ID: 1179454636

View in Genome Browser
Species Human (GRCh38)
Location 21:41490742-41490764
Sequence CTCCCTCCTGGCCCATGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 270}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179454636_1179454647 20 Left 1179454636 21:41490742-41490764 CCAGCTCATGGGCCAGGAGGGAG 0: 1
1: 1
2: 1
3: 28
4: 270
Right 1179454647 21:41490785-41490807 CAGTGATGCCCAGCAGCCCCAGG 0: 1
1: 0
2: 5
3: 48
4: 367
1179454636_1179454648 26 Left 1179454636 21:41490742-41490764 CCAGCTCATGGGCCAGGAGGGAG 0: 1
1: 1
2: 1
3: 28
4: 270
Right 1179454648 21:41490791-41490813 TGCCCAGCAGCCCCAGGTCCAGG 0: 1
1: 0
2: 13
3: 66
4: 593

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179454636 Original CRISPR CTCCCTCCTGGCCCATGAGC TGG (reversed) Intronic
900186159 1:1334242-1334264 GCCCCTCCTGGCCAATGTGCAGG + Exonic
900316524 1:2059946-2059968 GTCCCTGCTGGCCCCTGAGCTGG + Intronic
900343685 1:2200786-2200808 CTCCCCCATGGGCCAAGAGCTGG + Intronic
900647574 1:3715865-3715887 CTCCATCCTGGGCTATGATCGGG - Intronic
900650293 1:3727093-3727115 CTCCCTGCTCCCCCATGTGCAGG + Exonic
900999663 1:6142467-6142489 CACCATCCTGGCCGATGAGATGG - Exonic
901455390 1:9360190-9360212 CACCCTCCTGGCCTCTAAGCAGG - Intronic
901497601 1:9630851-9630873 CTCCCTGCTGGGCCAGGAGCCGG - Intergenic
902447628 1:16477019-16477041 CTCAGTCCTGGCCAAGGAGCTGG - Intergenic
902467526 1:16627234-16627256 CTCAGTCCTGGCCAAGGAGCTGG - Intergenic
902507054 1:16945495-16945517 CTCAGTCCTGGCCAAGGAGCTGG + Exonic
903389507 1:22953978-22954000 CTCGCTCCTGGCCCACGTCCTGG - Exonic
904232532 1:29088074-29088096 CTCCCTCCTGTCGCACAAGCTGG + Intronic
904418973 1:30379361-30379383 CTCCCTCCCCTCCCATGCGCTGG + Intergenic
904965042 1:34365471-34365493 AGCCCTCCTAGACCATGAGCTGG - Intergenic
905773480 1:40653444-40653466 CTCCCTCCTGCATCCTGAGCTGG - Intronic
907391387 1:54160637-54160659 CTTCCCACTGGCCCAGGAGCTGG - Intronic
907518272 1:55007111-55007133 CTCCTTGCTGGCCCCTGAGATGG + Exonic
912521691 1:110250164-110250186 CTCCCTCCTCCCACATGACCAGG + Intronic
913089263 1:115465604-115465626 CTCCCACCTCCCCCATGAGCAGG - Intergenic
913991856 1:143620429-143620451 CTCCTTCTTTGCCCATCAGCAGG - Intergenic
918686036 1:187416973-187416995 TTCCCTCCTGCCCCATTAGAAGG - Intergenic
919744824 1:201002182-201002204 TGGCCTCCTGGCTCATGAGCTGG + Exonic
919793086 1:201304922-201304944 CTCCCAGCTGGCCAATGAGGTGG - Intronic
920041910 1:203103561-203103583 CTCCCTCCTGAGCCATTGGCTGG + Intronic
920417316 1:205807430-205807452 CCCACTCCAGGCCCATGAGCTGG - Intronic
920830170 1:209457346-209457368 TTCCCTCCTGACCCAGGAGAAGG - Intergenic
921519354 1:216140710-216140732 ATCCCTTCAGGCCCCTGAGCTGG - Intronic
922609352 1:226912955-226912977 CTCTCTCCTGGCCCCTGGGAGGG - Intronic
922868514 1:228881342-228881364 CTCCATGCTGGCCCATCAGTCGG + Intergenic
924548836 1:245055109-245055131 CTCCCTCCAGGCCAAAGAGCAGG - Intronic
1063248837 10:4252166-4252188 CCCCCTCCTGGCTCAGGTGCAGG - Intergenic
1064030067 10:11877838-11877860 GTCCCTGCTGCCCCCTGAGCTGG - Intergenic
1067084561 10:43230918-43230940 CTGTCTCCAGGCCCTTGAGCTGG - Intronic
1069867468 10:71512613-71512635 CTCCCTGCTGCCCCATGAGAGGG - Intronic
1070562790 10:77580530-77580552 CTTCCTCCTGGCCCATGACTTGG + Intronic
1070731762 10:78833683-78833705 CTCCCTCCTGCCCCTTGACCCGG + Intergenic
1073059365 10:100724310-100724332 CTCCCTCCTGCCCACTGCGCGGG + Intergenic
1075344289 10:121670849-121670871 CTCCCTGCTGGCCCCTGGACAGG + Intergenic
1075900636 10:126040409-126040431 CTCCCACCTGGACCCTCAGCTGG + Intronic
1076747096 10:132519957-132519979 CTGCCTCCTGGCCCCGGGGCTGG - Intergenic
1077094453 11:793365-793387 CTCCCTCCTTTCCCCTGACCAGG - Intronic
1077233924 11:1470839-1470861 CTCCGTCCTGGCCCGGGAGATGG - Intronic
1077895592 11:6451021-6451043 CTCCCTTGGGGCCCATGAGGCGG + Exonic
1078727264 11:13942846-13942868 CACCACCCTGGCCCATGAGAAGG + Intergenic
1079237583 11:18701067-18701089 CTTCCTTCTGGCCCATGGCCTGG + Exonic
1081910384 11:46696390-46696412 CTCCCTCCAGGCCCTGCAGCTGG + Intronic
1083259354 11:61514854-61514876 CTCCTTCCTGGTCCCTGAGGTGG - Intergenic
1083291368 11:61692172-61692194 TGCCCACGTGGCCCATGAGCCGG + Intronic
1083295080 11:61710995-61711017 CTGCCTTCTGGCCCCAGAGCAGG - Intronic
1083600230 11:63942766-63942788 CTGCCTTCTGCCCCATGGGCAGG + Intronic
1083652139 11:64209864-64209886 CTCCCTCCAGGAGCATGAACAGG - Intronic
1084275692 11:68049946-68049968 TTTCCTCCTGGGGCATGAGCAGG - Exonic
1084433388 11:69123752-69123774 CTCCCTCCTGGCCCTTGCAGGGG + Intergenic
1084516198 11:69639185-69639207 CTCCCTCCTGGACCCAGAGCCGG + Intergenic
1084951145 11:72666193-72666215 CTCCCTCCAGCCCCTAGAGCAGG - Intronic
1087046267 11:93846303-93846325 CTCCCTGCTGGTCTAGGAGCGGG - Intronic
1087175257 11:95089990-95090012 CTTCCTCCTCGCCCACGAGCCGG - Exonic
1089243024 11:117098117-117098139 CTGCCGCCTGGCCCCTGCGCCGG + Intronic
1089566259 11:119373252-119373274 CTCCCTCCTGGACTATGACCGGG - Exonic
1091328538 11:134712425-134712447 CTGCCTACTGGCCCATCAGGGGG + Intergenic
1091346035 11:134854828-134854850 CTCACTCCTGGCCCCTCAGTGGG + Intergenic
1092295633 12:7197888-7197910 CCCACTCCTGGCCCATGACAAGG - Intronic
1092446993 12:8567232-8567254 CTCCTTCCAGTCCCATGAGATGG + Intergenic
1094489577 12:30950747-30950769 AGCCATCCTGGGCCATGAGCTGG - Intronic
1096117024 12:49060645-49060667 CTATTTCCTGGCCCAAGAGCTGG + Intergenic
1097183278 12:57183202-57183224 CTTCCTCCCGGCCCATGCTCTGG + Intronic
1098355223 12:69606138-69606160 TTTCCTCCTGTCCCATGGGCTGG + Intergenic
1099729727 12:86484814-86484836 CTCCCCCAAGGCCCAAGAGCAGG + Intronic
1102695960 12:114799711-114799733 CTCCCCGCTGGCCCTAGAGCAGG - Intergenic
1103417456 12:120752588-120752610 CTCCCTCCATCCCCATGACCAGG - Intergenic
1103842915 12:123879841-123879863 CTCCCGCTTGGCCCATGCTCAGG - Intronic
1104386832 12:128357959-128357981 GACACTCCTGGCCCCTGAGCAGG - Intronic
1104849440 12:131864295-131864317 CTTCCTGCTGGAACATGAGCAGG + Intergenic
1104989623 12:132618546-132618568 CCCCCACCTGGACCAAGAGCTGG + Intergenic
1105441263 13:20416832-20416854 CTCCATGCTGCCCCATGACCTGG + Intronic
1111193799 13:84845203-84845225 CTGCCTCCTGCCCAAGGAGCTGG - Intergenic
1112545612 13:100366427-100366449 CTCCATCCTGTGCCAGGAGCTGG + Intronic
1113171582 13:107510829-107510851 CTCCATCCTGGCTCATGGGATGG + Intronic
1115773189 14:36687583-36687605 CTGCCTACTGGCCCAGAAGCTGG - Intronic
1118442301 14:65822820-65822842 CCCCCTCAGGGCCCATGTGCTGG + Intergenic
1118951105 14:70437471-70437493 CTCCCTCCTGGGCTAGGAGGTGG + Intergenic
1119029457 14:71180397-71180419 CTGCCTCCTTTGCCATGAGCAGG - Intergenic
1119344241 14:73909085-73909107 CTCCCTCCTGGCCCAAGAGCTGG - Intronic
1119435497 14:74595351-74595373 CTCAGCCCTGGGCCATGAGCTGG - Intronic
1119643598 14:76331804-76331826 CACCCTCCTGGCACAGGTGCAGG - Intronic
1119830681 14:77699610-77699632 CTCTCTCCTGGCCCATCACAAGG + Intronic
1119903016 14:78277307-78277329 CTCCCACCTGCCCTATGAGTGGG - Intronic
1122610006 14:102975848-102975870 CCCCCGCCTGGCCCCGGAGCCGG + Intronic
1122783507 14:104153621-104153643 GTGCCTCCTGGCCCCAGAGCTGG + Intronic
1122811533 14:104291752-104291774 CTCGCTCCTGGCCCCTGGGGCGG + Intergenic
1122968147 14:105141266-105141288 CTTCCACCTGGCCCTGGAGCTGG - Exonic
1128374955 15:67067540-67067562 GTCCACCCTGGCCCAGGAGCAGG - Intronic
1129171379 15:73810223-73810245 CTCCCTTCTGACCCCAGAGCAGG - Intergenic
1129252118 15:74314834-74314856 CTCTCACATGGCCCATGTGCAGG + Intronic
1129674197 15:77623517-77623539 CTGCCTCCTGGCCCATGGGGAGG + Intronic
1129942143 15:79507440-79507462 CTCACACCTAGCCCAGGAGCTGG + Intergenic
1130322879 15:82854951-82854973 GTCCCTCCTGGCCCTGGATCAGG - Intronic
1131071574 15:89469831-89469853 CTCCCTCCTGTGCAATGTGCAGG - Intergenic
1131095160 15:89649918-89649940 CTCCCTCCTTGAGGATGAGCAGG - Exonic
1132106822 15:99068957-99068979 CTCCTTCCATGCCCATGGGCAGG + Intergenic
1132415162 15:101614190-101614212 CTTCCTCCTTCCCCAGGAGCAGG + Intergenic
1132729760 16:1355667-1355689 CTCCCTCCTGGACAGTGTGCTGG - Intronic
1132767166 16:1540195-1540217 TTCCCACCTGGCCCTTGGGCTGG - Intronic
1132873794 16:2126968-2126990 TGCCATCCTGGCCCATGAGTGGG - Intronic
1133424794 16:5678872-5678894 GTCCATCCTTACCCATGAGCTGG - Intergenic
1133876819 16:9742810-9742832 CACACACCTGGCCCAGGAGCTGG + Intergenic
1135325134 16:21520913-21520935 CTCCCCCGTGCCCCAGGAGCTGG - Intergenic
1136016494 16:27404194-27404216 CACCCTCCTGGCAGAGGAGCGGG - Intronic
1136336617 16:29614181-29614203 CTCCCCCGTGCCCCAGGAGCTGG - Intergenic
1137476884 16:48817081-48817103 TTCCCTCCTGGCCCATGACAAGG - Intergenic
1138081440 16:54094714-54094736 CTCCCTCCCAGCCCCAGAGCTGG + Intronic
1138094374 16:54200553-54200575 GTCTCTCCTGGCCAATGAGTAGG - Intergenic
1138094861 16:54203591-54203613 CTCTCTACTGGCCAATGGGCGGG + Intergenic
1138205336 16:55120337-55120359 CTGCCTCCTGGCCCTGGGGCAGG - Intergenic
1139648209 16:68347261-68347283 CTCCGTGCTGGCCCATCACCTGG + Exonic
1140111988 16:72012481-72012503 CTCCCAGCTGCTCCATGAGCTGG + Intronic
1141628997 16:85276746-85276768 CTCGCTCGTGGCCCAGCAGCAGG + Intergenic
1142037341 16:87869965-87869987 CTCCCCCGTGCCCCAGGAGCTGG - Intergenic
1142154032 16:88525115-88525137 CTGCCTCTTGGCCCATCCGCAGG - Intronic
1142904397 17:3032739-3032761 CTCCCTCCTGGGTCAGAAGCGGG - Intronic
1143110960 17:4552515-4552537 CTTCCTCCTGGCCCAGCAGAAGG - Exonic
1143379322 17:6486169-6486191 CTCCTTCCTCCCCCATGAGATGG + Intronic
1143922132 17:10338302-10338324 CAGCCTCCTGACCAATGAGCCGG - Intronic
1144702295 17:17347578-17347600 CTCTCTGCTGGGCCCTGAGCGGG - Exonic
1144823412 17:18091149-18091171 CTGCTTCCTGCCTCATGAGCAGG - Intronic
1145264211 17:21371768-21371790 GTCCCTCCTGCCCCATCAGGAGG - Intergenic
1145366582 17:22270861-22270883 CTCCCTTCTGGCCCAGGGTCTGG + Intergenic
1147604620 17:41767510-41767532 CGCCCTCCTGGTACAGGAGCAGG + Exonic
1147879849 17:43646370-43646392 CTCTCTCCGGGCCCGTGGGCCGG - Intronic
1149555789 17:57572586-57572608 GTACCTCCTGGCACATAAGCAGG + Intronic
1151426037 17:74031766-74031788 TCCCCTCCTGGGCCATCAGCAGG + Intergenic
1152336576 17:79702522-79702544 CTCCCTCCTGACCCCAGTGCTGG - Intergenic
1157544691 18:48539461-48539483 CACCCCGCTGGCCCAGGAGCAGG - Intronic
1157597500 18:48872668-48872690 CTCCCACCTGGCCAATTAACTGG - Intergenic
1157814646 18:50721930-50721952 CTCCCCAGGGGCCCATGAGCTGG + Exonic
1160225361 18:77007464-77007486 CTCCCTCCAGCCCCCTGAGCAGG - Intronic
1160965889 19:1746747-1746769 CCCCGTTCTGGCCCATGCGCCGG - Intergenic
1161443435 19:4305039-4305061 CTCCCTCCTGGCCGCGGACCAGG + Intronic
1161716817 19:5880837-5880859 CTCCCTCCTGGCCCAGGGGGAGG - Intronic
1163218440 19:15897506-15897528 CTGGCTCCTGGCCCATGTCCTGG - Exonic
1163262874 19:16201805-16201827 CTCCAGCCTGGCCCCTTAGCTGG - Intronic
1163634083 19:18430422-18430444 CTCCCTCCTGGACGAAGGGCAGG + Intronic
1164445296 19:28312458-28312480 CCCTCCCCTGGCCAATGAGCAGG - Intergenic
1164826856 19:31290311-31290333 CACCCTCCTGGCTCTTGACCGGG + Intronic
1165069814 19:33248788-33248810 GTCCCTCCTGGCTCCTGAGAAGG - Intergenic
1165077806 19:33290479-33290501 GTCCCTCCAGGCCCCTGTGCTGG + Intergenic
1166750031 19:45160178-45160200 CTCCCTCCTGCCTCAGGAGCAGG - Intronic
1166873747 19:45885354-45885376 GTCCCGCCTGGCCAATGGGCTGG - Exonic
1167112290 19:47469516-47469538 CACCCTCCTAGCCCAGGGGCTGG + Intronic
1168148165 19:54430854-54430876 CTCGCTCCAGGCCCAGCAGCTGG - Exonic
1168703255 19:58453883-58453905 TTCCCTCCTGGTTGATGAGCAGG + Intronic
925739479 2:6993273-6993295 CCCCCGCCAGCCCCATGAGCTGG - Intronic
925764274 2:7215607-7215629 CTCCCACCTGCCCCATGTACAGG - Intergenic
927981957 2:27380102-27380124 CTCTCTCGAAGCCCATGAGCTGG + Exonic
929431652 2:41892705-41892727 CTCTCTCCTGGCCCAGGGCCAGG - Intergenic
931981681 2:67699902-67699924 CTCGCTCCTGGCCCATGAACTGG + Intergenic
932092189 2:68816222-68816244 CTCCTTGCTGGCACATGGGCAGG + Intronic
933726532 2:85430528-85430550 CTTCCTCCAGGCCCAGGAGGAGG + Intronic
934526766 2:95056873-95056895 GTCCCTCCTGGCGCCTGACCGGG - Intergenic
934615752 2:95769608-95769630 CTCCAGCCTGTCCCCTGAGCTGG + Intergenic
934645140 2:96054949-96054971 CTCCAGCCTGTCCCCTGAGCTGG - Intergenic
934838544 2:97611038-97611060 CTCCAGCCTGTCCCCTGAGCTGG - Intergenic
936241357 2:110791005-110791027 CTCCTTCCTGGCCTGTGGGCTGG + Intronic
936973595 2:118197758-118197780 CTCCCTCCTTGCCGAGGAGCTGG + Intergenic
937290885 2:120781110-120781132 CTCCCACCAGGCCCAGAAGCAGG - Intronic
937539193 2:122927419-122927441 CTTCCTGCTGGCCCGTGAGAAGG + Intergenic
937871905 2:126792195-126792217 CTCCATCCTGGCTCATGGGAAGG - Intergenic
938734605 2:134175025-134175047 TTTCCTCCTGGCCCATGGGCAGG + Intronic
941094032 2:161214973-161214995 CTCCCTCTTGGACAAAGAGCAGG - Intronic
941922327 2:170863706-170863728 CTGCCTCCTGTGCAATGAGCTGG - Intergenic
942245000 2:173999530-173999552 CTCCCTCCTAGCTCAGGAGCCGG - Intergenic
942362001 2:175181854-175181876 CTCCCTCTTGCCCCATCACCAGG - Exonic
945950734 2:216036232-216036254 CTCCATCCTGGCCCTTCAGCTGG - Intronic
946167996 2:217877129-217877151 CCTCCTCCTGGCCCAGGAGCAGG + Intronic
946325146 2:218981207-218981229 CTCCTTCCTGGGACCTGAGCAGG - Exonic
947735045 2:232449962-232449984 CAGCCTCCTGGCCCCTGAGGAGG + Intergenic
948667746 2:239546775-239546797 CAGCCTCCTTGCCCCTGAGCAGG + Intergenic
948721927 2:239905969-239905991 CCCCATCCTGTCCCATGCGCGGG + Intronic
948900973 2:240956745-240956767 GTCCAGCCTTGCCCATGAGCTGG - Intronic
1170639455 20:18138488-18138510 CTCCCTCCTGGCCCAAGGTTGGG + Intronic
1170793600 20:19527560-19527582 CTCTCTCCTGCCTCATGAGCAGG - Intronic
1171454268 20:25258594-25258616 GTGCCTCCTGGGCCCTGAGCGGG - Intronic
1172275491 20:33676881-33676903 CTCGCTCCTGGAGCATGTGCGGG - Exonic
1174295423 20:49542116-49542138 CTCTCTGCTGCCCCTTGAGCAGG - Intronic
1175403394 20:58713016-58713038 CTCTCCCCAGCCCCATGAGCTGG + Intronic
1175717263 20:61263423-61263445 CTCCTTCCTGGCCCCTGATGTGG - Intronic
1175824120 20:61927447-61927469 CTCCCTCCTGGCCCGGCAGGAGG - Intronic
1178473626 21:32917489-32917511 CTTCCTCCTGGGCTCTGAGCAGG - Intergenic
1178491485 21:33055413-33055435 CTCCCCTCTGCTCCATGAGCGGG + Intergenic
1179454636 21:41490742-41490764 CTCCCTCCTGGCCCATGAGCTGG - Intronic
1179523643 21:41961581-41961603 CTCCCTCGGGCCCCATGAGCTGG - Intergenic
1179874241 21:44259586-44259608 CTCCCTCATGGCCTCAGAGCAGG - Intronic
1181162328 22:20966086-20966108 CTCCTTCCTGGCCCAGGCCCTGG + Intronic
1182737865 22:32543861-32543883 CTCCATCTTGGGCCATGAGATGG + Intronic
1183318252 22:37148685-37148707 CTCCCTACAGCCCCATGAGGAGG + Intronic
1183499448 22:38169583-38169605 ATCCCTCCAGGCCCAGGATCTGG - Intronic
1183520427 22:38293593-38293615 CTCCCTCCTCGCCCACAGGCAGG + Intronic
1183785777 22:40028339-40028361 TCCTCTCCTGGGCCATGAGCAGG - Intronic
1184242431 22:43218195-43218217 GTCCTTCCTTGCACATGAGCCGG - Intronic
1185078194 22:48694586-48694608 CTCCTCCCTGCCCCATGTGCTGG + Intronic
1185089771 22:48759314-48759336 CTGCCACCTGGCCCGTGATCTGG - Intronic
1185128244 22:49023516-49023538 CTGCCTCCTGTCCCTTGAGAGGG - Intergenic
953871425 3:46630380-46630402 CACCCACCAGGCCCATGACCAGG - Intergenic
954626335 3:52023917-52023939 CTCCCTCCTGAGGCCTGAGCTGG - Intergenic
954714694 3:52521221-52521243 ATCCCTCCAGGCCCATGTCCTGG - Intronic
954945592 3:54421494-54421516 GGCCCTCCTGGCTCAGGAGCAGG - Intronic
955966593 3:64395523-64395545 CTGCATCCTGGCCAATGACCGGG + Intronic
959184835 3:103033203-103033225 CTTTCTGCTGGCCCATGATCGGG + Intergenic
961506072 3:127371263-127371285 CTCCCTCCAGGCACAGGAGGGGG + Intergenic
961691302 3:128671855-128671877 CTCCCTCCTGTCCCACAGGCCGG + Intronic
962941436 3:140128256-140128278 CTCCTCCCTCGCCCAAGAGCTGG - Intronic
963040718 3:141067730-141067752 CTGGCTCCTGGCCCCTCAGCTGG - Intronic
963277663 3:143349016-143349038 CTTCCTCCTGCCCCAAGATCAGG - Intronic
963299384 3:143581842-143581864 GTCTCTCCTGGCCCACCAGCAGG + Intronic
965450963 3:168837266-168837288 CTCCCTCTGGGCCCAGGAGATGG - Intergenic
965965702 3:174486314-174486336 CTCCCTCTTGGAGCATGAGCAGG + Intronic
968538893 4:1152200-1152222 TTGCCTCATGGCCCATCAGCTGG - Intergenic
968554697 4:1240957-1240979 CACCCGGCTGGCCCAGGAGCAGG - Intronic
968615468 4:1575729-1575751 CTCCCTCCTTGCCAGAGAGCAGG + Intergenic
968905629 4:3449409-3449431 CTCCCTCCTGACCCTCCAGCGGG + Exonic
969330041 4:6469343-6469365 CTACCTCCTGTTCCTTGAGCAGG - Intronic
969330623 4:6471976-6471998 CTCCCTCCTGGGCCCCGGGCAGG + Intronic
969436400 4:7191921-7191943 CTCCCTCGTGGCCCCTGGGTTGG + Intergenic
969518779 4:7663783-7663805 CTTCCTCCTGGCTCACAAGCTGG + Intronic
969680782 4:8642264-8642286 CTCCCTCCTGGACAAAGGGCAGG - Intergenic
975978407 4:80126266-80126288 CTCCTTTCTGCCCCATGAGTGGG - Intergenic
976522862 4:86050065-86050087 TTCTCTCCTGGCCATTGAGCAGG + Intronic
976727738 4:88231160-88231182 CTTTCTCCTGCCCCAAGAGCAGG - Intronic
978781288 4:112557717-112557739 CTCCCTCCAGGACAAAGAGCAGG - Intronic
983296702 4:165875271-165875293 CTTCCTCCAGGCCCAAGAGAGGG - Intronic
983801024 4:171929900-171929922 CTCACACCTGGCCCAACAGCCGG + Intronic
983900785 4:173131609-173131631 CAACCTCCTGGCCCATGAAAAGG + Intergenic
985705610 5:1399923-1399945 CTTGCTCCTGCCCCATGTGCAGG + Intronic
985775809 5:1841168-1841190 CCCCCTCCTGTCCCCTGAGGAGG - Intergenic
987085221 5:14461589-14461611 CTCCCTCCTGGCCCAGGCCTGGG - Intronic
990672780 5:58151247-58151269 CTCAGCCCTGGCCCCTGAGCAGG - Intergenic
990742617 5:58927673-58927695 TTCCCTTCTGGTCCCTGAGCTGG - Intergenic
992997548 5:82347819-82347841 CTCCTTCTTGGCTCAGGAGCGGG - Intronic
997379227 5:133423458-133423480 CTCCCTCCTGGAACCTCAGCGGG + Intronic
997433179 5:133855510-133855532 TTCCCTCCTAGCCCAGGAGGAGG + Intergenic
997725786 5:136118859-136118881 CTCTCTCCTGGTCCTTGAGAGGG - Intergenic
997753615 5:136373711-136373733 CTCCCTCCAGGTTCATGACCAGG - Intronic
999240199 5:150123028-150123050 CTCCCTCCTGGTACCTGGGCAGG + Exonic
999283108 5:150377792-150377814 CTCCCACCTGTACCATGAGGTGG + Intronic
999896772 5:156042698-156042720 CTCCCCCCAGGCCCACCAGCTGG - Intronic
1001328552 5:170746361-170746383 CTTCCTCCTGCCCCATGGCCTGG - Intergenic
1005909535 6:30296213-30296235 CTCCCTCTTTGCCCACTAGCAGG - Intergenic
1006298045 6:33178787-33178809 CTCCCTACTGCACCCTGAGCTGG + Intronic
1008304576 6:49886060-49886082 CTCCATTCTGGCCCAGGACCAGG + Intergenic
1010678354 6:78769953-78769975 CTGCCTCCTGTCACATCAGCTGG + Intergenic
1019289312 7:242562-242584 CTCCATCCTGGCCAGGGAGCGGG + Intronic
1019748868 7:2716421-2716443 CTCCCTCCTCACCCATGCTCTGG - Exonic
1020879368 7:13739768-13739790 TTCCCTCCTGGCTCAAGAGTGGG + Intergenic
1023818908 7:43969621-43969643 CTACCTCCTGGTCCCAGAGCTGG - Intergenic
1026909236 7:74083141-74083163 CTCCCTCCAGGACCCTGGGCAGG + Intronic
1027475934 7:78631372-78631394 CTCCCTCCTGGACCAGGCGGTGG + Intronic
1028351705 7:89857632-89857654 CTCCATACTGTCCCATCAGCAGG + Intergenic
1028684227 7:93574878-93574900 CCCCCTCCTGTCCCAGGAGAGGG + Intergenic
1029487865 7:100854230-100854252 CCCCCTCCTCCCCCAGGAGCCGG - Exonic
1029560557 7:101300097-101300119 CTCCCTCCTTGGCCCTCAGCTGG - Intergenic
1029743958 7:102506584-102506606 CTACCTCCTGGTCCCAGAGCTGG - Intronic
1029761947 7:102605747-102605769 CTACCTCCTGGTCCCAGAGCTGG - Intronic
1029926937 7:104328532-104328554 CTCCCTCCTGGCCCGGGCTCCGG - Intergenic
1032083304 7:128870570-128870592 CTCTCTCCTGGCCCAGGTGCGGG + Intronic
1034429551 7:151034311-151034333 CTACCAGCTGGCCCAGGAGCAGG - Exonic
1035334756 7:158120811-158120833 CTCCCTTCTGGCCCAACATCTGG - Intronic
1036773063 8:11592184-11592206 CCCCCACCCGGCCCAGGAGCTGG - Intergenic
1037779720 8:21859511-21859533 CTCCCTGCTGGCCCGTGGGTAGG - Intergenic
1037912671 8:22753267-22753289 CTCCCTCCTGACTCCTGAGCAGG - Intronic
1040416136 8:47197663-47197685 ATCACTCCTGGACCCTGAGCTGG + Intergenic
1044217377 8:89628224-89628246 CTCCATCATTGCCCATTAGCAGG + Intergenic
1045059555 8:98400091-98400113 CTCCCTCCAGACCCATGCTCAGG + Intergenic
1047442222 8:124888361-124888383 CTCCCTCCTGGCACTAGATCAGG - Intergenic
1049176677 8:141197090-141197112 CTCCATCCTGGCCTGTGTGCTGG + Intergenic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1049533129 8:143166385-143166407 CTGCCTCCTGGGCCGGGAGCTGG + Intergenic
1049569746 8:143363749-143363771 CTCCAGCCTGGCCCCTGAGCTGG + Intergenic
1052300391 9:26946988-26947010 CTCGCTCCGGGGCCACGAGCTGG - Exonic
1053273424 9:36765914-36765936 CTCACTCCTCGCCGAAGAGCAGG - Intergenic
1060079441 9:120628696-120628718 CTCCCTCCTGGGCAAAGATCAGG - Intronic
1060200399 9:121649030-121649052 CTTCTTCCTGGCCCAGGAACAGG - Intronic
1060209309 9:121700161-121700183 CTCCCGGCTGGCCCAGGAGAAGG - Intronic
1061101265 9:128494329-128494351 CTCCCCGCTGGCCATTGAGCAGG - Intronic
1061572784 9:131487990-131488012 CACCCTACCAGCCCATGAGCGGG + Exonic
1062035456 9:134380690-134380712 TCCCCACCTGGCCCAGGAGCTGG - Intronic
1062038906 9:134395327-134395349 TTCCCTCCTGGCCCACTGGCCGG + Intronic
1062335069 9:136061386-136061408 CTCCCTCCAGGCCCAGATGCTGG + Intronic
1188483074 X:30653721-30653743 CTCCCTCCTTGCCCAGCGGCCGG - Intronic
1189057692 X:37715872-37715894 CTCCCCCCTGGCCCATTTGGAGG - Intronic
1189311601 X:40022710-40022732 TTCCTTCCTGTCCCAAGAGCAGG + Intergenic
1190116754 X:47630314-47630336 CTCCCTCCACCCCCACGAGCAGG - Intergenic
1190263641 X:48815006-48815028 CTCCTGCCAGACCCATGAGCAGG - Exonic
1190304768 X:49075747-49075769 CTCCCTCCTACCCCAGGACCTGG - Exonic
1192607980 X:72539666-72539688 CTGGATCCAGGCCCATGAGCTGG - Intronic
1194245084 X:91500595-91500617 CTCCCTCAAGGCCCAGGAGCAGG + Intergenic
1195329010 X:103781206-103781228 CTCCCTCCTTTCCCATGCCCTGG - Intronic
1198023754 X:132684583-132684605 CTTCCTATTGTCCCATGAGCAGG - Intronic
1200564059 Y:4741905-4741927 CACCCTCAAGGCCCAGGAGCAGG + Intergenic
1201014847 Y:9590417-9590439 CTGACTCCTGACCCCTGAGCAGG + Intergenic
1201160309 Y:11160327-11160349 CTCACTCCAGGCACAGGAGCCGG + Intergenic