222540609-222540631 GCAACTTGCTCAGGGTCACATGG - Intronic
923095789 1:230774166-230774188 AAGTACTGCTCCAGGTCACATGG + Intronic
923202584 1:231726414-231726436 GAGTGCTGCCCAAGGTCACCTGG + Intronic
923614041 1:235521798-235521820 GTTACCCACTCAAGGTCACAAGG + Intergenic
924588453 1:245380606-245380628 GCGACCTGTGCCAGGTCACACGG + Intronic
924817905 1:247458862-247458884 GTAACCTGCTCAAAGACACATGG - Intergenic
1063040017 10:2328707-2328729 AAGACCTGCTCGATGTCACAAGG + Intergenic
1063571235 10:7216096-7216118 GCAACGTGCTCAAGGCCACAGGG + Intronic
1063735069 10:8743763-8743785 GAAACTTGCCCAAGGTCACATGG - Intergenic
1063923528 10:10955198-10955220 GTAACCTGCTCAAGGCCACGTGG + Intergenic
1064722697 10:18246030-18246052 GAGAACAGCTCCAGGTCAAAAGG + Intronic
1065449638 10:25843423-25843445 GAGACCTGCTCGATGTCAGGTGG + Intergenic
1065850445 10:29783333-29783355 GCGATTTGCTCAAGGTCACATGG + Intergenic
1065924128 10:30420941-30420963 GTGACTTGCCCAAGGTCACATGG + Intergenic
1065966808 10:30777349-30777371 GTGACTTGCTCAAGTCCACAGGG + Intergenic
1067370459 10:45677571-45677593 GTAACCTCCCCAAGGTCACATGG - Intergenic
1067565032 10:47330331-47330353 GTGATCTTCTCAATGTCACATGG + Intergenic
1068500076 10:57833498-57833520 GAGTTCTGCTCATGGCCACAGGG - Intergenic
1068719342 10:60225442-60225464 TATACCTACTCAAGGTCACATGG + Intronic
1069821806 10:71233127-71233149 CAACCTTGCTCAAGGTCACAGGG - Intronic
1069861855 10:71476412-71476434 GTGACATGCTCAAGGTCACATGG + Intronic
1069872577 10:71542271-71542293 GTAACTTGCCCAAGGTCACATGG - Intronic
1070179284 10:73998528-73998550 AGGACTCGCTCAAGGTCACAGGG - Intronic
1070758552 10:79008849-79008871 GTAACGTGCCCAAGGTCACAGGG + Intergenic
1070774506 10:79101940-79101962 GTGGCCAGCTCCAGGTCACACGG + Intronic
1070779188 10:79127630-79127652 GAGACTTGACCAGGGTCACACGG + Intronic
1070795184 10:79212113-79212135 GTGACTTGCTTAAGGTCACGTGG - Intronic
1071481476 10:86068169-86068191 GTGACTTGGCCAAGGTCACATGG + Intronic
1071942158 10:90601790-90601812 GAGACTTACTCACTGTCACAAGG - Intergenic
1072159301 10:92751524-92751546 GAGACTTACTTAAGGTCACATGG + Intergenic
1072189243 10:93066855-93066877 GGGAACTGCCCAAGGTCATACGG - Intronic
1072237061 10:93462484-93462506 GTAACTTGCTCAAGATCACAGGG + Intronic
1072325048 10:94289283-94289305 GAGAGCCACTCAGGGTCACACGG - Intronic
1072371888 10:94772558-94772580 GAGTTCTGCTCATGGCCACAGGG + Intronic
1072555287 10:96510073-96510095 ATGACTTGCTCAAGGCCACACGG + Intronic
1072626210 10:97113909-97113931 AAGACATGCCCACGGTCACATGG + Intronic
1073294596 10:102431493-102431515 GTAACTTGCCCAAGGTCACAAGG + Intronic
1073503085 10:103959871-103959893 GTGACTTGCCCAATGTCACAGGG + Intergenic
1073562966 10:104512537-104512559 GTGGCCAGCTCAAGGCCACACGG + Intergenic
1073703377 10:105955477-105955499 GCCACTTGCTCAAGGTCTCATGG + Intergenic
1074082424 10:110178282-110178304 GTGACCTGTTCAAGGTCACATGG + Intergenic
1074299812 10:112223543-112223565 GTGATTTGCTTAAGGTCACAAGG - Intergenic
1074392193 10:113067718-113067740 AAGACTTGCTCAAGGTCACATGG - Intronic
1074491620 10:113944190-113944212 GAGCCCTGAGAAAGGTCACATGG + Intergenic
1074612778 10:115037859-115037881 GAGTTCTGCTCATGGCCACAGGG - Intergenic
1074822012 10:117186699-117186721 GTAACTTGCCCAAGGTCACATGG - Intergenic
1074878913 10:117636387-117636409 GAGACCTTCCCAAAGCCACAAGG - Intergenic
1074895866 10:117777245-117777267 GTGACCTACTTAAGGTCACCTGG - Intergenic
1074921315 10:118016773-118016795 GTAACTTGCTCAAGGTCACAGGG - Intronic
1075025017 10:118978108-118978130 GTGACCTGCTCCAGGTCCCTGGG - Intergenic
1075073641 10:119335842-119335864 GCTACTTGCTCAAAGTCACAGGG - Intronic
1075466724 10:122656995-122657017 GAGACTTACCCAAAGTCACAGGG - Intergenic
1075468782 10:122672393-122672415 GAGACTTTCCCAAAGTCACAGGG - Intergenic
1075837412 10:125466564-125466586 GGAATCTGCTCAAGGTCACATGG + Intergenic
1076235361 10:128860267-128860289 GCCACCTGTTCAAGGTCCCAAGG - Intergenic
1076391945 10:130110137-130110159 GAGACTTGCACAAGATCCCAGGG - Intergenic
1076398602 10:130161275-130161297 GTGACTTGCCCAAGGTCACCTGG + Intronic
1076531639 10:131149064-131149086 GCGACCTTCTCAGGGTCACCTGG - Intronic
1076934458 10:133558271-133558293 GGGGCTTGCTCACGGTCACATGG + Intronic
1077252304 11:1566074-1566096 GAGACCCCGTCCAGGTCACAAGG + Intronic
1077366961 11:2165148-2165170 CAGCCCTGCTCAAGGCCAGAAGG + Intronic
1077486877 11:2842934-2842956 GTGACTTGCCCAAGGTCACCCGG + Intronic
1077532808 11:3105154-3105176 GTGACTTGTCCAAGGTCACACGG + Intronic
1077535105 11:3120298-3120320 GACACCTGCTCAAGGCCCCAAGG + Intronic
1077856330 11:6129823-6129845 GAAACTTGCCCAAGGTCACAGGG + Intergenic
1077911708 11:6577858-6577880 GTAAACTGCCCAAGGTCACACGG + Intronic
1077913647 11:6596397-6596419 GAGGCCTGGGCAAGATCACACGG + Exonic
1078277374 11:9862469-9862491 GAGAACTGTTCAGGGTCATATGG + Intronic
1078430209 11:11282487-11282509 GAGACTTGTCCAGGGTCACATGG + Intronic
1078742330 11:14078651-14078673 GTAACCTGTTCAAGGTCACAGGG - Intronic
1078774496 11:14381669-14381691 GTGACCTGCTCATGGTCACATGG - Intergenic
1078910930 11:15731105-15731127 GTGACTTGCTCAGGTTCACATGG + Intergenic
1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG + Intergenic
1079129490 11:17738961-17738983 GGGACCTGCCCAAGGGCACTCGG + Intronic
1079391424 11:20025124-20025146 GTGACCTGCCCAAGGTGCCAGGG - Intronic
1079587238 11:22141036-22141058 GTGACTTTCCCAAGGTCACATGG - Intergenic
1079989576 11:27232636-27232658 GTGACTTGCTCATGGTCACTTGG + Intergenic
1080008465 11:27433855-27433877 GGGACTTGCTTCAGGTCACATGG - Intronic
1080644792 11:34180689-34180711 GCGCCTTGCTCAAGGTTACACGG + Intronic
1080700357 11:34639135-34639157 TTAACGTGCTCAAGGTCACATGG + Intronic
1080888421 11:36387706-36387728 GTGACTTGCCCAAGGCCACAGGG + Intronic
1081607155 11:44534560-44534582 GTTACTTGCCCAAGGTCACATGG - Intergenic
1081674233 11:44959089-44959111 GAGTCCTGCTCGAGTTCTCATGG - Intergenic
1081742727 11:45452203-45452225 GAGGCTTTCCCAAGGTCACAGGG + Intergenic
1081870497 11:46380840-46380862 GGGGCTTGCTCAAGGCCACAGGG - Exonic
1081915846 11:46729636-46729658 GCAACTTGCTCAAAGTCACATGG - Intronic
1081997593 11:47375317-47375339 GAGACTTGCACAAGGTCACACGG - Intronic
1082791036 11:57346982-57347004 GTGACTTGGCCAAGGTCACAGGG - Intronic
1082800093 11:57408159-57408181 ATGACATGTTCAAGGTCACATGG + Intronic
1082802764 11:57426784-57426806 GGAACTTGCCCAAGGTCACAGGG + Intronic
1082813489 11:57493192-57493214 ATGACTTGCTCAAGCTCACAGGG + Intronic
1083258794 11:61512017-61512039 GTGACTTGCTCAAGATCACTTGG - Intergenic
1083282042 11:61632972-61632994 GCAACCTGCGCAAGGTCATATGG + Intergenic
1083302901 11:61748097-61748119 AAGACCTGCCCAAGGTCGCATGG + Intergenic
1083613381 11:64014940-64014962 CAGAGCTGCCCAAGGTCACAGGG + Intronic
1083622016 11:64053829-64053851 GGGGAGTGCTCAAGGTCACATGG + Intronic
1083655173 11:64226041-64226063 CAGACTTGCCCAAGGTCACACGG + Exonic
1083741819 11:64715291-64715313 GGGACTTGCCCAAGGTCACACGG + Intronic
1083832479 11:65241652-65241674 GACACATGCCCAAGGTCACTTGG - Intergenic
1083870759 11:65487066-65487088 GTGACCTGCTGAAGGTCCCAGGG + Intergenic
1084588430 11:70076986-70077008 GAGGCTGGCACAAGGTCACAAGG + Intergenic
1084773523 11:71359746-71359768 GGGGCCTCCTCAAAGTCACATGG - Intergenic
1084901236 11:72311492-72311514 GTGACCTGCTTAAGGTTACAGGG + Intronic
1085312339 11:75524142-75524164 GGGACCTGCTCAAGGTCTCAAGG - Intronic
1085393960 11:76196904-76196926 GTGATGTGCCCAAGGTCACATGG - Intronic
1085394151 11:76198174-76198196 GTGACTTGCTCAAGGTCGCAAGG - Intronic
1085770107 11:79317625-79317647 GTGACCTGCTCAAGGTCATATGG + Intronic
1086994819 11:93344227-93344249 GAGACATACACAAGGTCAAATGG - Intronic
1087223859 11:95576368-95576390 GAAACGTGCTGAAAGTCACATGG + Intergenic
1087662235 11:101001117-101001139 GTAACTTGCCCAAGGTCACATGG - Intergenic
1087872843 11:103319393-103319415 GAAACTTGCTCTAGGTCGCATGG - Intronic
1088071355 11:105789592-105789614 TAGAGCTGCTCATGGTCACAGGG - Intronic
1088187800 11:107193055-107193077 GACACCAACACAAGGTCACAAGG - Intergenic
1088354778 11:108931362-108931384 GAAAACTGCTGAACGTCACAGGG - Intronic
1088455258 11:110026746-110026768 GAAACTTGCCCAAGGTCACAAGG - Intergenic
1088505227 11:110520975-110520997 AGGACCTGCCCAAGGTCACACGG + Intergenic
1088683627 11:112266595-112266617 TTGAGCTGCTCCAGGTCACATGG + Intronic
1088727637 11:112653671-112653693 GAGACTTGCTCAGGGTGACATGG + Intergenic
1089145966 11:116329884-116329906 GAGACCTTCCCCTGGTCACATGG - Intergenic
1089159287 11:116425063-116425085 GTGAATTGCCCAAGGTCACAGGG + Intergenic
1089270609 11:117299376-117299398 GTGATCTGCTCAAGGTGACAGGG - Intronic
1089306214 11:117527942-117527964 AAAACTTGCCCAAGGTCACAGGG - Intronic
1089607840 11:119651947-119651969 GGGCCTTGCTCAAGGTCACCTGG + Intronic
1089656360 11:119949814-119949836 GACATCTGCTGAAGATCACATGG + Intergenic
1089685871 11:120146567-120146589 GTAACCTGCCCAAGGTCACAAGG + Intronic
1089766722 11:120773156-120773178 GTAACCTGCACAAGGCCACATGG + Intronic
1089972017 11:122701574-122701596 GAGGTCTGTTGAAGGTCACAGGG + Intronic
1089975579 11:122728935-122728957 GAGACTTGCTCAAGGCCACCCGG + Intronic
1089994612 11:122893897-122893919 AAGACTTGCCCAAGCTCACATGG + Intronic
1090253396 11:125266271-125266293 GTCACTTGCCCAAGGTCACACGG + Intronic
1090269910 11:125378671-125378693 CAGTCCTGGCCAAGGTCACAAGG + Intronic
1090405605 11:126474374-126474396 GTGACTGGCTCAAGGTCACATGG + Intronic
1090431947 11:126653611-126653633 GAGCTCTTTTCAAGGTCACACGG + Intronic
1091004588 11:131941427-131941449 GTAACTTGCCCAAGGTCACATGG - Intronic
1091218851 11:133919137-133919159 GTGTCCTGCACATGGTCACAAGG + Intronic
1091311143 11:134576087-134576109 AGGACCTGCTTAAGGTCTCATGG - Intergenic
1091536236 12:1412669-1412691 GTGACTTTCCCAAGGTCACAGGG - Intronic
1091673016 12:2466721-2466743 CAGACCTGCCCAAGGTCTCCAGG - Intronic
1091855997 12:3740796-3740818 GCAACTTGCTCGAGGTCACATGG - Intronic
1091992019 12:4963049-4963071 GCAACCTGCCCAAGATCACACGG - Intergenic
1092225636 12:6746516-6746538 GTGACCTGCCCAAGACCACAAGG + Intergenic
1092262834 12:6961705-6961727 GTCACTTGCCCAAGGTCACAGGG + Intergenic
1092745843 12:11671707-11671729 GTGACCTACTGAAGGTCCCAAGG + Intronic
1092765736 12:11851041-11851063 GGGACTTGTTCAAGGTCACCTGG + Intronic
1093420761 12:18971721-18971743 GAGGCTTGCTCAAGTTCACATGG - Intergenic
1094299647 12:28948424-28948446 GTGATTTGCCCAAGGTCACATGG + Intergenic
1095464209 12:42473711-42473733 GAGACTTGTCCAAGGTCATATGG + Intronic
1096108490 12:49013656-49013678 GCAACTTGCCCAAGGTCACATGG + Intronic
1096244788 12:49978399-49978421 TTGACTTGCTCAAGGTCACCTGG + Intronic
1096577073 12:52559358-52559380 GAGACCTGCCCACAGTCACACGG - Intergenic
1096676326 12:53228072-53228094 GTGACTGGCTTAAGGTCACATGG + Intronic
1097126677 12:56782086-56782108 GAAGCATGCTCAAGGTCACCTGG - Exonic
1097289549 12:57902872-57902894 CTGACTTGCTCCAGGTCACAGGG + Intergenic
1097356826 12:58611631-58611653 GGAACTTGCTCAAGGTCACACGG + Intronic
1098870239 12:75809280-75809302 GAGTCTTGCTCAAGACCACATGG + Intergenic
1098885695 12:75958730-75958752 GAAACCTGCCCAAGTTCCCATGG + Intergenic
1099093415 12:78341334-78341356 CAGGCTTGATCAAGGTCACAAGG - Intergenic
1099171598 12:79371176-79371198 GAGACTCGCTCAAGGTCACAAGG + Intronic
1100391755 12:94150138-94150160 GAGACCTGGTAAATGTCACCCGG - Intronic
1100507805 12:95237201-95237223 GGAACTTGCCCAAGGTCACAAGG - Intronic
1100707975 12:97222141-97222163 GTGACTTGCCCAAGGTCACACGG + Intergenic
1100819424 12:98417497-98417519 GCAACTTGCTCAAGGTCACATGG - Intergenic
1101241894 12:102847209-102847231 GTGACTTGCTCATGATCACAGGG + Intronic
1101286283 12:103316623-103316645 GAGACATGATGGAGGTCACAGGG - Intronic
1101437175 12:104673762-104673784 GGAACTTGCCCAAGGTCACACGG - Intronic
1101604241 12:106235751-106235773 GTGACTTGCCCAAGGCCACATGG + Intergenic
1101613188 12:106310638-106310660 GTGACCTTCCCAAGGTCTCATGG + Intronic
1101752302 12:107591878-107591900 GAAACCTGCCCACGGTTACATGG + Intronic
1101836069 12:108296222-108296244 CTGACTTGCCCAAGGTCACAGGG - Intronic
1101854421 12:108430193-108430215 ATGACTTGCCCAAGGTCACACGG - Intergenic
1102024072 12:109703568-109703590 GGGACCTGCCCAAGGTCACGTGG + Intergenic
1102161557 12:110773326-110773348 GTCATTTGCTCAAGGTCACATGG + Intergenic
1102212920 12:111139922-111139944 GTGACTTACCCAAGGTCACACGG - Intronic
1102389787 12:112540228-112540250 AAGACTTGCCAAAGGTCACACGG + Intergenic
1102396484 12:112590383-112590405 AGGACCTGCTCAAGGTCACTGGG - Intronic
1102403024 12:112647303-112647325 GAGACTCGCTCAGGGTCACATGG - Intronic
1102452919 12:113055237-113055259 GAGATTGGCTCAAGGTCGCATGG - Intergenic
1102544764 12:113646456-113646478 GTGACCTGTGCAAGGTGACAAGG - Intergenic
1102576082 12:113856920-113856942 GTCACTTGCCCAAGGTCACACGG + Intronic
1102638401 12:114344791-114344813 GTGACTTGCTCAAGGTCATAGGG - Intergenic
1102639925 12:114358062-114358084 GTGACTTGCCCAAGGTCACATGG + Intronic
1102716341 12:114976247-114976269 GGGGCTTGCTCAGGGTCACATGG + Intergenic
1102730837 12:115107850-115107872 GAGACCTGCCCAAGTTGGCAGGG + Intergenic
1102745042 12:115242953-115242975 GTGACTTGCTCAAGATCACATGG + Intergenic
1102972114 12:117177150-117177172 GGGATTTACTCAAGGTCACAGGG + Intronic
1102980562 12:117237734-117237756 GTGAACTGCTCAAGGTAACAAGG + Intronic
1103165115 12:118763712-118763734 GAGACTTGCCCAGGGTCACATGG + Intergenic
1103174410 12:118849758-118849780 GTGACTTGCACAAGGTCACACGG + Intergenic
1103191510 12:119005907-119005929 GAGCTTTGCCCAAGGTCACACGG - Intronic
1103333395 12:120170710-120170732 GTGTGTTGCTCAAGGTCACACGG + Intronic
1103340230 12:120217011-120217033 GGGTCCTGCTCAAGGTGGCAGGG + Intronic
1103357639 12:120333413-120333435 GTAACTTGCTCAAAGTCACATGG + Intergenic
1103367125 12:120391372-120391394 GTGACTTGCCCAAGGCCACACGG - Intergenic
1103940514 12:124498995-124499017 GAGGCCTGCTAATGGTTACAGGG + Intronic
1104201487 12:126593933-126593955 GGGATATGCTCAAGGTCACCAGG + Intergenic
1104707588 12:130958940-130958962 GCGATTTGCTCAAGGTCACAGGG + Intronic
1104794454 12:131507468-131507490 GAAACCAGCTCAAGGCCCCAGGG - Intergenic
1105503184 13:20989515-20989537 GAGACAAGCTGAAGGGCACATGG + Intronic
1106320384 13:28632147-28632169 CAGAGGTTCTCAAGGTCACATGG + Intergenic
1106374522 13:29172187-29172209 GAGACCTGTCCAATGTCACATGG - Intronic
1106516048 13:30455049-30455071 GAGGCTTGCTCAAGGACAAATGG - Intergenic
1106567802 13:30901412-30901434 GAAACTTGCTCAAGATGACATGG + Intergenic
1106691132 13:32117922-32117944 GGGAGCTGCCCAAAGTCACATGG - Intronic
1107457791 13:40570904-40570926 GACACCAGCTCCAGATCACAAGG + Intronic
1108005371 13:45941047-45941069 GTGATTTGCTCAAGGTCAAACGG - Intergenic
1108241772 13:48471900-48471922 GAGACCTGCCCAAGGTGAGGTGG - Intronic
1108454420 13:50598571-50598593 CTTACTTGCTCAAGGTCACATGG - Intronic
1110108243 13:71707873-71707895 GAGCCATACTCAAGGGCACATGG + Intronic
1110910160 13:80950376-80950398 CAGACCTGCAGAAGATCACAAGG + Intergenic
1111903627 13:94230283-94230305 AAGTCCTGCTCCAGGTCACATGG + Intronic
1111971878 13:94925293-94925315 GAGACCTGCTCTACTTCCCAAGG - Intergenic
1112097481 13:96150702-96150724 GCATCCTGCTCAAAGTCACAGGG - Intronic
1112485087 13:99812496-99812518 AAGTCCTGCCCAAGGCCACAGGG - Intronic
1113469053 13:110531483-110531505 GTGACTTGCCCAAGGTCACACGG - Intronic
1114813869 14:25932515-25932537 GTGACTTGCCCAAGGTCACAGGG + Intergenic
1116057305 14:39879665-39879687 AAGACTTGCCCAAGGTCACAGGG + Intergenic
1118387422 14:65267777-65267799 AGGGCCTGCTCAAGGGCACATGG + Intergenic
1119158584 14:72433771-72433793 GTGACTTGCCCAAGGTCACATGG - Intronic
1119432402 14:74577010-74577032 GTGGCTTGCCCAAGGTCACAAGG + Intronic
1119481800 14:74962652-74962674 AAGACTTGCCCAAGGTCACACGG - Intergenic
1119690640 14:76669358-76669380 CTGACTTGTTCAAGGTCACAGGG - Intergenic
1119748878 14:77063888-77063910 GAGACATTCTCAAGGTCACATGG + Intergenic
1119881039 14:78100010-78100032 AAGACCTGGTCACGGTGACATGG - Intergenic
1120032414 14:79657220-79657242 GGGACCTGCTCAAGATCACATGG + Intronic
1120102464 14:80461124-80461146 GTGACTTGCTCAGGGTGACAGGG + Intergenic
1120108629 14:80526278-80526300 GAGAGCTGCCCAAGGTCAAATGG + Intronic
1120341964 14:83232473-83232495 GTGACTTGGTCAAGGTCATATGG - Intergenic
1120786136 14:88538775-88538797 GTGACTTGCTCATGGTTACATGG - Intronic
1120833271 14:89016898-89016920 GTGACTTGCTCAAGGTCACATGG - Intergenic
1121252808 14:92512681-92512703 GTGACTTGCTCAAGGCCATATGG - Intergenic
1121285473 14:92732101-92732123 GTGACTTGCTCAAGGTCACATGG - Intronic
1121323613 14:93007138-93007160 GCTGCCTGCCCAAGGTCACACGG + Intronic
1121346924 14:93143116-93143138 GGAACCTGCCCGAGGTCACAGGG - Intergenic
1121429245 14:93875060-93875082 GTGACCTCCCCAAGGTCACATGG - Intergenic
1121436218 14:93921853-93921875 GAGACTTGCTGAAGGTCCCATGG - Intronic
1121465853 14:94115146-94115168 AAGACATGCTCAGGGTCACATGG - Intronic
1121535376 14:94687111-94687133 GTGACTTCCTCAAGGTCACACGG + Intergenic
1121744891 14:96280315-96280337 GAAACTTGCTCACCGTCACATGG - Intergenic
1121748062 14:96318368-96318390 GTGACCTTCCCAAAGTCACATGG + Intronic
1121812879 14:96907169-96907191 GTGACTTGCACAAGGTTACAAGG + Intronic
1121861698 14:97324754-97324776 AGGACCTGCTAAAGGTCACATGG - Intergenic
1122089981 14:99331479-99331501 GTGACATGTCCAAGGTCACATGG - Intergenic
1122131859 14:99608836-99608858 GTCACTTGCCCAAGGTCACATGG + Intergenic
1122145254 14:99684840-99684862 GTCACCTGCCCAAGGTCACACGG + Intronic
1122220332 14:100234692-100234714 GAGATGTGCTCAACGTCACATGG - Intergenic
1122261330 14:100524758-100524780 CGGATTTGCTCAAGGTCACAGGG - Intronic
1122536097 14:102464096-102464118 GAGATCTGCTGAGGGCCACACGG - Intronic
1122623474 14:103072688-103072710 GAGACTCGCTCAGGGGCACACGG + Intergenic
1124494270 15:30176815-30176837 GCAACCTGCTCAAGTTCCCATGG - Intergenic
1124749300 15:32361830-32361852 GCAACCTGCTCAAGTTCCCATGG + Intergenic
1124848333 15:33311985-33312007 GCGACTTGCTCAAGGTCACTTGG - Intronic
1125933672 15:43617272-43617294 GTAACCTGCTCAAGGTCATATGG + Intronic
1125946770 15:43716734-43716756 GTAACCTGCTCAAGGTCATATGG + Intergenic
1126699680 15:51356661-51356683 GTGACCTGCCGAAGGTCACACGG - Intronic
1126988117 15:54338750-54338772 GACATTTTCTCAAGGTCACAAGG + Intronic
1127960803 15:63888891-63888913 GAGACCTGCCCAAGGTTACATGG + Intergenic
1127969208 15:63945681-63945703 GTGGCCTGCTTAAGCTCACATGG - Intronic
1128064125 15:64753960-64753982 GTGACTTGTCCAAGGTCACATGG + Intronic
1128093026 15:64931737-64931759 GTAACTTGCTCCAGGTCACAGGG - Intronic
1128171569 15:65517865-65517887 GCGACTTGCTGAAAGTCACAGGG + Intergenic
1128232610 15:66046163-66046185 GGGACCTGCTCCAGTTCACATGG + Intronic
1128260227 15:66228030-66228052 GTGACCTGCCCATAGTCACAAGG - Intronic
1128554105 15:68618723-68618745 GTAACTTGCCCAAGGTCACATGG + Intronic
1128709464 15:69860920-69860942 GAGACTTGTCCAAGGTCACATGG + Intergenic
1128727213 15:69997190-69997212 GCGACCTGCTCAAGGTTAGGTGG + Intergenic
1129157743 15:73729207-73729229 GACACCTGCACAGGGCCACAAGG - Intergenic
1129199364 15:73989732-73989754 GAAACCTGTTCAAGGTCACATGG + Intronic
1129237351 15:74231669-74231691 TGGACTTGCCCAAGGTCACACGG - Intergenic
1129257679 15:74343376-74343398 GTCACTTGCCCAAGGTCACATGG + Intronic
1129521873 15:76191395-76191417 GGGACTTGCTCAAGGCCACAGGG + Intronic
1129698774 15:77755645-77755667 AACACCTTCCCAAGGTCACAAGG + Intronic
1129700015 15:77762500-77762522 GATACCTGCCCAAGGCCACTTGG + Intronic
1129857608 15:78835800-78835822 GTTACTTGCTTAAGGTCACAGGG - Intronic
1130152701 15:81323755-81323777 GTGACTTGCCCAAGGTCACCTGG - Intronic
1130562888 15:84972355-84972377 GTGACTTGCCCATGGTCACAGGG - Intergenic
1131174851 15:90202989-90203011 GTAGCCTGCTCAAGGTCACATGG - Intronic
1132670903 16:1101972-1101994 CAGCCCTGCTCAAGGACTCAGGG + Intergenic
1133326344 16:4944609-4944631 GCCACCTGCCCAAGGTCACACGG - Intronic
1133384026 16:5354408-5354430 GTGACTTGCCTAAGGTCACATGG - Intergenic
1133654265 16:7844617-7844639 GTGACTTGCTCAATGTCACACGG + Intergenic
1133888532 16:9855211-9855233 GTGGCTTGTTCAAGGTCACATGG - Intronic
1133974681 16:10592049-10592071 TTGACTTGCTCAAGGGCACATGG + Intergenic
1134179929 16:12039350-12039372 GTGACTTGCTCAAGGTCATTTGG + Intronic
1134258220 16:12629390-12629412 GAGACCTGCTCAAGGGGAGCTGG + Intergenic
1134372991 16:13643024-13643046 GTGAACTGCTCAAGGTCACATGG - Intergenic
1134492888 16:14709088-14709110 GGGAACTGCTCAAGGGCACCAGG - Intronic
1134498269 16:14748210-14748232 GGGAACTGCTCAAGGGCACCAGG - Intronic
1134582305 16:15380881-15380903 GGGAACTGCTCAAGGGCACCAGG + Intronic
1134663318 16:16000493-16000515 GTGACTTGCCCAAGTTCACATGG + Intronic
1134796333 16:17040285-17040307 GGAACATGCTCAGGGTCACAAGG - Intergenic
1135159958 16:20085331-20085353 GCGACTTGGTCAAGGTCACGCGG - Intergenic
1135306674 16:21373117-21373139 GTGACTTGCTCAAGGTCATTTGG + Intergenic
1135313626 16:21424932-21424954 GGGAACTGCTCAAGGGCACCAGG + Intronic
1135366550 16:21857212-21857234 GGGAACTGCTCAAGGGCACCAGG + Intronic
1135445265 16:22513946-22513968 GGGAACTGCTCAAGGGCACCAGG - Intronic
1135660323 16:24291041-24291063 GTGACATGCCCAAGGTCACCTGG - Intronic
1135924312 16:26679096-26679118 ATGACTTGCTCAAGGTCACAAGG - Intergenic
1136152768 16:28362656-28362678 GGGAACTGCTCAAGGGCACCAGG + Intronic
1136179317 16:28539896-28539918 GGGACTCGCCCAAGGTCACACGG - Intergenic
1136193982 16:28638506-28638528 GGGAACTGCTCAAGGGCACCAGG - Intronic
1136210315 16:28752617-28752639 GGGAACTGCTCAAGGGCACCAGG - Intronic
1136303416 16:29352259-29352281 GTGACTTGCTCAAGGTCATTTGG + Intergenic
1136310288 16:29403636-29403658 GGGAACTGCTCAAGGGCACCAGG + Intronic
1136323737 16:29505426-29505448 GGGAACTGCTCAAGGGCACCAGG + Intronic
1136397677 16:30001892-30001914 GAGACCTGCTCAAGGCCACGTGG - Intronic
1136438422 16:30245407-30245429 GGGAACTGCTCAAGGGCACCAGG + Intronic
1136470553 16:30477025-30477047 GAGACTTGACCAAGGTCACATGG + Intronic
1137289216 16:47040344-47040366 GTGACCTCCTCAAGATCACATGG + Intergenic
1137571144 16:49567140-49567162 GAGACTTGCCAAAGATCACAAGG + Intronic
1137576135 16:49601558-49601580 GTGACTTGTTCAAGGTCACAAGG + Intronic
1137693633 16:50446926-50446948 GACACTTCCTCAAGGTCACTTGG + Intergenic
1137790023 16:51167066-51167088 ATGACCTGCCCAAGGTCACATGG - Intergenic
1137790637 16:51171870-51171892 GGGACTTGCTCAGGATCACATGG - Intergenic
1137816929 16:51407118-51407140 ATGACCTGCCCAAGGTCACATGG + Intergenic
1138480267 16:57298126-57298148 GTGATCTACCCAAGGTCACACGG + Intergenic
1138526230 16:57608972-57608994 GAGACTTGCCCAAGGTCACCCGG + Intergenic
1138542966 16:57699511-57699533 GAGACATGCTCTGGGTCACAGGG + Intronic
1138944598 16:61833043-61833065 GTGACCTGCCCACGATCACATGG - Intronic
1138956407 16:61975803-61975825 CTGAACTCCTCAAGGTCACAAGG + Intronic
1139297041 16:65910051-65910073 GTAACTTGTTCAAGGTCACACGG - Intergenic
1139857970 16:69996022-69996044 GGGAACTGCTCAAGGGCACCAGG + Intergenic
1140378308 16:74463268-74463290 GTGACCTGCTCAAACTCCCAGGG - Intronic
1140641676 16:76980972-76980994 GGGACTTGCCCAAGGTCATATGG - Intergenic
1140659215 16:77171320-77171342 GTAACTTGCTCAAGGTCATATGG - Intergenic
1140836539 16:78799593-78799615 GGGACTTGGCCAAGGTCACATGG + Intronic
1140852227 16:78945895-78945917 CTGACATGTTCAAGGTCACAAGG - Intronic
1140913947 16:79478351-79478373 GGAAGCTGCTCAAGGTCAAATGG + Intergenic
1140995292 16:80253053-80253075 GAGACTTGCCCAAGATCACACGG - Intergenic
1141202657 16:81909906-81909928 GTGACCTGCTCCAGGACACTTGG + Intronic
1141219037 16:82051955-82051977 GAGACCTGCACCAGGTGCCAAGG - Intronic
1141374869 16:83521417-83521439 GGAACCTGCTAAAGGTCACCTGG - Intronic
1141545617 16:84766250-84766272 GTGACTTGTTCAAGGTCACATGG - Intronic
1141839108 16:86563078-86563100 GAGAACTGCTGTTGGTCACAAGG - Intergenic
1141840789 16:86572918-86572940 GAGACCTTCACAAGCACACAGGG - Intergenic
1141984461 16:87570926-87570948 GGGACTTGCCCAAGGTCACTCGG - Intergenic
1142119928 16:88382254-88382276 GGAACCTGCCCAAGGCCACACGG - Intergenic
1142127925 16:88419425-88419447 AGAACCTGCCCAAGGTCACATGG - Intergenic
1142152063 16:88517013-88517035 GCGACCTGCCCCAGGTCACACGG - Intronic
1142471518 17:165719-165741 AACACGTGCTCAAGGTGACAAGG + Intronic
1142480288 17:214807-214829 GGGGTCTGCTCAAGGTCACATGG + Intronic
1142750885 17:1986920-1986942 GAGATGTCCTCAAGGTCGCACGG - Intronic
1142950273 17:3472449-3472471 GTAACTTGCCCAAGGTCACAGGG - Intronic
1143100677 17:4503139-4503161 GACACTTACCCAAGGTCACACGG + Intronic
1143289413 17:5817695-5817717 GCAACTTGCTCAAGGCCACAGGG + Intronic
1143352048 17:6295929-6295951 GAGACTTGCCTGAGGTCACAAGG - Intergenic
1143355305 17:6323565-6323587 GTCACTTGCTGAAGGTCACAGGG + Intergenic
1143610971 17:8017161-8017183 GACACTTTCCCAAGGTCACATGG - Intronic
1143794287 17:9324059-9324081 AAGACTTGCTCAAGGTCTCAGGG + Intronic
1143849881 17:9802884-9802906 GCAACCAGCTCAAGGTCACATGG - Intronic
1143982120 17:10879192-10879214 GTGACTTCCTCAAGGTCGCATGG - Intergenic
1144224762 17:13134240-13134262 GTGACTTGTGCAAGGTCACATGG + Intergenic
1146008476 17:29177059-29177081 GGGACTTGCTCAAGGTCACACGG - Intronic
1146076850 17:29738486-29738508 GAGACTTTCTCAAGGTCTCAAGG - Intronic
1146287529 17:31584314-31584336 ATGACCTGTCCAAGGTCACATGG + Intergenic
1146558677 17:33849430-33849452 GTAACCTACTCAAGGTCCCATGG + Intronic
1146667246 17:34713307-34713329 GTGACATGCTCAAGAGCACATGG - Intergenic
1146681418 17:34811011-34811033 GAGACCTGGTCCTGGCCACAAGG + Intergenic
1146927220 17:36753379-36753401 CAGCCTTGCTCAAGGTCACAGGG + Intergenic
1146944921 17:36866983-36867005 GTGACTTGCTCAAGGTCCCTTGG - Intergenic
1146959097 17:36957208-36957230 GTAACTTGCCCAAGGTCACATGG - Intronic
1147217853 17:38911388-38911410 GGGACCTGCCCAAGGTCATCTGG - Intronic
1147595288 17:41712719-41712741 GTGACTTGCCCAAAGTCACAGGG + Intronic
1147664319 17:42136514-42136536 GTGACTTGGCCAAGGTCACACGG - Intronic
1147789540 17:43004948-43004970 GAAACTTGCCCAAGGTCACAGGG - Intergenic
1147950492 17:44105013-44105035 GAGACTTGTCCAAGGTCACCTGG + Intronic
1148126354 17:45239190-45239212 GAGGCCTATCCAAGGTCACACGG - Intronic
1148152267 17:45403860-45403882 GTGACTTGCTCAAGGTCCCTCGG - Intronic
1148196129 17:45714674-45714696 GTAACTTGCCCAAGGTCACACGG + Intergenic
1148732309 17:49844958-49844980 GTGACTTGTCCAAGGTCACACGG + Intronic
1148987670 17:51637738-51637760 GTGGGCTGCCCAAGGTCACAGGG + Intronic
1149335026 17:55626777-55626799 GATGTCTACTCAAGGTCACATGG + Intergenic
1149540847 17:57467073-57467095 GAGACCTTCTCAAGGTGAGTAGG - Intronic
1149564832 17:57633684-57633706 ATGACTTGCTCAAGGCCACATGG - Intronic
1149995975 17:61406060-61406082 GGGACTTGCCAAAGGTCACACGG - Intronic
1150722785 17:67627767-67627789 GAGGCTTGCTCAAAGTCACATGG - Intronic
1151567770 17:74909242-74909264 GAGTTCTGCTCATGGCCACAGGG - Intergenic
1151904152 17:77036688-77036710 GAGAGATGCTCAAAGTCACATGG + Intergenic
1151989733 17:77566644-77566666 ATGACCCGCTCAAGGTCTCAAGG + Intergenic
1152265666 17:79293225-79293247 GTGACCTGCTCAAGCCCACATGG + Intronic
1152781884 17:82230404-82230426 GGGCCCTGCCCAAGGTCACATGG - Intronic
1154111436 18:11571899-11571921 ATGACTTGCCCAAGGTCACAAGG - Intergenic
1154119420 18:11639299-11639321 GGGAACTGCTCAAGGGCACCAGG + Intergenic
1155515269 18:26618131-26618153 AAGACTTGCTTAAGGTCACATGG - Intronic
1155557915 18:27042268-27042290 GTGACTTGGTCAAGGTCACTTGG - Intronic
1156039696 18:32806710-32806732 GAGACCTGCTTATGTTCCCAGGG + Intergenic
1156197209 18:34788501-34788523 GTGACTTGCCCAAGGTCATAGGG + Intronic
1156350819 18:36299515-36299537 GAAACCACTTCAAGGTCACAGGG - Intronic
1156596378 18:38552410-38552432 GAGGCTTATTCAAGGTCACATGG - Intergenic
1157298218 18:46461183-46461205 GGGACTTGCTCAAGGTCATTGGG - Exonic
1157306427 18:46520884-46520906 ATGACTTGCCCAAGGTCACACGG + Intronic
1157740958 18:50092384-50092406 GGGACAGGCCCAAGGTCACATGG + Intronic
1158021535 18:52847840-52847862 GTGACCTACTCAAAGTTACAAGG - Intronic
1158241746 18:55385831-55385853 CAGCCCTGCTCAAGTTCTCAGGG + Intronic
1158545745 18:58395002-58395024 GTAACTTGCCCAAGGTCACACGG - Intronic
1158589834 18:58769905-58769927 CTGGCTTGCTCAAGGTCACAGGG + Intergenic
1158876539 18:61739495-61739517 GGGATGTGCTCAAAGTCACACGG - Intergenic
1160040651 18:75342343-75342365 ACGACCTGCTCAAGGTTACGGGG - Intergenic
1160308083 18:77759891-77759913 CAGAGCTGCTCAACATCACATGG + Intergenic
1160461242 18:79040386-79040408 AAAACCTGCTCAAGATCACATGG + Intergenic
1160584426 18:79904523-79904545 GAGACCAGCTCGAGGCTACAGGG + Intronic
1160707345 19:535772-535794 AAGACCTGCCCCAGCTCACAAGG - Intronic
1161322010 19:3645705-3645727 GGTGCCTGCTCAAGGCCACATGG + Intronic
1161682102 19:5685211-5685233 GCGACTTGCCCAAGGTCACACGG - Intronic
1161793751 19:6375126-6375148 GACACATGGTCAAAGTCACAAGG + Exonic
1161885101 19:6988482-6988504 GTGGCTGGCTCAAGGTCACATGG - Intergenic
1161952567 19:7475981-7476003 GGGGACTGCTCAGGGTCACACGG - Intergenic
1162477314 19:10908272-10908294 GAAACCTGCCCAAGGCTACATGG - Intronic
1162921729 19:13906851-13906873 GACATCTGCCCAAGGTCATAGGG + Intronic
1163187459 19:15649103-15649125 GAGAGCTGCTCAAGGGAGCAAGG + Intronic
1163623443 19:18374285-18374307 GAGATCTGCTCTGAGTCACAGGG - Intergenic
1163703047 19:18796035-18796057 GGCACCTGCCAAAGGTCACACGG - Intergenic
1164573005 19:29387612-29387634 GTGACATGCTCAGGATCACATGG - Intergenic
1164632909 19:29773365-29773387 GAGCCGTGCTCTGGGTCACATGG - Intergenic
1164633679 19:29777743-29777765 GAGCCGTGCTCTGGGTCACATGG - Intergenic
1164739779 19:30567362-30567384 GAGAGCTCCTCAGGGTCACGTGG - Intronic
1164836671 19:31359424-31359446 GTGACCTGCTCAGGCTCACTGGG - Intergenic
1165404565 19:35621824-35621846 GTGTCGTGATCAAGGTCACAGGG + Intronic
1165717195 19:38053998-38054020 GGGACCTGTCCAAGGTCACACGG + Intronic
1166351562 19:42201167-42201189 GTGACTTGCCCAAGGTCACACGG + Intronic
1166411005 19:42555412-42555434 GAGTCCTGGGCATGGTCACACGG - Intronic
1166608939 19:44171596-44171618 GGAACGTGCTCAAGTTCACATGG + Intronic
1166772495 19:45292356-45292378 GTTACTTGCCCAAGGTCACACGG - Intronic
1166773491 19:45298407-45298429 GTGACTTGCTCAAGGTCACTTGG - Intronic
1166820211 19:45574594-45574616 GCTGCCTGCTCAAAGTCACATGG + Intronic
1166831585 19:45642583-45642605 GGGACTTCCCCAAGGTCACACGG - Exonic
1167020674 19:46873047-46873069 GGGACTTGCCCAAGGCCACATGG + Intergenic
1167146947 19:47686856-47686878 GCAGCCTGCTGAAGGTCACAGGG - Intronic
1168148479 19:54432447-54432469 GGGACCTTCCCAAGGTCACACGG + Intronic
925349620 2:3191706-3191728 GTGGACTGCTCAAGGACACAGGG + Intronic
925914200 2:8593097-8593119 GACACCTGCACAAGGTGAGAGGG - Intergenic
926216860 2:10911404-10911426 GGGACTTGCCCAAGGTCACGCGG - Intergenic
926268599 2:11347241-11347263 GTAACTTGCTCAGGGTCACATGG - Intronic
926350028 2:11985684-11985706 ATGACCAGCACAAGGTCACAAGG - Intergenic
926694898 2:15764337-15764359 GGGACTTCCCCAAGGTCACATGG + Intergenic
926729862 2:16028394-16028416 GAGTACTGCCCAAGGCCACAAGG + Intergenic
926863156 2:17330249-17330271 GAGACTTGCCCAAAGTCACGAGG + Intergenic
927684336 2:25160444-25160466 GAGACTTGCCTAAGGTCCCATGG + Intergenic
927915656 2:26934447-26934469 GGGACCTGCCCAAGCTCACAGGG - Intronic
928083678 2:28332373-28332395 GTGGCTTGCTCAAGATCACATGG + Intronic
928113822 2:28530980-28531002 GTGACCTGTGCAAGTTCACACGG + Intronic
928214120 2:29347145-29347167 AAAACTGGCTCAAGGTCACATGG + Intronic
928279826 2:29935854-29935876 GAGACCTGCTCAACATCATCAGG - Intergenic
928611180 2:32993809-32993831 GGAACCAGCTCAGGGTCACATGG + Intronic
929596336 2:43178681-43178703 GTGACCGGTTCAAGGTCGCATGG - Intergenic
929598612 2:43191373-43191395 GTGACCTGCCCAAGGTCACTGGG + Intergenic
929599912 2:43198522-43198544 AAGACCCGCCCAAGGTCACCCGG - Intergenic
930027512 2:47038297-47038319 GTGACTTGCCCAAGGTCACATGG + Intronic
930688691 2:54336454-54336476 GTGACTTGCCCAAAGTCACATGG - Intronic
931529268 2:63195328-63195350 GTGACCTGCTTAAGATCACATGG - Intronic
932008820 2:67954945-67954967 GTGACTTGCCCAAGGTCACATGG - Intergenic
932046023 2:68350793-68350815 GTAACTTGCCCAAGGTCACATGG + Intergenic
932108246 2:68968922-68968944 TTGACCTGTCCAAGGTCACATGG - Intergenic
932721331 2:74140870-74140892 AAAACTTGCTCAAGGTCACATGG + Intronic
933183953 2:79258325-79258347 GGGAACTGCCCAAGGTCGCATGG - Intronic
933452131 2:82467842-82467864 GAGATTTGGTCAAGGTCTCATGG + Intergenic
933693146 2:85195132-85195154 GTAACTTGCTCAAGGTTACAAGG - Intronic
933773842 2:85760018-85760040 TGGACCTGCCTAAGGTCACATGG + Intronic
933808231 2:86015574-86015596 GCCACTTGCTGAAGGTCACAGGG + Intergenic
934476432 2:94596541-94596563 GAGACCTGCCCAAGGCCAACTGG - Intronic
934603898 2:95679840-95679862 GGGACCTGCCCAAAGTCACAGGG - Intergenic
935375176 2:102388343-102388365 GAAACTTGCCCAGGGTCACACGG + Intronic
935470217 2:103450414-103450436 GAGACCTTCCCAAAGACACATGG - Intergenic
936537282 2:113322069-113322091 GGGACCTGCCCAAAGTCACAGGG - Intergenic
936913790 2:117618665-117618687 GTGACTGGCTTAAGGTCACATGG - Intergenic
938233223 2:129679753-129679775 GTAACTTGCCCAAGGTCACATGG + Intergenic
938596787 2:132795226-132795248 GAGCTCTGCTCATTGTCACAGGG - Intronic
938807633 2:134821548-134821570 GTGAGCTGCTCAAGGACCCATGG - Intergenic
938979537 2:136513247-136513269 GTGACTTGTTCAAGATCACATGG - Intergenic
939114753 2:138047844-138047866 GAGACCTGATAATGGTCACATGG - Intergenic
939919688 2:148094045-148094067 GAGACATGCCCATGATCACATGG + Intronic
941128439 2:161616054-161616076 GTGACTTGCCCAAGGTCACATGG + Intronic
941329794 2:164165670-164165692 GCCACCGACTCAAGGTCACAGGG + Intergenic
941351826 2:164447505-164447527 GTAAACTGCTCAAGGTCACAAGG + Intergenic
941625522 2:167826479-167826501 GAGACCTCCTCAGGGGCATAGGG - Intergenic
941653731 2:168121219-168121241 AGGACCTGCCCAAAGTCACATGG - Intronic
942276060 2:174325031-174325053 AAGGCCCGCCCAAGGTCACAGGG + Intergenic
942427015 2:175870875-175870897 GAGAACTGACTAAGGTCACATGG + Intergenic
942605659 2:177687862-177687884 GTGACTTGTTCAAGGTCCCAGGG + Intronic
942868593 2:180707400-180707422 GAAACCTGCCCAAGGTTACATGG + Intergenic
943537038 2:189165652-189165674 GGAACTTGTTCAAGGTCACAAGG + Intronic
944014026 2:195010524-195010546 GTGAAATACTCAAGGTCACAGGG - Intergenic
944016266 2:195043062-195043084 GTGAGTTGCTCAAAGTCACATGG - Intergenic
944930493 2:204513890-204513912 GAGGCCAGGGCAAGGTCACATGG - Intergenic
945049572 2:205810362-205810384 GAGGCCTACTGAAGTTCACAGGG - Intergenic
946395240 2:219440740-219440762 GTTACTTGCCCAAGGTCACATGG - Intronic
946458119 2:219845639-219845661 ATGACCTGCCCAAGGTCACATGG - Intergenic
947977569 2:234380262-234380284 TAGACCTGCTCACTGTCACCTGG + Intergenic
948378877 2:237539775-237539797 GTGACCTGCCGAAGGTCACATGG + Intronic
1168796481 20:613145-613167 GTGACTTGCCCGAGGTCACACGG + Intergenic
1168805178 20:668535-668557 GCGACTTACCCAAGGTCACATGG - Intronic
1168833478 20:860521-860543 GTGATTTGCCCAAGGTCACATGG - Intergenic
1168858724 20:1029375-1029397 GTCACCTACACAAGGTCACATGG - Intergenic
1168891431 20:1297373-1297395 ATGATCTGCTCAAGGTCACACGG - Intronic
1168919584 20:1520205-1520227 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1168939466 20:1696428-1696450 GGGCCTTGCCCAAGGTCACAGGG - Intergenic
1169250839 20:4060212-4060234 GTCACTTGCTCAAGGCCACATGG - Intergenic
1169304356 20:4475477-4475499 GTGAGCTGCCCAAGGTCACTAGG - Intergenic
1169537281 20:6558717-6558739 GTAACCTGCTCAAAGTCTCAGGG - Intergenic
1169647865 20:7833741-7833763 GAGTTCTGCTCAGGGCCACAGGG + Intergenic
1170427004 20:16245150-16245172 ATGACTTGCTGAAGGTCACAAGG + Intergenic
1170485694 20:16813652-16813674 GAGAACTGCTCAAGATCCAACGG - Intergenic
1170486422 20:16821090-16821112 GGGATTTGTTCAAGGTCACATGG + Intergenic
1171310665 20:24142337-24142359 GAGATTTGCTCGGGGTCACATGG - Intergenic
1172030776 20:31980545-31980567 ATGACTTGCCCAAGGTCACATGG - Intronic
1172239217 20:33401227-33401249 GTGACCTGTCCAAGGTCACACGG + Intronic
1172240929 20:33412167-33412189 GAGACTTGCTTCAGGTCACCTGG + Intronic
1172331629 20:34079741-34079763 GAGACTTGCCCAAGGTTACATGG + Intronic
1172391215 20:34566692-34566714 GGGCCCTGCAAAAGGTCACATGG + Intronic
1172495894 20:35383892-35383914 GTGACTTGCCCAAGGTCACAAGG - Intronic
1172647170 20:36477858-36477880 GGGACTTGCCCAAGGTCATACGG + Intronic
1172684964 20:36746439-36746461 GAGCCATACCCAAGGTCACAGGG + Intergenic
1172770852 20:37381868-37381890 GAGACCTGCTGAAGAGCTCAAGG - Intronic
1172801180 20:37577297-37577319 GTGACTTGCGCAGGGTCACAAGG - Intergenic
1172838930 20:37890487-37890509 GTGAGCTGCACAAGGCCACATGG + Intergenic
1172852017 20:37973230-37973252 GAGACTTTCCCAAGGCCACATGG + Intergenic
1172852968 20:37979891-37979913 ATGACTTGCCCAAGGTCACACGG + Intergenic
1172906995 20:38377813-38377835 GTGACCTTCCCAAGGCCACATGG - Intergenic
1172973502 20:38890042-38890064 GTGACCTGCCTGAGGTCACATGG + Intronic
1173421856 20:42908201-42908223 GTGACTTGTCCAAGGTCACATGG - Intronic
1174089547 20:48036161-48036183 GTGACCTACTCAAGGCCCCAGGG + Intergenic
1174162399 20:48560907-48560929 GGGTCTTGCTCAAGGTCACGAGG - Intergenic
1174179415 20:48665551-48665573 GAAACTTTCTCAAGGTTACATGG - Intronic
1174253489 20:49236638-49236660 GAAACCTGCACATGGTCACTCGG - Intronic
1174267840 20:49344845-49344867 GTGGCTTGCTCAAGGTCCCATGG - Intergenic
1174269138 20:49354338-49354360 GTGCCTTGCCCAAGGTCACATGG + Intergenic
1174367713 20:50066551-50066573 GCCACTGGCTCAAGGTCACAGGG + Intergenic
1174377822 20:50138265-50138287 AAGAACTCCCCAAGGTCACACGG + Intronic
1174392435 20:50226253-50226275 GTGACATGCTCAAGGTCACATGG + Intergenic
1174392453 20:50226389-50226411 GTGACTTGCCCCAGGTCACACGG - Intergenic
1174412164 20:50343388-50343410 GTGACTTGCCCAAGGTCACACGG + Intergenic
1174657093 20:52180812-52180834 GTAACCTGCCCAAGGTCACATGG + Intronic
1175045131 20:56097778-56097800 GTGACTTACCCAAGGTCACACGG + Intergenic
1175537853 20:59727602-59727624 GTGACTTGCCCAAGGTCACATGG - Intronic
1175669937 20:60893369-60893391 ATAACTTGCTCAAGGTCACATGG + Intergenic
1176372969 21:6073660-6073682 GGGACTCACTCAAGGTCACAGGG - Intergenic
1178235053 21:30832230-30832252 GAGAATTACTGAAGGTCACATGG + Intergenic
1178465972 21:32847927-32847949 GAGACCTGCCCATGGTCACTGGG + Intergenic
1178681149 21:34672763-34672785 GTAACTTGCCCAAGGTCACACGG - Intronic
1179131103 21:38638174-38638196 GTGACTTGCTCAAGGTCCCATGG - Intronic
1179338436 21:40480817-40480839 GATACTGGCTCAAGGTCAAAAGG + Intronic
1179451801 21:41473249-41473271 GAGACCTGCTCAAGGTCACAGGG + Intronic
1179567267 21:42257143-42257165 GGAACTTGCCCAAGGTCACACGG + Intronic
1179568300 21:42262756-42262778 ATGACCTGCTCAAGGTCACACGG - Intronic
1179750508 21:43464583-43464605 GGGACTCACTCAAGGTCACAGGG + Intergenic
1180927480 22:19566365-19566387 GTAAACTGCCCAAGGTCACAGGG + Intergenic
1181098705 22:20524353-20524375 GAGACCTAGTGAAGGTCAGAAGG + Intronic
1181256596 22:21566907-21566929 GTGACTTGCCCAAGGTCACACGG - Intronic
1181601127 22:23952430-23952452 GGGACTTGCACAAGGCCACAGGG + Intergenic
1181748752 22:24974246-24974268 GAGACCTGCCCAATGTCACAAGG - Intronic
1181771208 22:25127091-25127113 AAGTCTTGCTCAAAGTCACATGG - Intronic
1181815043 22:25431041-25431063 GGGGCCTGCCCAAGCTCACATGG + Intergenic
1181890234 22:26056392-26056414 ATGGCCTGCTCAAGGTCAAACGG + Intergenic
1181915469 22:26276308-26276330 GGAATTTGCTCAAGGTCACATGG + Intronic
1181920344 22:26315614-26315636 GAGCCCAGCCCAAAGTCACATGG - Intronic
1181935546 22:26435870-26435892 GTGACCTGCTCAAAGTCTCACGG - Intronic
1181993530 22:26856981-26857003 GTGACTAGCCCAAGGTCACACGG + Intergenic
1182038449 22:27217545-27217567 AAGACTTGCCCAAGGTCACACGG - Intergenic
1182065601 22:27429344-27429366 GTAACTTGCTCAAGGTCATATGG + Intergenic
1182097996 22:27638824-27638846 GGGACTTGCCCAAGATCACAGGG + Intergenic
1182149797 22:28020033-28020055 GAGACCTGCACAAAGCCACCAGG + Intronic
1182310149 22:29398580-29398602 GTGACTTGCTCAGGGTCACACGG - Intronic
1182442974 22:30374858-30374880 GTGAGCTGTCCAAGGTCACACGG - Exonic
1182554548 22:31122270-31122292 GGAACTTGCTCAAGGTCACCTGG - Intergenic
1182766673 22:32762575-32762597 GTGACCTCCCCAAGGTCTCATGG - Intronic
1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG + Intergenic
1183016927 22:34996468-34996490 ATGACTTGCCCAAGGTCACAAGG - Intergenic
1183106032 22:35615725-35615747 GAGACTTGTCCAAGGTCACATGG + Intronic
1183125921 22:35782017-35782039 GTGACTTGCCCAAGATCACATGG + Intronic
1183215814 22:36479234-36479256 GTGGCCTGCCCAAGGCCACAGGG + Intronic
1183273426 22:36876073-36876095 AAGACCTGCTGGAGCTCACAAGG + Exonic
1183492779 22:38125640-38125662 GTGACTTGCTCAAGGTCACACGG - Intronic
1183520896 22:38295478-38295500 GGGGCCTGCTCATGGGCACAGGG + Intronic
1183529908 22:38347725-38347747 GTGACTTGCTCAAGGTCACATGG + Intronic
1183596129 22:38813051-38813073 GAGACTTCCCCAAGATCACATGG - Intergenic
1183730072 22:39613557-39613579 GTGACTTGCCCAAAGTCACATGG + Intronic
1184040711 22:41941585-41941607 GTGACCTATTCAAAGTCACACGG + Intronic
1184101965 22:42345464-42345486 GTGACCTTGCCAAGGTCACAAGG + Intergenic
1184271494 22:43387073-43387095 GTGACCTGCCCAAGGGCACAAGG + Intergenic
1184449986 22:44577056-44577078 GGGACTTGCTCAGGGTCACACGG - Intergenic
1184499198 22:44861702-44861724 GAGACTTGCCCAAGGTCATGTGG - Intronic
1184508398 22:44917801-44917823 GTGACCTGCCCAAGGCCACAGGG - Intronic
1184558486 22:45247120-45247142 GAGTCATGCTCAAAATCACACGG + Intergenic
1184606520 22:45577587-45577609 GACTACTGCTCAAGGCCACATGG - Intronic
1185078105 22:48694096-48694118 GAAGTCTGCCCAAGGTCACACGG - Intronic
949517706 3:4822075-4822097 GTGACTTGCCCAGGGTCACACGG - Intronic
949856431 3:8466103-8466125 GTGATCTACCCAAGGTCACACGG + Intergenic
949919031 3:8987052-8987074 GAGATTTGCTCAGGGTCACACGG - Intronic
949953200 3:9246533-9246555 ATGACTTGCCCAAGGTCACAAGG - Intronic
950016049 3:9755876-9755898 GTGACCTGGCCAAAGTCACATGG - Intronic
950049846 3:9979477-9979499 GTGACTTGCTCAAGATCACATGG - Intronic
950111935 3:10424252-10424274 GAGGCCTGCTCAGGGTCATACGG + Intronic
950131695 3:10551797-10551819 GAGACATGCTTGGGGTCACATGG - Intronic
950191114 3:10976801-10976823 GGGATTTGTTCAAGGTCACATGG - Intergenic
950206843 3:11087291-11087313 GTGACTTGCTCAGGTTCACATGG + Intergenic
950243233 3:11390924-11390946 GATACTTGCTCAAGGTCACATGG - Intronic
950440768 3:13008960-13008982 GTGACTTGCACAAGGCCACATGG + Intronic
950453979 3:13081781-13081803 AAGACCCGCCCAAGGTCACTGGG - Intergenic
950489384 3:13294405-13294427 GAGAGCTGCACACAGTCACAGGG + Intergenic
950523676 3:13510863-13510885 GTCACCTGTCCAAGGTCACATGG - Intergenic
950549852 3:13659624-13659646 GAGACCTGCTCGAGGTTTGAGGG + Intergenic
950554236 3:13685641-13685663 GTGACTTGCCCAAGGTCACATGG - Intergenic
950567889 3:13781972-13781994 AGGACTTGCTCAAGGTCACACGG + Intergenic
950585632 3:13890410-13890432 GTCACTTGCACAAGGTCACAGGG - Intergenic
950897908 3:16469974-16469996 GTGACTTGCTCAAGGTCATGGGG + Intronic
951993612 3:28702872-28702894 GAAACTTGCCCAAAGTCACATGG - Intergenic
952307967 3:32162095-32162117 GTGACTTGCCCAAGGCCACAGGG - Intronic
952936501 3:38402607-38402629 GAGTGCTGCTTAAGGTCTCATGG - Intronic
953215309 3:40912739-40912761 GTGACTTGCCCAAGGTCACATGG - Intergenic
954184750 3:48908372-48908394 GTTCCCTGCCCAAGGTCACATGG + Intergenic
954241663 3:49298644-49298666 CAGAGATGGTCAAGGTCACAGGG + Intronic
954315485 3:49799138-49799160 CAGAGCTGCTCAAGGTCAACTGG + Exonic
954416340 3:50395305-50395327 GCAGCCTGCCCAAGGTCACATGG + Intronic
954423057 3:50428745-50428767 GGGACTTGCCCAAGGTCACTAGG + Intronic
955150181 3:56359566-56359588 GTGACTTGCCCAAGGCCACATGG + Intronic
955215441 3:56981707-56981729 AAGACCTGGCCAAGCTCACATGG + Intronic
955523026 3:59793470-59793492 CAGCCTTGCCCAAGGTCACATGG + Intronic
955705981 3:61728222-61728244 CAGACTTGCTCAAGGTCGCACGG - Intronic
955741762 3:62098600-62098622 GTAACTTGCCCAAGGTCACATGG + Intronic
955938534 3:64126555-64126577 GAAACCTGCCCACAGTCACATGG - Intronic
956100201 3:65760344-65760366 GAAACTTGCCCAAGGTCACACGG + Intronic
956417680 3:69051078-69051100 GTAACTTGCTCTAGGTCACACGG - Intronic
956594224 3:70948762-70948784 GTGACATGCTCAAGGTTGCATGG - Intergenic
959030060 3:101289119-101289141 GAAACCTGCTAAAGGCTACATGG + Intronic
959943090 3:112099953-112099975 GTGACTTGCTCAAGGTCACCTGG + Intronic
960360993 3:116710942-116710964 GAGTGCTTCCCAAGGTCACATGG + Intronic
960915488 3:122690250-122690272 GAGACATGCCCAAGGTCACATGG + Intronic
961379875 3:126490056-126490078 GTGACCTGCCCAAGGTCTCATGG - Intronic
961427095 3:126856871-126856893 ATGACATGCTCAGGGTCACAAGG - Intronic
961566957 3:127770787-127770809 GTGACTTGCCCAAGGTCACAAGG + Intronic
961637895 3:128344525-128344547 GTGACCTGCCCAAGGTCACAGGG + Intronic
961658783 3:128457472-128457494 GAGACGTGCTCAAGGTCACAGGG - Intergenic
963044669 3:141093900-141093922 GTGACCAGAACAAGGTCACATGG - Intronic
963219746 3:142796152-142796174 GTAACTTGCGCAAGGTCACATGG + Intronic
963371254 3:144403399-144403421 GAGACCTGCCCTAGATCTCAGGG + Intergenic
964014637 3:151929985-151930007 GGGTCCTGTTCAAGGTAACATGG - Intergenic
964724284 3:159798265-159798287 GTAATTTGCTCAAGGTCACATGG - Intronic
966239437 3:177739922-177739944 GTAACTTGCTGAAGGTCACATGG - Intergenic
967526658 3:190502925-190502947 GAGAGTTGCTTAAGGTCACACGG - Intergenic
967830557 3:193915845-193915867 TTGACTTGTTCAAGGTCACATGG - Intergenic
967877897 3:194279289-194279311 GAGATTTGCTCAAGGCCACGTGG - Intergenic
967932051 3:194696998-194697020 GAAGCCTGCCCAAGGTCAAAGGG - Intergenic
967970332 3:194994629-194994651 GTGACTTGCTCAAAGTCACACGG - Intergenic
967976830 3:195040224-195040246 GTGACTTGCCCAAGGTCACGCGG + Intergenic
968044479 3:195616370-195616392 GAGACTTGGCCAGGGTCACAGGG + Intergenic
968045279 3:195620481-195620503 GGGACTTGCCCAAGGTCACTCGG - Intergenic
968060268 3:195722421-195722443 GAGACTTGGCCAGGGTCACAGGG + Intronic
968061134 3:195726824-195726846 GGGACTTGCCCAAGGTCACTCGG - Intronic
968884523 4:3320504-3320526 GTGACTTGCTCACAGTCACAGGG + Intronic
969166429 4:5319814-5319836 GAGCTCTGCCCAAAGTCACAGGG + Intronic
969292800 4:6251594-6251616 GTGACTTGCCCAAGGTCACCTGG - Intergenic
969427686 4:7135303-7135325 GGGACTTGTTCAAGCTCACATGG - Intergenic
969485285 4:7468912-7468934 GTGACTTGTCCAAGGTCACACGG - Intronic
969869088 4:10093654-10093676 GTGACCTGGCCCAGGTCACATGG - Intronic
971066469 4:23038498-23038520 GTGACTTGCCCAAGGTGACATGG + Intergenic
971748724 4:30618874-30618896 GGGATTTGCTCAAGGTTACATGG + Intergenic
972234714 4:37117847-37117869 GCAACTTGCTCAAGGTCACATGG - Intergenic
972287219 4:37660711-37660733 TGCACTTGCTCAAGGTCACATGG + Intronic
972736672 4:41848750-41848772 GAGGCTTGGTCAAGGTCACATGG + Intergenic
973607553 4:52602571-52602593 GTGACTTGCCCAAGATCACAAGG - Intronic
974353555 4:60782501-60782523 GTGACTTTCCCAAGGTCACATGG - Intergenic
974839105 4:67281495-67281517 GAGTTCTGCTCATGGCCACAGGG + Intergenic
976001980 4:80385589-80385611 GTGACTTGCCCGAGGTCACAAGG + Intronic
976482161 4:85557364-85557386 GAGCCCTGCTCAAGCACACATGG - Intronic
976927839 4:90523682-90523704 CTGACCTGCTCAAGGTTAAATGG - Intronic
977491590 4:97720193-97720215 GAGAATTAATCAAGGTCACATGG - Intronic
977640013 4:99346893-99346915 AGGACTTGCACAAGGTCACAGGG - Intronic
977835159 4:101637376-101637398 GAGTTCTGCTCATGGCCACAGGG + Intronic
978459464 4:108935039-108935061 GTGACTTGCCCAAGGTCAGACGG + Intronic
978884928 4:113757545-113757567 GAAACTTGCCCAAAGTCACAAGG + Intronic
979459691 4:120967875-120967897 GTGACTTGACCAAGGTCACATGG + Intergenic
979513892 4:121584959-121584981 GAAACTTGCTCAAGGTCACTTGG - Intergenic
981347398 4:143692247-143692269 GTCACTTACTCAAGGTCACACGG + Intronic
982342405 4:154315276-154315298 GTAACTTGTTCAAGGTCACATGG + Intronic
983104690 4:163672116-163672138 AATACATGCTCAAGATCACATGG - Intronic
984557021 4:181226592-181226614 GAGACCTGCCCCTGGTCAGAGGG + Intergenic
984747120 4:183232393-183232415 GAGAACTGCTAATGGGCACAAGG - Intronic
984748720 4:183251049-183251071 GTGACTTGTTCAAGCTCACATGG - Intronic
984969434 4:185174055-185174077 GGGACTTACTCAAGGTCACACGG - Intronic
985170476 4:187143591-187143613 GAGACTTGCTGAATGTCACATGG + Intergenic
985489107 5:168775-168797 GAGAGCAGCTCCAGGTAACAGGG + Intronic
985890169 5:2709009-2709031 GAGGCCTTCTCCAGGCCACATGG + Intergenic
986381432 5:7190189-7190211 GTGACTTGCCCAAGGTCACATGG + Intergenic
986679187 5:10218002-10218024 GTGACCTGCACCAGTTCACATGG - Intergenic
987147855 5:15010229-15010251 GAGACCTGCCCCAGGTGCCATGG + Intergenic
987652564 5:20761913-20761935 GAGCCCTGCTCAAGGCAACCTGG + Intergenic
988093878 5:26577103-26577125 GGGACTTGCTCAACATCACAGGG - Intergenic
988742996 5:34099569-34099591 GAGCCCTGCTCAAGGCAACCTGG - Intronic
988992670 5:36686827-36686849 GGGACTTGCTCAAGGCCACATGG - Exonic
990382346 5:55230024-55230046 GTGACTTGCTTAAGGTCACCTGG + Intergenic
990488120 5:56278918-56278940 GAGACCTCCTGAAGGTCACATGG - Intergenic
991421120 5:66443201-66443223 GTGACCTGGACAAGGGCACATGG + Intergenic
992612106 5:78516804-78516826 AAGACAGGCTCAAGGGCACAAGG - Intronic
992663251 5:78982579-78982601 GAAACTTGCCCAAGGTTACAGGG - Intronic
995138586 5:108707090-108707112 TGAACGTGCTCAAGGTCACAGGG - Intergenic
995219173 5:109628597-109628619 GAGTTTTGCTCAAGGTCAAAGGG - Intergenic
995542394 5:113197777-113197799 GTAATCTGCTCAAGGTCACAGGG + Intronic
996500286 5:124209053-124209075 GACATTTGTTCAAGGTCACATGG - Intergenic
996680116 5:126222186-126222208 GAGTTCTGCTCATGGCCACAGGG - Intergenic
997297144 5:132775530-132775552 ATAACCTGCCCAAGGTCACATGG + Intronic
997430968 5:133840978-133841000 GAGACCTCCTCATGCCCACAAGG + Intergenic
997512907 5:134465638-134465660 GTGACTTGCACAAGGTCACACGG - Intergenic
997623880 5:135318767-135318789 GGGACCTGCCCAAGTTCATATGG - Intronic
997668115 5:135648576-135648598 GGGACCTGCCCAGGCTCACATGG - Intergenic
997752373 5:136358675-136358697 GGGACCTGCTCAAGGTCTCAAGG - Intronic
997815121 5:137009769-137009791 TAGACCTGCCCAAGGTCACAGGG - Intronic
997878139 5:137567224-137567246 GAAATTTGCTCAAGGTCACTTGG + Intronic
998135467 5:139671928-139671950 GCCACCTGCCTAAGGTCACAAGG - Intronic
998393759 5:141805017-141805039 GAGCTTTGCCCAAGGTCACAGGG - Intergenic
998526292 5:142846259-142846281 GAGACCTTTCCAAGGTCACATGG + Intronic
998796261 5:145822636-145822658 GTGACTTGCTCAAGGTCACATGG - Intronic
999267052 5:150273267-150273289 CAGAGCTGCTCAAGCTCACAGGG + Intronic
999319769 5:150606675-150606697 GTGACCTGCCCACAGTCACAAGG + Intronic
999437239 5:151572401-151572423 GAGACTTGCCCAAAGTCACAGGG + Intergenic
999753099 5:154644879-154644901 GAGGCCTGGTCTAAGTCACAGGG - Intergenic
999831234 5:155322219-155322241 GTAACCTTCTCAAGGCCACAGGG - Intergenic
1000036191 5:157449926-157449948 GCAAACTGCTCAAGGTCACAAGG + Intronic
1000247809 5:159463441-159463463 GTGACTTGCACAAGGTCATATGG + Intergenic
1000302215 5:159966429-159966451 GAAACTGGCCCAAGGTCACATGG + Intronic
1000815230 5:165912907-165912929 GGAACTTGCTCAAGGTCAAAGGG - Intergenic
1000899643 5:166897013-166897035 GTGACCCGCCCAAGGTCACAAGG + Intergenic
1001007407 5:168065384-168065406 GGGACGTGCTCAAGGTCCCCTGG - Intronic
1001119593 5:168968844-168968866 GTAACTTACTCAAGGTCACACGG - Intronic
1001313323 5:170626430-170626452 GACACCTGCTCACGGTGCCATGG - Intronic
1001405769 5:171476238-171476260 CAGGCTTGCCCAAGGTCACATGG + Intergenic
1001711458 5:173781938-173781960 GTGAACTGCTCAAGGGCAAATGG + Intergenic
1001798497 5:174522883-174522905 TGGACCAGCCCAAGGTCACATGG + Intergenic
1001936415 5:175708961-175708983 GAGACGTGCCCAAGGTCATACGG - Intergenic
1001954189 5:175837152-175837174 GTGACCTGGTCAAGGTCACAGGG + Intronic
1002248189 5:177903567-177903589 GAGACTTGTTCAAGGTCACACGG + Intergenic
1002409250 5:179060980-179061002 GTGACCTGCCCAAAGTCATAAGG - Intronic
1003638727 6:7858614-7858636 GAGAGAGTCTCAAGGTCACATGG - Intronic
1004199912 6:13538537-13538559 GTGACTTGCCCAAGGTCATATGG - Intergenic
1006431775 6:34001735-34001757 GTGACTTGCTCAAGGTCTCATGG + Intergenic
1006440811 6:34052543-34052565 CTGCCCTGCTCAAGGTCTCACGG - Intronic
1006524369 6:34591183-34591205 AAGACTTGTTCAAGGTCACCTGG + Intronic
1006748656 6:36363005-36363027 GTGACTTGCGCAAGATCACATGG - Intronic
1007072591 6:39048383-39048405 GGGACTTGTCCAAGGTCACACGG - Intergenic
1007307193 6:40916308-40916330 GGGACCTGCTGCTGGTCACACGG - Intergenic
1007953623 6:45896430-45896452 GAGCCTTGCTCAAGGGCACATGG + Intergenic
1008088513 6:47269088-47269110 GTGACTTGCCCAAAGTCACATGG - Intronic
1008210190 6:48712684-48712706 GTGACTTGCCCAAAGTCACAAGG + Intergenic
1008459753 6:51754483-51754505 GAGTCTTGTTCAAGGTCACTGGG - Intronic
1008506362 6:52234678-52234700 GCGACTTGCTCAAGGTCACTTGG - Intergenic
1008589891 6:52983550-52983572 GTGACCTGTCCAAGGTAACATGG - Intronic
1008895531 6:56549925-56549947 GTGACTTGTCCAAGGTCACACGG - Intronic
1009752451 6:67889439-67889461 GAGACCTTCTGTGGGTCACAGGG + Intergenic
1010057194 6:71580187-71580209 GTAACTTGCCCAAGGTCACACGG + Intergenic
1010300051 6:74249509-74249531 GGGACTGGCTCAAGTTCACATGG - Intergenic
1011207989 6:84922117-84922139 TAGATCTGCTGAAGGTCACAAGG + Intergenic
1011504289 6:88023943-88023965 ATGACTTGCTCAGGGTCACATGG + Intergenic
1011529265 6:88302270-88302292 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1012223445 6:96678661-96678683 GTGGTCTGCTCAAGGCCACATGG + Intergenic
1012265483 6:97136980-97137002 GTGACTTTCTCAGGGTCACACGG - Intronic
1013281746 6:108644194-108644216 GAAACCTGCCCAAGACCACATGG - Intronic
1013441352 6:110173510-110173532 GTAATTTGCTCAAGGTCACATGG - Intronic
1014011666 6:116483144-116483166 GAGACTTGCTTAAGGCCACTGGG + Intergenic
1014153321 6:118084096-118084118 GTGACTTGCCCAGGGTCACATGG + Intronic
1016276281 6:142356735-142356757 GTGACTACCTCAAGGTCACATGG + Intronic
1017065796 6:150527931-150527953 GTAATCTGCTCCAGGTCACAAGG - Intergenic
1017447078 6:154516869-154516891 CTGACTTGCTCAAGGTTACAGGG - Intergenic
1017587538 6:155943822-155943844 GTCACTTGCTCAAAGTCACATGG - Intergenic
1017746326 6:157449909-157449931 TAAACTTGCTCAAGTTCACATGG - Intronic
1017804460 6:157931775-157931797 CTGACTTGCCCAAGGTCACATGG - Intronic
1018002619 6:159593102-159593124 GAGACTTGCCCAAGGACACATGG - Intergenic
1018364471 6:163103873-163103895 ATGACTTGCCCAAGGTCACAGGG + Intronic
1019648177 7:2142016-2142038 GTGCGCTGCTCAAGGTGACAGGG - Intronic
1020035866 7:4962797-4962819 GGGACCTTCCCAAGGTCACAGGG + Intergenic
1020444993 7:8259679-8259701 GTAACTTGGTCAAGGTCACACGG + Intronic
1020704437 7:11526419-11526441 GAGACATGCTCAATGTGCCAAGG - Intronic
1020841087 7:13218834-13218856 GTGACTTACTCAAGGTTACAAGG + Intergenic
1022377683 7:29829698-29829720 GTGACCTGACCAAGGCCACACGG + Intronic
1023254995 7:38304504-38304526 GTGCCCTGCTCAAAGTCACTTGG - Intergenic
1023700768 7:42889945-42889967 GTTACCTGCTCAAGATTACATGG - Intergenic
1024697137 7:51869255-51869277 GAGAGTGGCTCAAGGTCACTCGG + Intergenic
1026137227 7:67674169-67674191 GTGACTTGCCCAAGGTCACAAGG + Intergenic
1026257591 7:68725960-68725982 GAGACTTGCTGAAGGTTACTTGG + Intergenic
1027162429 7:75812479-75812501 GTAACTTGCTCAAGGTCACGTGG - Intronic
1027435163 7:78156637-78156659 GTAACTTCCTCAAGGTCACATGG + Intronic
1027994514 7:85408279-85408301 GTGACATGCCCAAGATCACAAGG - Intergenic
1028655289 7:93198388-93198410 GAGTCTTGCCCAAGGTCACTTGG + Intronic
1028938969 7:96498806-96498828 GTAACCTTCTCAAGGTTACAGGG - Intronic
1029894377 7:103967006-103967028 GACAGCTGCAAAAGGTCACAGGG - Intronic
1031927654 7:127653085-127653107 GTGACTTGCTTAAGGTCACATGG + Intronic
1032616532 7:133478468-133478490 GAGACCTGCTCAGACACACATGG - Intronic
1032684318 7:134216061-134216083 GTAACTTGCCCAAGGTCACATGG - Intronic
1032710840 7:134458902-134458924 GCGAGCTGCTCAGGGTCACTCGG + Intronic
1033438268 7:141353935-141353957 GAGACTTTCTCAAGGTCAAATGG - Intronic
1033445222 7:141415431-141415453 GAGACCTGTTGAAAGTCACAGGG + Intronic
1033445518 7:141418338-141418360 GAGCCCTTGACAAGGTCACAGGG + Intronic
1033806334 7:144958565-144958587 GAGACTTGCTCAAGGTCAGATGG - Intergenic
1034550887 7:151819960-151819982 GTGACGTGCCCAAGGTCACATGG + Intronic
1034580265 7:152035479-152035501 GAGTTCTGCTCATGGCCACAGGG + Intronic
1035648850 8:1248841-1248863 GGGACCTGCACACGGTCACCAGG + Intergenic
1035708329 8:1694694-1694716 GAGAGCTGCCCCAGGCCACACGG + Intronic
1036547414 8:9785285-9785307 AGGAACTTCTCAAGGTCACATGG - Intergenic
1036770930 8:11577998-11578020 GTGAATTGCTCCAGGTCACAAGG + Intergenic
1037290585 8:17345564-17345586 GATTCCTGCTCTAGGTTACAGGG - Intronic
1037758848 8:21728718-21728740 GGGACTTGCCCAAGGTCACATGG - Intronic
1037913967 8:22760870-22760892 GAGACACGTTCAAGGTCACCTGG - Intronic
1038128277 8:24698910-24698932 GTGATGTGCTAAAGGTCACATGG + Intergenic
1038240343 8:25802342-25802364 GTGACTTGCTTAAGGTCAAATGG + Intergenic
1038513650 8:28164387-28164409 GAGACTTGCTCAAATTAACAGGG + Intronic
1038746347 8:30258513-30258535 GAAACCTGCTTAAAGTAACAAGG + Intergenic
1040906308 8:52472816-52472838 AGAACTTGCTCAAGGTCACATGG + Intergenic
1041283268 8:56233131-56233153 GTGACTTGCTCAAGTTCACATGG + Intergenic
1041414282 8:57590168-57590190 GTGACTTGCTCAAAGTAACATGG - Intergenic
1041485161 8:58368463-58368485 GTGACTTTCTTAAGGTCACACGG - Intergenic
1041716047 8:60933203-60933225 GTGACCTCCTGAAGGCCACAAGG - Intergenic
1042542691 8:69922678-69922700 GAGGGCTGCTTAAAGTCACATGG - Intergenic
1042545362 8:69946571-69946593 AGAGCCTGCTCAAGGTCACATGG - Intergenic
1042923424 8:73942197-73942219 GGGCCTTGTTCAAGGTCACATGG + Intronic
1044808424 8:96032503-96032525 GTGACAAGCCCAAGGTCACATGG + Intergenic
1045743129 8:105385948-105385970 GTAACTTGCTCAAGGTCACATGG - Intronic
1046530899 8:115443614-115443636 TCAACCTGCCCAAGGTCACATGG - Intronic
1047363545 8:124191726-124191748 AAAACCAGCTCCAGGTCACAGGG + Intergenic
1047494448 8:125399554-125399576 GGGACCTGCCCAGGGTCACACGG - Intergenic
1047942409 8:129838168-129838190 GAGACTTGCTCAAAGTCATACGG + Intergenic
1047976382 8:130134578-130134600 GTGACTTACACAAGGTCACACGG + Intronic
1048255735 8:132903789-132903811 GGGACCAGCCCAAGGTCACCTGG - Intronic
1048396679 8:134020631-134020653 GTAACTTGCTCAAGGTCACACGG + Intergenic
1048458418 8:134599491-134599513 GTGACTTGCCCAAGGCCACAGGG + Intronic
1048543058 8:135360605-135360627 GTTACTTGCCCAAGGTCACACGG - Intergenic
1048717879 8:137287936-137287958 GAGGTCTCCCCAAGGTCACATGG - Intergenic
1048871334 8:138801900-138801922 GAAACCTGCCCAAGGTCACACGG + Intronic
1048959630 8:139565183-139565205 GAGACCAGCACAAGGTTACAAGG - Intergenic
1049034908 8:140067658-140067680 GTGACTTGATCAAGGTCACAGGG + Intronic
1049190941 8:141287032-141287054 GCGACTTCCTCAAGGTCACACGG - Intronic
1049376865 8:142293524-142293546 GAGACCTGCCCAGGGTCACATGG + Intronic
1049717077 8:144098140-144098162 GAGTCCTGCACCAGGTCACTGGG - Intergenic
1051934988 9:22435361-22435383 GAGTTCTGCTCATGGCCACAGGG - Intergenic
1052058055 9:23925065-23925087 GAGTTCTGCTCATGGCCACAGGG + Intergenic
1052338383 9:27341772-27341794 GTGACTTGCCCAAGGTTACATGG + Intronic
1053151055 9:35743275-35743297 GTAACATGCGCAAGGTCACAAGG - Intronic
1053293083 9:36894926-36894948 GTCACCTGCCCAAGGTCACACGG - Intronic
1053306928 9:36991264-36991286 GTGACCTACCCAAGGTCACATGG + Intronic
1054878987 9:70125374-70125396 GAAACTTGTTCAAGGTCACAGGG + Intronic
1054892447 9:70266324-70266346 GATAATTGCTCAAGGTCACAAGG - Intronic
1054974768 9:71129577-71129599 GAAACCTGCAGAAGGTCACGTGG + Intronic
1055404104 9:75956369-75956391 GAAATCTGCCCAAGGCCACAGGG + Intronic
1055657378 9:78464866-78464888 GTGACTTGACCAAGGTCACAGGG + Intergenic
1056070535 9:82982213-82982235 GTGACATGTCCAAGGTCACAAGG + Exonic
1056411763 9:86335193-86335215 ATAACTTGCTCAAGGTCACAAGG + Intronic
1057329520 9:94100192-94100214 GTGACTTGCTCAGGGTCACGTGG + Intronic
1057802600 9:98199259-98199281 GGGACATGTCCAAGGTCACATGG + Exonic
1057802961 9:98201096-98201118 GGGACCTGCCCAAGGTCTCTGGG + Intronic
1058533880 9:105934435-105934457 GTGACTTGCTCAAGGTCATATGG + Intergenic
1058872294 9:109213036-109213058 ATGACTTTCTCAAGGTCACACGG - Intronic
1058876366 9:109248452-109248474 GAAACCTGCTCAGGGTCGCCTGG + Intronic
1058903135 9:109459302-109459324 GACATCTGCTCCTGGTCACAAGG + Intronic
1059303914 9:113339303-113339325 GTGACTTGCTGAAGGTCACAGGG + Intronic
1059332822 9:113546903-113546925 GCAATTTGCTCAAGGTCACACGG - Intronic
1059526460 9:114995599-114995621 GTGGCCTTCTCAAGGCCACAAGG + Intergenic
1059605508 9:115830525-115830547 GAGACCAGCTCCAGGTTTCAGGG + Intergenic
1059614157 9:115930792-115930814 GGGACTTGCTCTAGGTCACAGGG - Intergenic
1059781244 9:117530357-117530379 GTGACTTGCCCAAGGGCACACGG + Intergenic
1059963366 9:119589364-119589386 GGGATCTACTCAAGGTTACAGGG - Intergenic
1060025424 9:120166668-120166690 GTGACTTGGCCAAGGTCACAGGG - Intergenic
1060063356 9:120481450-120481472 GTAACTTGTTCAAGGTCACATGG - Intronic
1060152322 9:121296606-121296628 GTGACTTGCCCAAGGTCACCAGG + Intronic
1060204717 9:121675691-121675713 GTCACCAGCCCAAGGTCACAGGG - Intronic
1060672802 9:125485141-125485163 GACACTTGCTTAAGGTTACATGG + Intronic
1060730867 9:126036185-126036207 GTGACCTGCCCACGGTCACCTGG + Intergenic
1060978089 9:127777074-127777096 GAGACTTGCTTGAGGTCACACGG - Intronic
1061209000 9:129179946-129179968 GAGACTTGCCCAAGATCACATGG + Intergenic
1061211392 9:129195431-129195453 GGCACTTGCTCAGGGTCACACGG + Intergenic
1061249411 9:129417674-129417696 GTGATCTGCCCAAGGTCACCTGG - Intergenic
1061268725 9:129524110-129524132 GGGACTTGCTCAAGGTCACAAGG - Intergenic
1061510549 9:131058443-131058465 TGGCCTTGCTCAAGGTCACATGG + Intronic
1061710949 9:132487245-132487267 GGGACTTACCCAAGGTCACACGG + Intronic
1061885515 9:133589404-133589426 GAGAAAAGCACAAGGTCACATGG + Intergenic
1062011888 9:134271740-134271762 GTGCCCTGCTCAGGGTCTCACGG - Intergenic
1062161936 9:135085428-135085450 AAGACCTGTCCAAGGTCATATGG - Intronic
1062197322 9:135281519-135281541 GGGACCTGCTCAGGGACACCAGG - Intergenic
1062351865 9:136143408-136143430 GAGACTTGTTCCAGGTCTCACGG - Intergenic
1062378850 9:136277132-136277154 GTGATTTGTTCAAGGTCACATGG - Intergenic
1062497524 9:136838747-136838769 GAGGCCCCCTCATGGTCACAGGG - Intronic
1186838372 X:13460202-13460224 GATACCTCCCCAAGCTCACACGG + Intergenic
1186968740 X:14816864-14816886 GAAACTTGCCCAAAGTCACAGGG - Intergenic
1187104711 X:16229399-16229421 GTGACTTCCTCAAGGTCACATGG - Intergenic
1187435567 X:19265754-19265776 GAGACCTGCTCAAGCTCACATGG - Intergenic
1187444005 X:19344551-19344573 AAAACTTGCTCAAGGTCACAGGG - Intronic
1188028410 X:25235696-25235718 GTGACTTGCACAAGGTCACATGG - Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189226284 X:39415908-39415930 GTAACTTGCTCAAGGTCACATGG - Intergenic
1189462553 X:41253965-41253987 GAGATCTGTTCAAGGTCACAGGG + Intergenic
1189588805 X:42489931-42489953 GAAACTTGCCCAAAGTCACACGG - Intergenic
1190224634 X:48535641-48535663 GAAACAAGCTCAAGGTCAAAGGG - Intergenic
1190541170 X:51480419-51480441 GAGTTCTGCTCATGGCCACAGGG - Intergenic
1191678468 X:63816282-63816304 CTGACTTGCCCAAGGTCACACGG - Intergenic
1191975914 X:66870729-66870751 GTGACTTGCCCAAGGTCATAAGG + Intergenic
1191979596 X:66911339-66911361 GTGACTTGCTCAAGTTCACATGG - Intergenic
1192126440 X:68504796-68504818 GTAACCTGCTCAGTGTCACATGG + Intronic
1192154498 X:68733735-68733757 GAGACGTGCCCAAGGTCACTAGG + Intergenic
1192558512 X:72109345-72109367 TTGACTTGCCCAAGGTCACAGGG + Intergenic
1192709439 X:73564201-73564223 GCAACCTGACCAAGGTCACAGGG - Intronic
1193038228 X:76976802-76976824 GTGACTTGCCCAAGATCACATGG + Intergenic
1194655967 X:96573777-96573799 GTGACTTTCTCAAGGCCACAAGG - Intergenic
1195412601 X:104584254-104584276 GGGACATGCTCAAGGTTACAGGG + Intronic
1195439280 X:104883479-104883501 GAGTTCCGCTCATGGTCACAGGG - Intronic
1195671394 X:107473147-107473169 GTGACTTGCTCAGGGGCACATGG + Intergenic
1195702057 X:107712983-107713005 GTGACTTGCCCAAAGTCACATGG - Intergenic
1195707444 X:107748211-107748233 AAGTCTTGCCCAAGGTCACACGG - Intronic
1196022254 X:111002717-111002739 GACACGTGCCCAAGGTCACACGG + Intronic
1196699283 X:118650133-118650155 GTGACTTGCTTAGGGTCACAGGG - Intronic
1197627888 X:128823594-128823616 GTAACTTGCTCAAAGTCACAGGG + Intergenic
1197714050 X:129693529-129693551 GTGACCTGCCTAAGGTCACACGG - Intergenic
1198506639 X:137307930-137307952 ATGACCTGCACAAGGCCACATGG - Intergenic
1198523119 X:137472783-137472805 GGGACATGCTCAAGGTCACACGG - Intergenic
1198551118 X:137745873-137745895 ATGACATGCTCAGGGTCACAAGG + Intergenic
1198694724 X:139323913-139323935 CAGATTTGCTCAAGGTGACATGG + Intergenic
1199088037 X:143651694-143651716 GTGATTTGCTCAAGGTCACATGG + Intergenic
1199297280 X:146173542-146173564 GGAACCTGCTCAAGGCCACTAGG - Intergenic
1199434793 X:147801521-147801543 GTAACTTGCTCAGGGTCACAGGG + Intergenic
1199504239 X:148543509-148543531 GTGACTTGCCCAAGGCCACAGGG + Intronic
1199713698 X:150490967-150490989 GGGACTTTCTCAAGTTCACACGG + Intronic
1199760234 X:150899064-150899086 GAGCCCTTCTCAAGGTCACCCGG - Intergenic
1199982812 X:152930104-152930126 GTAACTTGCTCAAGGTCACATGG + Intronic
1200069599 X:153521412-153521434 GAGACAAGTCCAAGGTCACATGG + Intronic
1200248865 X:154541707-154541729 GGGATCTGCCCAAGGACACAAGG + Intronic
1200711007 Y:6485040-6485062 GAGTTCTGCTCATGGCCACAGGG - Intergenic
1201022927 Y:9676946-9676968 GAGTTCTGCTCATGGCCACAGGG + Intergenic