ID: 1179455715

View in Genome Browser
Species Human (GRCh38)
Location 21:41498473-41498495
Sequence CAGCCTGACCAGAAAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 282}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179455715 Original CRISPR CAGCCTGACCAGAAAGAAGA AGG Intronic
901487619 1:9575947-9575969 CAGCATGACCAGGAAGGGGAAGG - Intronic
902852172 1:19168044-19168066 CAACCTGACCAGTGAGAGGAGGG + Exonic
905540960 1:38760125-38760147 CAGCCTTAGCAGAAAGAGGCTGG - Intergenic
905874038 1:41421043-41421065 CAGCTTGGCCAGGAATAAGAAGG + Intergenic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
908938893 1:69409236-69409258 GAGCCTGGACAGAAAGGAGAAGG + Intergenic
909149385 1:71981760-71981782 CAGCCTTACCAGTAACTAGAAGG + Intronic
909801756 1:79818821-79818843 CTGGCTGACCAGGAAAAAGAGGG + Intergenic
911740426 1:101381030-101381052 CAGCCAGAGCAGCAAGAACAGGG - Intergenic
912760143 1:112359414-112359436 CAGCATGACTGGGAAGAAGATGG + Intergenic
913382853 1:118229599-118229621 GTGCCTGACCAGACAGATGAGGG - Intergenic
914826647 1:151142375-151142397 CAGCCAGACCAGCAAAAAGAAGG - Intronic
914998646 1:152566501-152566523 CTGCCTGAGTAGAAAGAGGATGG + Intronic
914999998 1:152580230-152580252 CAGCCTGAGTAGAAAGAGGATGG + Intronic
915471512 1:156128503-156128525 CAGCCTGAGCTGAAAGAAGCTGG - Intronic
918912058 1:190587054-190587076 CTGCATGACAAGAAAGAATAAGG + Intergenic
919135924 1:193507814-193507836 GAGCCTGAGCAGAGACAAGAGGG - Intergenic
919350136 1:196440996-196441018 CATCCTGCTCAGAAAGAAGCTGG + Intronic
919711656 1:200735273-200735295 CACCCTGAGTACAAAGAAGAAGG - Intergenic
920602240 1:207339404-207339426 CAAACTTACCAGATAGAAGACGG - Exonic
920850499 1:209625077-209625099 CAGCCTGAGAAGAATGAAAATGG - Intronic
920983485 1:210861710-210861732 CAGACTGGTCAGAAAGAAGCTGG + Intronic
921648255 1:217645770-217645792 TATCCTGACCAGTAACAAGATGG - Intronic
922292357 1:224218992-224219014 CAGTCTGAGCTGAAAGCAGATGG + Intergenic
922924797 1:229339661-229339683 CAGCCAGCCCAGACAGAAGTAGG + Intronic
924225964 1:241921861-241921883 CAGTATGACCTGTAAGAAGAGGG + Intergenic
1063094723 10:2899326-2899348 TAGCCAGAGCAGCAAGAAGAGGG + Intergenic
1063122513 10:3114800-3114822 CAGGCTGCCCACAAAGAAGCCGG - Intronic
1064242173 10:13640665-13640687 CAGACTGACTAAAAAGAAAAGGG - Intronic
1065473128 10:26103449-26103471 CAGCGTGAGCAACAAGAAGATGG - Intronic
1066974181 10:42349742-42349764 CAGCCTGCCCAGACATTAGATGG + Intergenic
1067147040 10:43701514-43701536 CAGGCTGCCCAGGAAGAACAAGG - Intergenic
1068331450 10:55576358-55576380 CAGGCTGAGGAGAAAGAGGAAGG + Intronic
1069628425 10:69882230-69882252 TAGCCAGACCAGAAGGCAGACGG - Intronic
1069887652 10:71634149-71634171 GGGCCTGGCCAGAAAGCAGAGGG + Intronic
1070318513 10:75336792-75336814 CACCCTAGCCAGCAAGAAGATGG - Intergenic
1070462657 10:76685238-76685260 CAGCCTGACTAGATAGAGCATGG - Intergenic
1070812296 10:79304601-79304623 CAGCCCGGCCTGGAAGAAGAAGG + Intronic
1073737108 10:106361434-106361456 CAGCATGAACACAAAGAAGCAGG + Intergenic
1073953996 10:108846322-108846344 CAGCCTTTCCAGAAAGGAGTTGG - Intergenic
1074460123 10:113629137-113629159 CTGCCTGACCATAAAGGAGCAGG - Intronic
1075546816 10:123361398-123361420 CATCCTGGTCAGAAAGTAGATGG + Intergenic
1076294513 10:129374210-129374232 CAGTGTGAACAGAAAGCAGAGGG - Intergenic
1076467091 10:130690405-130690427 AAGCCAGCCCAGAAATAAGAAGG - Intergenic
1076643494 10:131935167-131935189 GAGGCTCAACAGAAAGAAGAGGG - Intronic
1076695410 10:132244892-132244914 CAGCCTCACCAGCAACAAAACGG + Intronic
1077470588 11:2758218-2758240 CAGCCTGTCCAACTAGAAGATGG + Intronic
1077928160 11:6703302-6703324 CAGCATGGTCAGAAAGAAGAAGG + Intergenic
1078142531 11:8702541-8702563 CAGCCGGGCAAGAAAGCAGAAGG - Intronic
1078228309 11:9414333-9414355 CAGACTGGTCAGAAAGAAGCTGG - Exonic
1080749832 11:35141455-35141477 GGGCCTGGCCTGAAAGAAGAGGG + Intronic
1083336074 11:61922637-61922659 GAGGCTAACCAGAAAGAAGAGGG - Intergenic
1083341664 11:61962252-61962274 CAGCCTGAACAAAGAGGAGATGG + Exonic
1084712291 11:70851329-70851351 CTGGCTGTCCACAAAGAAGAAGG + Intronic
1086290514 11:85303900-85303922 CTCCTTGACCAGATAGAAGAAGG + Intronic
1086820863 11:91434262-91434284 CAGCATGAGCAGAAATAACATGG + Intergenic
1087504909 11:99007345-99007367 CAGCCTTAATAGAAGGAAGATGG - Intergenic
1088883021 11:113986537-113986559 CAGGCTGACCACATAGAAGAGGG - Exonic
1089269048 11:117288795-117288817 CAGCCTGACCAAAAGTGAGATGG - Exonic
1089813745 11:121153537-121153559 GAGCCTCAACAGACAGAAGAGGG - Intronic
1090018812 11:123108857-123108879 CAGCCTGACTAGCATGGAGAAGG + Intronic
1090640121 11:128722877-128722899 CAGCCTGAACAGCTAGAACAGGG - Intronic
1091346420 11:134857208-134857230 CAACCTGGCCAGAAAGCAGGAGG + Intergenic
1093823616 12:23653505-23653527 CAGCCCGAACAGACAGAATAAGG - Intronic
1094372748 12:29755813-29755835 CAAACTGAGCAGCAAGAAGAAGG + Exonic
1095520178 12:43054579-43054601 CAACCAGAAGAGAAAGAAGAGGG - Intergenic
1096949129 12:55446341-55446363 CAGCCTGACCAACATGGAGAAGG - Intergenic
1100476064 12:94936440-94936462 CATCCTGCCCAGGAAAAAGAAGG + Intronic
1101667328 12:106831182-106831204 CAGCCTGTGGAGAAAGAAGGTGG - Intronic
1103717374 12:122952910-122952932 CAGCCTGTCCACACAGTAGAAGG + Intronic
1103883509 12:124184361-124184383 CAGGGTCACCAGAAAGGAGAGGG - Intronic
1104512159 12:129390692-129390714 CAGAGTCACCAGCAAGAAGAAGG - Intronic
1104531304 12:129573331-129573353 GAGCCAGACCTGAGAGAAGAGGG + Intronic
1104615324 12:130263344-130263366 CAGCGTGACCAGGAAGAACAGGG + Intergenic
1106543681 13:30712941-30712963 CAGCATGGCCAGAGAGAAGTTGG - Intergenic
1106920635 13:34559572-34559594 GAGCCTGAATAGAAAGAACATGG + Intergenic
1107040821 13:35945410-35945432 CAGCCTGGCCAGCAGGGAGAAGG + Intronic
1107953841 13:45489720-45489742 CACCCCAACCAGGAAGAAGATGG - Intronic
1112362192 13:98728292-98728314 CATCCTGAGCAAAAAGAATAGGG - Intronic
1113634717 13:111911825-111911847 CAGGCTGACCTGCTAGAAGAAGG - Intergenic
1115161402 14:30399654-30399676 CAGCCTGACTAGAATAAAGCAGG - Intergenic
1117429844 14:55646011-55646033 CAGCCTGACCAAAAAGATTTAGG - Intronic
1117495445 14:56297624-56297646 AAACCTGACCAGACAGCAGAGGG + Exonic
1118856844 14:69629651-69629673 CAACTTGAACAGAAACAAGAGGG - Intronic
1119329515 14:73783695-73783717 CATGCAGACGAGAAAGAAGAAGG + Intronic
1119549544 14:75498321-75498343 AAAGCTTACCAGAAAGAAGAGGG + Intergenic
1120169426 14:81234143-81234165 CAGCCTGACCAACATGATGATGG - Intergenic
1120829468 14:88985345-88985367 CAACCTGACCAGATAGAAATTGG + Intergenic
1121050133 14:90815031-90815053 CAGACTACCCAGAAAGGAGAGGG - Intronic
1122697886 14:103566095-103566117 AACTCTAACCAGAAAGAAGATGG - Intronic
1124556634 15:30731874-30731896 CAGCCTTCACAGACAGAAGAAGG + Intronic
1124674644 15:31673863-31673885 CAGCCTTCACAGAGAGAAGAAGG - Intronic
1125004395 15:34800801-34800823 AAGCCTGACCTGCAAGCAGAAGG + Intergenic
1125054713 15:35344179-35344201 AAGCCAGACTAGAAAGAAAAAGG + Intronic
1125968301 15:43891757-43891779 CAGCCTCTCCAGAAAGGAAAAGG - Intronic
1126261366 15:46696639-46696661 TAGAGTGACCAGAGAGAAGAGGG - Intergenic
1127284522 15:57520837-57520859 CAGCTTAACCAGAAGGAAGTTGG - Intronic
1127554096 15:60070457-60070479 CAGCATGACCAGCAAGAACCTGG - Intergenic
1128164554 15:65452008-65452030 CACCCTGACCAGAATGAACAGGG - Exonic
1129230556 15:74194966-74194988 CAGCCTGACCAAAGGGAAGCTGG + Intronic
1132179918 15:99744510-99744532 CAGACTGTCCTGAAAGTAGATGG - Intergenic
1132250310 15:100331051-100331073 CAACCTGTCCAGAAAGGAGAAGG + Exonic
1132815203 16:1822533-1822555 CAGGCTGAGCAGGAAGGAGAAGG - Intronic
1132942849 16:2516842-2516864 AAGCCTGACCAGACTGCAGAAGG - Intronic
1133859168 16:9577799-9577821 GAAACTGACCAGAAAGGAGAAGG - Intergenic
1136125622 16:28178052-28178074 CAGCATGTCCAGAAACATGATGG - Intronic
1136186351 16:28590979-28591001 CAGGCTGATCAGACAGACGAGGG + Intronic
1137285184 16:47009906-47009928 CAGCCTGACCAAAAATTAGCTGG - Intergenic
1137485540 16:48887546-48887568 CATCCTGAAAAGAAAGAACAAGG - Intergenic
1137764880 16:50970352-50970374 AAGCCTGACCAGAAGCCAGAGGG + Intergenic
1138008940 16:53360364-53360386 CAGTCAGATCAGAAAGAAGGGGG + Intergenic
1138036439 16:53611695-53611717 AAGTCTCAACAGAAAGAAGACGG + Intronic
1138167184 16:54813968-54813990 CAGCCAGAGCAAAAAGAACAGGG - Intergenic
1138463244 16:57166429-57166451 CATCCTGTCCTGAAAGAACATGG - Intronic
1138988475 16:62361422-62361444 CAGCCTGGGCAGAAGAAAGAAGG + Intergenic
1141160472 16:81626069-81626091 AAACCTGCCCAGCAAGAAGAAGG - Intronic
1142889145 17:2931757-2931779 CAGGCTGACCTGCAAGAAGAGGG - Intronic
1143290303 17:5823148-5823170 CAGCCTGACCAGGCTGAAGCAGG - Intronic
1143852855 17:9825762-9825784 CAGGCTGAGGAGAAAGAACAAGG - Exonic
1144573765 17:16416385-16416407 GAGCAGGATCAGAAAGAAGAAGG - Intronic
1145305607 17:21673372-21673394 CAGAGCGACCTGAAAGAAGATGG - Intergenic
1146515724 17:33487715-33487737 CAGCGTGGCCAGAATAAAGAAGG + Intronic
1147796233 17:43045352-43045374 CAGCCTGAATAGAAAGAATAGGG + Intronic
1148715068 17:49710108-49710130 AAGGCTGTCCAGAATGAAGAGGG - Intergenic
1151245436 17:72790885-72790907 GACCCTGAGCAGAAGGAAGAAGG + Intronic
1151427622 17:74041331-74041353 CCGCCTGAGCAGAAAGAGAATGG + Intergenic
1152328248 17:79655192-79655214 CACCCGGACCAGCACGAAGAGGG + Intergenic
1153692584 18:7608323-7608345 CAGCTTGTCCAGAACAAAGACGG + Intronic
1153813143 18:8769671-8769693 CAGCCTGGCCAGCAAGTGGAAGG - Intronic
1154074732 18:11188944-11188966 CAGACTGACGTCAAAGAAGATGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155670932 18:28370271-28370293 AGGCCTGAGCAGAAGGAAGAAGG + Intergenic
1155752582 18:29445840-29445862 CAGTCTGAAAATAAAGAAGAGGG - Intergenic
1157903493 18:51543627-51543649 AAGACTGAACAGAAAGTAGAAGG + Intergenic
1158316595 18:56217873-56217895 AAGCTTGATTAGAAAGAAGAAGG - Intergenic
1160059383 18:75515505-75515527 CAGCCAGACCACAGAGAAGCTGG + Intergenic
1161867493 19:6844245-6844267 CAGCCTGGGCAACAAGAAGATGG - Intronic
1162353601 19:10166608-10166630 CAGGCTGACGAGGACGAAGATGG - Exonic
1165163731 19:33834962-33834984 CTCCCTAAACAGAAAGAAGATGG + Intergenic
1165800098 19:38544015-38544037 CAGCCAATCCAGAAAGAGGATGG - Intronic
1166066970 19:40365854-40365876 CAGCCTGTCCAGACAGAAGCTGG + Exonic
1167386217 19:49165795-49165817 AAGCCTGAGCAGGAAGAAGCAGG - Intronic
1167555409 19:50192022-50192044 GATGCTGATCAGAAAGAAGAAGG - Intronic
928794503 2:35000190-35000212 CAACCTGACAACAAAGATGAGGG + Intergenic
931893211 2:66698698-66698720 CAGTCTGACCAAAGAGAAGAAGG - Intergenic
933191898 2:79343586-79343608 CACCTTGGCCAGGAAGAAGAGGG - Intronic
935175580 2:100645987-100646009 CAGCTTGACCAGAAAAAAACAGG + Intergenic
935211595 2:100943637-100943659 CAGGCTGTGCAGTAAGAAGAGGG + Intronic
935368107 2:102315967-102315989 CAGCCTGAAGACAAAGAAAATGG - Intronic
936538677 2:113332533-113332555 CAGCCTGAGCAGAGTGATGATGG - Intergenic
936625180 2:114141098-114141120 GAGACTGCCCAGGAAGAAGAGGG - Intergenic
937638470 2:124184742-124184764 CAGCCTGAAGAGAAAGACAATGG + Intronic
938522914 2:132091195-132091217 CAGCCTGCCCAGACATTAGATGG - Intergenic
939824915 2:147002303-147002325 CAGCCTGGCCAGGATGAAGTTGG - Intergenic
942610629 2:177738693-177738715 CAGCCTCACCAGAGAGAGGGAGG + Intronic
942863951 2:180649700-180649722 CAGCCTGACCAACATGGAGACGG - Intergenic
943733258 2:191325754-191325776 CACTCTGAACAGAAATAAGATGG + Intronic
943794446 2:191974306-191974328 CAGACTCAACTGAAAGAAGAAGG - Intronic
946010366 2:216559549-216559571 AAGCCTGCCTTGAAAGAAGAGGG - Intronic
947025132 2:225729464-225729486 CTGCCTGACAAGAAGCAAGAGGG + Intergenic
947167709 2:227279309-227279331 CAGCCTGACCAACATGGAGATGG - Intronic
947308871 2:228778349-228778371 CAGGCTGTCCAGCAAGGAGATGG - Intergenic
947331850 2:229036894-229036916 CTGCCTGACCACGAAGTAGAGGG + Intronic
948231210 2:236350891-236350913 AGGTCTGGCCAGAAAGAAGATGG + Intronic
948635360 2:239331119-239331141 CAGCCTGCCCAGGAGGAAGCGGG + Intronic
1169688296 20:8301621-8301643 CAGCATGACCAGAAGGACAATGG - Intronic
1170701262 20:18705678-18705700 CAGCCTGACCACCAAGACGGTGG - Intronic
1172109167 20:32535575-32535597 CAGCGTGATTTGAAAGAAGATGG - Intronic
1172882941 20:38213429-38213451 CAGCGCGCCCAGAACGAAGAGGG - Exonic
1173323607 20:42011958-42011980 CAAGCTGACCAGGAAGGAGAGGG - Intergenic
1173540615 20:43848253-43848275 CAGCCTGGCCAATAAGCAGAAGG + Intergenic
1173852661 20:46228617-46228639 AAACCTTTCCAGAAAGAAGAGGG + Intronic
1175576984 20:60067578-60067600 CAACCTAACCTGAAAGGAGATGG - Intronic
1177791118 21:25722793-25722815 CAGCCTAGCCAAAAAGAGGAAGG + Intronic
1178639564 21:34335166-34335188 GAGACAGACCAGAAGGAAGATGG + Intergenic
1178933762 21:36842865-36842887 CAGCCTAACCAGCAGGATGAGGG + Intronic
1179107978 21:38420767-38420789 CAGCCTCACCAGTTAGAAGATGG + Intronic
1179405127 21:41119433-41119455 CAGCTTCATTAGAAAGAAGAAGG - Intergenic
1179455715 21:41498473-41498495 CAGCCTGACCAGAAAGAAGAAGG + Intronic
1179877782 21:44279947-44279969 CAGCATGACCAGACTGGAGAGGG + Intergenic
1181458635 22:23073376-23073398 CGGCCTGGGCAGAATGAAGAGGG + Intronic
1182160173 22:28113552-28113574 CAGCTTGTCCTGAAAGCAGATGG - Intronic
1183023058 22:35042948-35042970 CAGACTGAAGAGAAAGAAGAAGG + Intergenic
1184100793 22:42340913-42340935 CTCCCTGACCAGAAAGGAGCCGG - Intronic
1184383431 22:44160706-44160728 CAGCCTGAGAAGAAAGCAGAAGG + Intronic
1185207791 22:49550090-49550112 CAGCCTACCCAGAAAGCACAAGG + Intronic
949936033 3:9116702-9116724 AAGCCAGCCCAGAAAGATGAGGG + Intronic
950064834 3:10103683-10103705 CAGCCTGGCAAGAAAGAACTTGG - Intronic
950887725 3:16375635-16375657 CAGCCTGAGCAGAGAGATAAAGG + Intronic
951587323 3:24228731-24228753 CATCCTCACCAGAAAGGTGATGG - Intronic
952168354 3:30776722-30776744 CAGTCTAACTAGAAGGAAGAGGG - Intronic
953751631 3:45612968-45612990 CTGCATGACCTGAAACAAGAAGG - Intronic
953854089 3:46487487-46487509 TAGCCTACCCAGAAAGAGGATGG + Intergenic
953938256 3:47066070-47066092 CAGACTGACGAGGAAGAAGAGGG - Intronic
954360782 3:50121742-50121764 CAGCCTGGCTGGAAAGATGATGG - Intergenic
954452745 3:50580452-50580474 CAGCCTGACCAGAGGGGAGGTGG + Exonic
954713331 3:52515530-52515552 AAGCCTGTCCAGAGAGAAGGAGG + Intronic
955663986 3:61330982-61331004 TATACCGACCAGAAAGAAGAAGG + Intergenic
958686974 3:97411127-97411149 CAGCATTACCTGAAAGAAAATGG + Intronic
958988598 3:100813727-100813749 CAGTCAGAGCTGAAAGAAGAGGG + Intronic
959337120 3:105080088-105080110 CAGCCTGACCACATGGTAGAAGG - Intergenic
959352520 3:105283855-105283877 AAACCTGACCAAAAAGAAAAAGG + Intergenic
961478043 3:127160829-127160851 CAGCCCGACCAGGAAGAATCTGG + Intergenic
967105069 3:186249095-186249117 CAGCCGGTCCAAAAAGGAGAGGG + Intronic
968066677 3:195762857-195762879 CAGCCTGACCATGAAGACGGCGG - Exonic
969528828 4:7718308-7718330 CAGCCTGTCCAGACTGAAGGAGG + Intronic
969707305 4:8818977-8818999 CAGCCTCCCCAGTAAGAAGGTGG + Intergenic
969707332 4:8819074-8819096 CAGCCTCCCCAGTAAGAAGGCGG + Intergenic
971823287 4:31587351-31587373 GAGGCTGACCAGAAGGAAAACGG + Intergenic
973872686 4:55182072-55182094 ACCCCTGACCAGAAAGGAGATGG - Intergenic
975176999 4:71300302-71300324 CAGCATGGCCAGGAAGAAGGTGG + Intronic
976653062 4:87456566-87456588 CAGCCATACCAGTATGAAGAGGG - Intronic
977605915 4:98984837-98984859 CAGCCTGACCAAGATGAAAAGGG + Intergenic
978065134 4:104388732-104388754 TAGCCTGACCAGAAAGGAGGAGG - Intergenic
981051252 4:140311597-140311619 CAGGCTTACCAGGAGGAAGAGGG - Intronic
982233402 4:153230027-153230049 CAGGCTAACCTGAGAGAAGAAGG + Intronic
983344841 4:166515065-166515087 CAGGCTGAGGAGGAAGAAGAGGG + Intergenic
983760923 4:171405486-171405508 CAGCCTGGCCAGTTAGAAGTAGG + Intergenic
984213256 4:176876836-176876858 CATCATGACCAGATAGATGATGG + Intergenic
984848030 4:184124269-184124291 CAGCCTGAGAAGGAAAAAGATGG + Exonic
987690931 5:21265878-21265900 CAGCCTTATGAGAAGGAAGAAGG + Intergenic
989412795 5:41139908-41139930 CAGTCTGACTAGGGAGAAGATGG - Intergenic
990150371 5:52810586-52810608 CAGCCTGAACTGGAAGAAAATGG + Intronic
990174833 5:53095993-53096015 CAGCCTGACTTTAAAGAAAATGG + Intronic
998003449 5:138641994-138642016 CAGCCAAACCAGACAGAAGGGGG + Intronic
999295696 5:150458330-150458352 CAGCCAGGACAGGAAGAAGAGGG + Intergenic
999794388 5:154975200-154975222 CAGCCTGGCCAAAAATTAGATGG - Intergenic
1000923452 5:167165490-167165512 TGGGGTGACCAGAAAGAAGAGGG + Intergenic
1002086096 5:176776533-176776555 CAGGCTGACCGGAAAGAAGATGG - Intergenic
1002992410 6:2250059-2250081 CAGTTGGACCAGAAAGCAGAAGG - Intergenic
1004701270 6:18081837-18081859 CAGCCTGAGCAAAAAACAGATGG - Intergenic
1004714611 6:18205136-18205158 CAGCAGGACCAGAAAGAGAATGG + Intronic
1006174700 6:32114930-32114952 CATCCTGGACAGCAAGAAGAGGG + Intronic
1006202954 6:32313102-32313124 CAGCCAGGCTAGAAAGAAGGAGG - Intronic
1006203611 6:32319582-32319604 CAGCCAGGCTAGAAAGAAGGAGG - Intronic
1006331972 6:33398128-33398150 AGGCCTGACCAGATGGAAGATGG + Exonic
1006800949 6:36759391-36759413 CCGCCTGACCACCAAGAAGAAGG - Intronic
1007662751 6:43496579-43496601 CAGGCTGTCCAGACAGAGGAGGG + Intronic
1008893289 6:56521375-56521397 CAGGCTGAACACAAACAAGAGGG - Intronic
1010767524 6:79793166-79793188 AAGCCTGAGCAGCAAGAAGGGGG - Intergenic
1011552953 6:88546642-88546664 CTGCCTGACCACACAGAAGGGGG - Intergenic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1012180059 6:96141584-96141606 AAGGCTGAACAGAAAGGAGAAGG + Intronic
1014149151 6:118033722-118033744 CAGCCACAGCAGCAAGAAGAGGG + Intronic
1014934766 6:127374488-127374510 CAGCCACACCACACAGAAGATGG - Intergenic
1016272861 6:142309525-142309547 CATCCTGCAAAGAAAGAAGATGG - Exonic
1017658104 6:156649136-156649158 CAGCCTGAGCAGACAGAAGCTGG + Intergenic
1018867864 6:167759564-167759586 CAGCCTGACCAGGCGGGAGATGG + Intergenic
1019786749 7:2982000-2982022 CAGCCAGACCCTAAAGAAGATGG - Intronic
1020223144 7:6256912-6256934 CAGTCTGACCACAAAAAGGAAGG + Intronic
1026458703 7:70595121-70595143 CATCCTGACCACAAAGCAGCTGG - Intronic
1026815132 7:73505047-73505069 CAGGCTGGCAAGAGAGAAGAGGG - Intronic
1028206298 7:88021103-88021125 CAGTCTTACCAGAAACCAGAAGG + Intronic
1028295448 7:89124103-89124125 CAGCTTGACCAGAAGCCAGAGGG - Intronic
1028913191 7:96230361-96230383 GAGCCAGATCAGAAAGAGGATGG - Intronic
1029518605 7:101045024-101045046 CACCCTAACAAGAGAGAAGAAGG - Intronic
1030844591 7:114393467-114393489 GAGTCTGACCAGAGAGAGGAGGG + Intronic
1031193388 7:118584134-118584156 CATCCTGACCACCAAGAAAATGG - Intergenic
1031813587 7:126404171-126404193 CAGCCAGAGAAGAAGGAAGAAGG - Intergenic
1032017334 7:128388526-128388548 CAGCCTGCCCTGAAAGGTGAAGG + Intergenic
1034295598 7:149969360-149969382 CAGCATGACCAGAAAGCTGGAGG + Intergenic
1034810464 7:154127545-154127567 CAGCATGACCAGAAAGCCGGAGG - Intronic
1035061100 7:156070297-156070319 CAGCATGGCCAGAACGAAGCAGG - Intergenic
1035827643 8:2661491-2661513 CAGCCTGGCCAACAACAAGAGGG - Intergenic
1037674598 8:21042838-21042860 CTCCCTGATGAGAAAGAAGAGGG + Intergenic
1038090596 8:24248663-24248685 CAGACAGACCAGGAAGAAGATGG + Intergenic
1038152983 8:24958898-24958920 GAGGCTGCCCAGAAAGGAGAGGG + Intergenic
1038275507 8:26117671-26117693 CAGGCTGGCCCCAAAGAAGAAGG - Intergenic
1039358313 8:36845947-36845969 CTGCCTGACGAAAGAGAAGAGGG + Intronic
1042736585 8:71996228-71996250 CAGCTTGACTAGAAGGAAGATGG - Intronic
1044235626 8:89826871-89826893 GAGACTGACCAGAAACAAGCAGG + Intergenic
1044286072 8:90413360-90413382 CAGCCTGTGCAGAAGGCAGATGG - Intergenic
1044854487 8:96461002-96461024 CAGGCTCACCAGAAAGCAGGTGG + Intergenic
1045329476 8:101142843-101142865 AGGCCTCACCAGAAAGAAGCAGG - Intergenic
1046645766 8:116783795-116783817 CAGCATGAGCAGGCAGAAGAGGG - Intronic
1047022857 8:120794906-120794928 TAGACTGACCAGAAAGTAGATGG - Intronic
1047636371 8:126767600-126767622 CAGCCTGAGCAGGAGGAAGTTGG - Intergenic
1049659479 8:143813350-143813372 CAGCTTGACCAGAAATGACAGGG + Exonic
1050920061 9:11188936-11188958 CCACCTGTCCAGAAAGATGATGG + Intergenic
1051436143 9:17034516-17034538 CAGCTTAACCAGAATAAAGATGG - Intergenic
1051622204 9:19062778-19062800 CAGCCTCACCAGTAAGTAGCTGG + Intronic
1051942024 9:22518668-22518690 AAGACTGACCAGAAAGTACAAGG - Intergenic
1052930635 9:34052569-34052591 CAGCCTGACCAACATGGAGAAGG + Intergenic
1052986222 9:34490149-34490171 CAGCTTGAGCTGGAAGAAGAGGG - Intronic
1056310520 9:85336157-85336179 CAGGCTTATCAGAATGAAGAAGG + Intergenic
1056848857 9:90063885-90063907 CAGCCTGCAGAGAAAGAAGAGGG + Intergenic
1057399420 9:94709967-94709989 CAGCCACACCAAAAACAAGATGG - Intergenic
1057999300 9:99848864-99848886 CAGTCTGACCAGAAAGAATGAGG - Intronic
1058217486 9:102253394-102253416 CAGCCCTAACAGAAAGAACATGG + Intergenic
1060022038 9:120140120-120140142 CAGCCTACCCAGAAAGGGGAAGG - Intergenic
1060246521 9:121951006-121951028 GAGTGTGCCCAGAAAGAAGATGG - Intronic
1061013664 9:127969789-127969811 CTGCCTTACCAGAAAGACCAAGG + Intronic
1061996506 9:134188847-134188869 CAGCCTTTCCAGACAGGAGAGGG + Intergenic
1062191735 9:135251396-135251418 CAGCCTGCACAGCAAGAAGTGGG + Intergenic
1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG + Intergenic
1186990323 X:15060142-15060164 CAGGCTGAGCAGATAGATGAGGG + Intergenic
1187866581 X:23728311-23728333 CAGCTTGAGCACAATGAAGAGGG + Intronic
1189643290 X:43098091-43098113 CAGACTGCCCAGAAAGTATAGGG - Intergenic
1189997031 X:46648794-46648816 CAACCTGACCACAAGGTAGAAGG + Exonic
1190584266 X:51922436-51922458 CAGACTGGTCAGAAAGAAGCTGG + Intergenic
1194064692 X:89247269-89247291 CAGCATGACTAGAAAAAAGCGGG + Intergenic
1196651547 X:118173228-118173250 CAGCCTGAGCACATTGAAGATGG - Intergenic
1197782765 X:130173398-130173420 CAGTTTGACCAGCAAGAAGGAGG - Intronic
1198259712 X:134954835-134954857 CCGGCGGACCAGCAAGAAGATGG + Intergenic
1198434729 X:136605675-136605697 AATCCTGAACAGAAAGAAGGTGG - Intergenic
1199024770 X:142923422-142923444 CAGCATGACAAGAAGGATGAAGG - Intergenic
1199876056 X:151929360-151929382 CAGCTTGCCCAGAAAGATGCAGG - Intergenic
1200239711 X:154487059-154487081 CAGCCAGACCAGAAAGGAGGAGG - Intergenic
1200835450 Y:7727347-7727369 CAGCCTGAGCAGAGAGATAAAGG + Intergenic
1200934333 Y:8725013-8725035 AAGGCTCACCTGAAAGAAGAAGG + Intergenic
1201487779 Y:14510373-14510395 GAGCCTGACCAAACAGATGAGGG - Intergenic