ID: 1179455198

View in Genome Browser
Species Human (GRCh38)
Location 21:41494470-41494492
Sequence CACTGTCTACGAGGTGCATC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 43}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179455198_1179455203 -10 Left 1179455198 21:41494470-41494492 CCGGATGCACCTCGTAGACAGTG 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1179455203 21:41494483-41494505 GTAGACAGTGGGGACCACAGTGG 0: 1
1: 0
2: 2
3: 35
4: 254
1179455198_1179455208 5 Left 1179455198 21:41494470-41494492 CCGGATGCACCTCGTAGACAGTG 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1179455208 21:41494498-41494520 CACAGTGGGCTGTGCGGGATAGG 0: 1
1: 0
2: 0
3: 15
4: 170
1179455198_1179455205 -1 Left 1179455198 21:41494470-41494492 CCGGATGCACCTCGTAGACAGTG 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1179455205 21:41494492-41494514 GGGGACCACAGTGGGCTGTGCGG 0: 1
1: 0
2: 5
3: 42
4: 357
1179455198_1179455210 7 Left 1179455198 21:41494470-41494492 CCGGATGCACCTCGTAGACAGTG 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1179455210 21:41494500-41494522 CAGTGGGCTGTGCGGGATAGGGG 0: 1
1: 0
2: 2
3: 20
4: 203
1179455198_1179455212 19 Left 1179455198 21:41494470-41494492 CCGGATGCACCTCGTAGACAGTG 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1179455212 21:41494512-41494534 CGGGATAGGGGTTTTCCGGTTGG 0: 1
1: 0
2: 0
3: 0
4: 37
1179455198_1179455206 0 Left 1179455198 21:41494470-41494492 CCGGATGCACCTCGTAGACAGTG 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1179455206 21:41494493-41494515 GGGACCACAGTGGGCTGTGCGGG 0: 1
1: 0
2: 2
3: 30
4: 318
1179455198_1179455213 28 Left 1179455198 21:41494470-41494492 CCGGATGCACCTCGTAGACAGTG 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1179455213 21:41494521-41494543 GGTTTTCCGGTTGGTATCCATGG 0: 1
1: 0
2: 0
3: 8
4: 69
1179455198_1179455209 6 Left 1179455198 21:41494470-41494492 CCGGATGCACCTCGTAGACAGTG 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1179455209 21:41494499-41494521 ACAGTGGGCTGTGCGGGATAGGG 0: 1
1: 0
2: 0
3: 10
4: 130
1179455198_1179455211 15 Left 1179455198 21:41494470-41494492 CCGGATGCACCTCGTAGACAGTG 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1179455211 21:41494508-41494530 TGTGCGGGATAGGGGTTTTCCGG 0: 1
1: 0
2: 0
3: 3
4: 58
1179455198_1179455204 -9 Left 1179455198 21:41494470-41494492 CCGGATGCACCTCGTAGACAGTG 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1179455204 21:41494484-41494506 TAGACAGTGGGGACCACAGTGGG 0: 1
1: 0
2: 3
3: 36
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179455198 Original CRISPR CACTGTCTACGAGGTGCATC CGG (reversed) Exonic
910508836 1:87980811-87980833 CACTGTCTTCAAAGTGCCTCAGG - Intergenic
910724157 1:90321109-90321131 CACTGTCTCCCAGGTGTTTCTGG - Intergenic
914374865 1:147064066-147064088 CACTGTGAACGAGGTGGAGCAGG + Intergenic
921025748 1:211279905-211279927 CACGGTCTAAGAGATGCAGCAGG + Intronic
922727998 1:227933980-227934002 CAATGTCCTCGAGGTTCATCTGG + Intronic
1070670586 10:78374685-78374707 CACTGTCAGTGAGGTGCTTCTGG + Intergenic
1070671723 10:78381933-78381955 GACTGTCTACCAGCTGCATCTGG + Intergenic
1090454842 11:126839927-126839949 CACTCTGTACGAAGTGCAGCAGG - Intronic
1109254052 13:60056669-60056691 CACTGTCTTCCAGGATCATCTGG - Intronic
1113890351 13:113732164-113732186 CACCGTCTCAGAGTTGCATCAGG + Intronic
1116982950 14:51190554-51190576 GACTATCTATGAGGTCCATCTGG - Intergenic
1138421536 16:56902436-56902458 CACTGTCAACGAGATGCGGCGGG + Exonic
1139721588 16:68860354-68860376 TACAGTCTTCGAGTTGCATCGGG - Exonic
1141147855 16:81544166-81544188 CACTGTGCACTAGGTGCATGTGG - Intronic
1145869944 17:28265796-28265818 CACTGTGTTGGAGGTGCAGCAGG - Intergenic
1147596383 17:41720705-41720727 CACTGTCTGAGAGATGCTTCTGG - Intronic
1151141335 17:71995277-71995299 CACTGTGTAAGACCTGCATCAGG - Intergenic
1151497417 17:74467091-74467113 CACTGACTGCGAGGGGCATGTGG + Intronic
1164618676 19:29681204-29681226 CACTCTCTACAAGGAGCCTCAGG + Intergenic
1165360356 19:35332833-35332855 CACTGTCATTGAGGTGCACCGGG - Exonic
1167507053 19:49876394-49876416 GACTGTCTACGATTTGCCTCAGG + Intronic
929409214 2:41677731-41677753 CATTGTCTAAGAGGTCCACCCGG - Intergenic
938168882 2:129057453-129057475 CACTTTCGATGAGGTGCCTCAGG - Intergenic
947666787 2:231911011-231911033 CACTGTCTAAGTGGTGCTGCTGG - Intergenic
1173008677 20:39160745-39160767 CACTCACTACCAGGTGAATCTGG - Intergenic
1179195656 21:39160167-39160189 CAGTGTCTACCTGCTGCATCAGG - Intergenic
1179455198 21:41494470-41494492 CACTGTCTACGAGGTGCATCCGG - Exonic
949691314 3:6643150-6643172 CACTGTTTACCAGCTACATCTGG - Intergenic
962902497 3:139773673-139773695 CACTGTGTACCAGGTGCTGCTGG - Intergenic
966197092 3:177324371-177324393 CACTGTGTAGAAGCTGCATCTGG + Intergenic
980789610 4:137603171-137603193 TACTGTTTACTAGGTGCAACTGG - Intergenic
982343404 4:154329742-154329764 CACTGTGTACCAGGCGCACCAGG + Intronic
999955052 5:156691267-156691289 CATTGTCTACTAGGTACATGTGG + Intronic
1002361004 5:178670788-178670810 CCCTGTCTCCGGGGAGCATCAGG - Intergenic
1023640598 7:42253267-42253289 CACTGTGAACAAGGTGCTTCTGG - Intergenic
1026466083 7:70655812-70655834 CACTGTCTAGGGGGTTCAGCTGG - Intronic
1033082243 7:138309287-138309309 CAAGGTCTAGGAGCTGCATCTGG + Intergenic
1034135322 7:148762680-148762702 CACTGTCGTGGATGTGCATCTGG - Intronic
1037856091 8:22371324-22371346 CACTGCCTACGAGGGCCATTAGG - Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1041553819 8:59130443-59130465 AACTGTCTACCAGGTATATCTGG + Intergenic
1055016258 9:71621400-71621422 CACTGGTTATGAGGTGCTTCTGG - Intergenic
1062059145 9:134485619-134485641 CACTGACTACCTGGTGCTTCAGG + Intergenic
1194338991 X:92686229-92686251 CCCTGTCTCTGAGCTGCATCTGG - Intergenic
1200647384 Y:5803012-5803034 CCCTGTCTCTGAGCTGCATCTGG - Intergenic