ID: 1179455838

View in Genome Browser
Species Human (GRCh38)
Location 21:41499416-41499438
Sequence GCAAGGTTTTTTGCTAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 5, 2: 27, 3: 79, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179455838_1179455840 10 Left 1179455838 21:41499416-41499438 CCAGTTTTAGCAAAAAACCTTGC 0: 1
1: 5
2: 27
3: 79
4: 222
Right 1179455840 21:41499449-41499471 TAGCCAGAACCTCCCACCCTCGG 0: 1
1: 0
2: 5
3: 18
4: 203
1179455838_1179455846 26 Left 1179455838 21:41499416-41499438 CCAGTTTTAGCAAAAAACCTTGC 0: 1
1: 5
2: 27
3: 79
4: 222
Right 1179455846 21:41499465-41499487 CCCTCGGTATCTGATCACTCTGG 0: 1
1: 0
2: 7
3: 33
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179455838 Original CRISPR GCAAGGTTTTTTGCTAAAAC TGG (reversed) Intronic
900842951 1:5070493-5070515 GCAGAGTTCTTTGCCAAAACTGG - Intergenic
900846638 1:5108564-5108586 GCAAGGCTCTTTTCTAAAACTGG + Intergenic
900913688 1:5619821-5619843 GCATGGTTCTTTGCTAAAACTGG + Intergenic
903517382 1:23920755-23920777 GCAGGATTTTTTGCTAGGACTGG - Intergenic
907090444 1:51719653-51719675 GCAAGAGTTTTTTCTAAAATGGG - Intronic
907856731 1:58311034-58311056 GCAGGATTCTTTGCTAAAACTGG - Intronic
908588123 1:65596979-65597001 GCAGAGTTCTTTGCTAAAACTGG - Intronic
908806995 1:67942172-67942194 GCAAGGTATTTAGCTAAGCCTGG + Intergenic
909034193 1:70578829-70578851 AGAAGGATTCTTGCTAAAACTGG - Intergenic
909092977 1:71250201-71250223 TCAGGTTTTTTTGTTAAAACAGG - Intergenic
909611031 1:77552033-77552055 GCAGAGTTCTTTGCTAAAACTGG - Intronic
910310829 1:85822735-85822757 GCAGGGTTCGTTGCTAAAACTGG - Intronic
911382688 1:97135693-97135715 TCAAGGTTTTATGGTAGAACAGG + Intronic
911391732 1:97253625-97253647 GAAAGTTTTTGTGCCAAAACCGG - Intronic
916217510 1:162410059-162410081 GTAGGGTTCTTTGCTAAAACTGG - Intronic
916430125 1:164720002-164720024 GCAAGCATTTGTGGTAAAACTGG - Intronic
916620514 1:166491268-166491290 TCAAGGAGTTTAGCTAAAACAGG + Intergenic
916721623 1:167488625-167488647 GCAGAGTTCTTTGCTAAACCTGG + Intronic
920055887 1:203191395-203191417 GCAGGGCTCTTTGCTAAAACTGG - Intergenic
920189189 1:204181566-204181588 GCAGGGCTCTTTGCTAAAACTGG + Intergenic
921524350 1:216199061-216199083 GTAAAGTTATTTGGTAAAACTGG - Intronic
921672116 1:217937107-217937129 GCAAGATTTTATGTGAAAACAGG + Intergenic
923423302 1:233842850-233842872 GCAAGGTATTTTTTTAAAGCAGG + Intergenic
923649797 1:235863906-235863928 GCAGGGTTCTTTGCTAATACTGG - Intronic
923772308 1:236948358-236948380 GAAAGGCTTTATGCTAAATCTGG - Intergenic
924170826 1:241338864-241338886 GCAAGGCAATTTGCTAAAAGTGG - Intronic
1063183058 10:3623464-3623486 GCAAGGTTTCTAGATAAATCAGG + Intergenic
1066443591 10:35461527-35461549 GCAGGGTGCTTTGCTAAAAGTGG + Intronic
1067545449 10:47189520-47189542 GTAGGATTCTTTGCTAAAACTGG + Intergenic
1067744251 10:48923424-48923446 GCAATTTTATTTGCTAAATCTGG - Intronic
1068238874 10:54277464-54277486 GCAATTTTATTTGCTAAATCTGG - Intronic
1068863516 10:61870434-61870456 GCAAGGTTTTTTATTAAAAGAGG + Intergenic
1071586740 10:86830286-86830308 GCAGGGTTCTTTGCTAAAACAGG + Intronic
1071821041 10:89281220-89281242 GCAGGATTCTTTGCTAAAACTGG - Intronic
1073531535 10:104237030-104237052 GCAGTGTTCTTTGCTAAAACCGG - Intronic
1074839888 10:117340309-117340331 GCAGAGTTCTTTGCTGAAACTGG - Intronic
1074848053 10:117416221-117416243 GTGAGGTTCTTTGCTAAAACTGG + Intergenic
1075624764 10:123954266-123954288 CAAATGTTCTTTGCTAAAACTGG + Intergenic
1082939561 11:58689738-58689760 GCAAGGTTGTTTGATAAAACTGG + Intronic
1082975536 11:59067500-59067522 ACAAGGTTTTGTGCTGAAATGGG - Intergenic
1083712332 11:64556864-64556886 GCAGGGTTCTTTGCTAAAACTGG + Intronic
1086640731 11:89152286-89152308 GAAAGGTATTTTGATAAAATGGG + Intergenic
1087433644 11:98085150-98085172 ACAAGTTTATTTACTAAAACAGG - Intergenic
1087433652 11:98085279-98085301 ACAAGTTTATTTACTAAAACAGG - Intergenic
1088552339 11:111025753-111025775 GGCAGGATTTTTGCTGAAACTGG - Intergenic
1090565319 11:127985296-127985318 ATAAGGTTTTTTGTTACAACTGG + Intergenic
1092063811 12:5572849-5572871 GTCAGATTTTTTTCTAAAACGGG + Intronic
1093019235 12:14187733-14187755 GTAGTGTTCTTTGCTAAAACTGG + Intergenic
1094177181 12:27553008-27553030 GCAGGGTTCTTTGCTAAACTTGG + Intronic
1094375919 12:29787110-29787132 GTAGTGTTCTTTGCTAAAACTGG - Intergenic
1095443262 12:42259391-42259413 GCAGGGTTCTTTGCTAAAATGGG + Intronic
1097443073 12:59634677-59634699 GCAGGGCTCTTTGCTAAAACTGG + Intronic
1098878393 12:75891220-75891242 GCAGGATTCTTTGTTAAAACTGG - Intergenic
1099495944 12:83346570-83346592 GCAATGTTTTGTGCTAATAAAGG - Intergenic
1099941429 12:89193938-89193960 TTAAGGAGTTTTGCTAAAACAGG - Intergenic
1100989256 12:100234533-100234555 GCAGGGTTCTTTGCTAAAATGGG + Intronic
1101153837 12:101908747-101908769 CCAGGGTTCTTTGCTAAAACTGG + Intronic
1102966769 12:117133691-117133713 GTAAGGTTCTATGATAAAACTGG + Intergenic
1103231333 12:119333299-119333321 TCAAGGTTGTTGGATAAAACAGG + Intergenic
1103670919 12:122614426-122614448 GGAAGGTTTTTTGGTCCAACAGG + Intronic
1105370305 13:19796243-19796265 GCAAGGTTCTTTGCTAAAACTGG + Intergenic
1106401064 13:29431600-29431622 GCAAGGTTTCTTGGCAAAAGTGG + Intronic
1108481238 13:50874114-50874136 GCAGGGCTCTTTTCTAAAACTGG + Intergenic
1109089039 13:58015820-58015842 GCAGGGTTCTTTGCTACAACTGG - Intergenic
1109869783 13:68319656-68319678 GCAAGTTTTTTTCCTTAAAAGGG + Intergenic
1109935815 13:69282883-69282905 TCAGGGTTCTTTGCTAAAAGTGG + Intergenic
1111339916 13:86870939-86870961 GCAGGGTTCTTTGCTAAAGCTGG - Intergenic
1111625292 13:90776941-90776963 GCAAGGATTTTTTTTAACACAGG - Intergenic
1112264843 13:97913874-97913896 GCAGGATTCTTTGCTAAAACTGG - Intergenic
1113676475 13:112210427-112210449 GCAGGGATTTTTGGCAAAACTGG + Intergenic
1113858328 13:113462458-113462480 AAAAGGTTTTTTTCTAAATCTGG + Intronic
1114676783 14:24446504-24446526 GCAAGGCTCTTTGCGAAAACTGG - Intergenic
1115427890 14:33281949-33281971 TCAAGTTTTTTTGCTAATGCTGG + Intronic
1116189797 14:41649569-41649591 GCAGGGTTCTTTGCTAAAACTGG - Intronic
1116452715 14:45083253-45083275 GCAAAGTTCTTTGCTTAAACTGG - Intergenic
1116502577 14:45638244-45638266 CACAGGATTTTTGCTAAAACTGG + Intergenic
1116751389 14:48889856-48889878 GGCAGGATTTTTGCTAAGACTGG - Intergenic
1117145972 14:52837174-52837196 TCCAGGATTCTTGCTAAAACTGG + Intergenic
1117862223 14:60104462-60104484 GAAAGGTATTTTGCTAAATATGG + Intronic
1118368133 14:65113092-65113114 TTAGGGTTCTTTGCTAAAACCGG + Intergenic
1120517641 14:85489583-85489605 ACAGGGTTCTTTGCTAAAACTGG - Intergenic
1121008976 14:90508877-90508899 ACAGGTTCTTTTGCTAAAACTGG - Intergenic
1121681394 14:95795471-95795493 GCAAGATTTTTCTTTAAAACCGG + Intergenic
1121909517 14:97776345-97776367 GCAGGGTTCTTTGATAAAACTGG - Intergenic
1123126681 14:105952011-105952033 GCAAGGTCTCTGGCTGAAACAGG + Intergenic
1125983282 15:44023511-44023533 AAAAGGTTTTGTACTAAAACAGG - Intronic
1128480327 15:68032037-68032059 GCAGGGTTCTTTGCTGAAACTGG - Intergenic
1128820698 15:70650155-70650177 GTAGGGTTCTTTGCTAAAACTGG + Intergenic
1130752246 15:86724603-86724625 GCAACATTTTATGCTAAAAATGG - Intronic
1132137118 15:99352089-99352111 GCAGAGTTCTTTGCTAAAACTGG + Intronic
1133660146 16:7908642-7908664 GCAAAGTGTGTTGCTAAAGCCGG + Intergenic
1133857364 16:9562123-9562145 GGAAGGTTTTTTGTGAACACCGG + Intergenic
1135716768 16:24777235-24777257 CCAAGGTTTGCTGCTATAACAGG - Exonic
1138471259 16:57239091-57239113 GCCAGATTTTATGCTAAAAATGG + Exonic
1139212761 16:65096323-65096345 CTAAGGTATTTTGTTAAAACAGG + Intronic
1140062207 16:71580569-71580591 TCAGGGTTCTTTGCTAAAACTGG + Intergenic
1141529111 16:84633948-84633970 GCAGGATTCTTTACTAAAACGGG - Intergenic
1143725363 17:8841344-8841366 GGCAGGATTCTTGCTAAAACTGG - Intronic
1143914928 17:10283858-10283880 GCAAGTTTCTATGGTAAAACAGG - Intergenic
1144220758 17:13097738-13097760 CCAGGGTTCTTTGCTAAAACTGG + Intergenic
1146680215 17:34801730-34801752 GCAAGGTATTTTCCACAAACTGG + Intergenic
1149254879 17:54814645-54814667 GCAGGGTTCTTTGGTAAAACTGG + Intergenic
1149707003 17:58704137-58704159 GCAGGATTCTTTGCTAAGACTGG - Intronic
1155121952 18:22830203-22830225 ACATTGTTTTTTGCTTAAACTGG + Intronic
1156833268 18:41521595-41521617 GCAAGGTTTTTTTCCCAAACTGG + Intergenic
1157427450 18:47595938-47595960 GCAGGATTCTTTGCTAAAGCTGG + Intergenic
1157510494 18:48268624-48268646 GCAGGATTCTTTGCTAAAACTGG + Intronic
1158094848 18:53758714-53758736 ACAGTGTTCTTTGCTAAAACTGG + Intergenic
1158203990 18:54970693-54970715 GAAAGGACTTTTGTTAAAACTGG + Intergenic
1159242662 18:65762799-65762821 TCAAGGTTTTTTTCTTACACAGG + Exonic
1159722614 18:71911526-71911548 GCAACGTTTTATTCTAAAAAGGG - Intergenic
1162642324 19:12021354-12021376 AAAAGGCTTTTTGCTATAACTGG - Intronic
1163843444 19:19625831-19625853 TAAAGGCTTTTTGTTAAAACAGG + Intronic
1164150503 19:22546231-22546253 GGAAGGTTTTTTGCAAAGAGGGG + Intergenic
1164241981 19:23397398-23397420 GGAAGGTTGTTTACTAAAACTGG - Intergenic
1165492403 19:36132095-36132117 GCAGGGTTCTTTGCTAAAACTGG + Intergenic
1165722147 19:38087065-38087087 GCAGGGTTCTTTGTTAAAACTGG + Intronic
1166576110 19:43839980-43840002 GTAATTTTTTTTGTTAAAACTGG + Intronic
925368253 2:3325509-3325531 GGAAGGTTTTGTGCTGAAATGGG - Intronic
925525843 2:4800984-4801006 GCATGATTTTTTTCAAAAACTGG + Intergenic
925697164 2:6593149-6593171 GAAAGGTATTTTGCTAAAACTGG - Intergenic
926651803 2:15354784-15354806 AGTAGGATTTTTGCTAAAACTGG - Intronic
927064776 2:19460450-19460472 GCAGGGTTCTTTGCTAAAAGTGG - Intergenic
928012092 2:27618766-27618788 GGAAGGTTTTTTAGTAATACAGG + Intronic
930176253 2:48304325-48304347 GCAGAGTTCTTTGCTAAAAATGG - Intergenic
933939802 2:87235731-87235753 GCAAGGTTTTGGGCAAACACAGG - Intergenic
934103591 2:88676312-88676334 GGAAAGTTTCTTGCTCAAACTGG - Intergenic
934940837 2:98500800-98500822 GCAGGGTTCTTTGCTAAAACTGG + Intronic
935421196 2:102870985-102871007 GCCATGTTTTTTGCTAAAGAAGG - Intergenic
936353335 2:111730042-111730064 GCAAGGTTTTGGGCAAACACAGG + Intergenic
936480908 2:112884009-112884031 AGGAGGGTTTTTGCTAAAACTGG + Intergenic
936861610 2:117026887-117026909 GCTAGGTTTTCTGCTAAAGGGGG - Intergenic
937840943 2:126524022-126524044 GCAGGGTTCTTTGCTAAAACTGG + Intergenic
939935751 2:148291223-148291245 GCTAGCTTTGTTGCTAAAATTGG - Intronic
942355921 2:175109968-175109990 GTAAGTTTTATTGCTAAAACAGG + Intronic
943218115 2:185065490-185065512 GCAGGGTTCTTTGCTGAAAATGG + Intergenic
943588116 2:189764261-189764283 GAAAGGTTTTATGTTCAAACTGG - Intergenic
944441284 2:199746139-199746161 CCAAGGTTTTATGTTAAAGCAGG + Intergenic
945302988 2:208231681-208231703 GCAGGGTCCTTTGCTAAAACTGG - Intergenic
945777872 2:214129926-214129948 TCATGGTTTTTTGTTAATACCGG - Intronic
946015997 2:216604453-216604475 GCAGGGCTCTTTGCTAAAACTGG + Intergenic
946494745 2:220184508-220184530 GCAGGGCTCTTTCCTAAAACTGG - Intergenic
947377847 2:229515215-229515237 GAAAGGTATTTTTTTAAAACAGG + Intronic
1168764400 20:371969-371991 GCAAGGTTTTCTGATGCAACTGG + Intronic
1169479468 20:5965300-5965322 GCTAGGTTTTTTGCTAAGGGGGG - Intronic
1169830328 20:9818106-9818128 GCAGGGTATTTTGTTAAAACTGG - Intronic
1171256674 20:23693741-23693763 GCAGGATTCTTTCCTAAAACTGG - Intergenic
1171264028 20:23755673-23755695 GCAGGATTCTTTCCTAAAACTGG - Intergenic
1171273215 20:23832517-23832539 GCAGGATTCTTTCCTAAAACTGG - Intergenic
1172542875 20:35735010-35735032 TAAAGGTGTTTTGCTATAACTGG + Intronic
1174688969 20:52483832-52483854 ACAAGGTTTTTTGTGAAGACAGG + Intergenic
1174856550 20:54050878-54050900 GCTTGGTTTTATGCTAATACTGG + Intronic
1176726033 21:10433503-10433525 GTAAGGTTTTTTGCTGATAGAGG + Intergenic
1177403465 21:20636384-20636406 GCAGGGTTCTTTGCTAAAACTGG + Intergenic
1177668645 21:24195605-24195627 GCGGGGTTCTTTGCTAAAACTGG - Intergenic
1178664183 21:34532257-34532279 GCGGGGTTCTTTGCTAAAACTGG + Intronic
1179057350 21:37948362-37948384 GCAAAATTCTTTGCTAAAACTGG + Intergenic
1179455838 21:41499416-41499438 GCAAGGTTTTTTGCTAAAACTGG - Intronic
1179648662 21:42792388-42792410 GCAGGATTCTTTGCTAAAGCTGG + Intergenic
1179794587 21:43775744-43775766 GCCAGGCTTCTTGCTAAAAGTGG - Intronic
1180727127 22:17954533-17954555 GCAATGTTCTTTGCTAAAACTGG + Intronic
1181904919 22:26186697-26186719 GCAGGATTCTTTGCTAAAACTGG + Intronic
1182685272 22:32117862-32117884 GACAGGATTCTTGCTAAAACTGG - Intergenic
1183682903 22:39344360-39344382 GGAGGGTTCTTTGCTAAAACTGG + Intergenic
949673917 3:6431019-6431041 ACAATGGTTTTTGTTAAAACTGG + Intergenic
949915876 3:8964110-8964132 GCAGGGTTTTTTGCTAAAACTGG - Intergenic
950029725 3:9844213-9844235 TTCAGGTTTTTTGCTAAGACAGG - Intronic
951564936 3:24003808-24003830 TCAAGTTTGTTTGCTAAATCTGG - Intergenic
951591244 3:24267535-24267557 GCAGGGTTCTTTGCTAAAACTGG - Intronic
954685536 3:52368207-52368229 GCAGGGTTCTTTACTGAAACTGG + Intronic
957009687 3:74989544-74989566 GCAATGTTTTTATCTGAAACGGG - Intergenic
957315197 3:78567791-78567813 ATAGGGTTCTTTGCTAAAACTGG - Intergenic
957615454 3:82520354-82520376 GCAAAGTGATTTGTTAAAACTGG - Intergenic
958520195 3:95175474-95175496 GCTGGATTCTTTGCTAAAACTGG - Intergenic
959051572 3:101529368-101529390 GCAGGGTTCTTTACTAAAATTGG - Intergenic
959525881 3:107376167-107376189 GCAAGCATTTTTGCAAAAAATGG + Intergenic
959770597 3:110090527-110090549 GCAGGGTTCTTTTCTAAAACTGG + Intergenic
960628009 3:119700497-119700519 GCACGGTTCTTTGCTAAAACTGG + Intergenic
960924934 3:122785352-122785374 GCAAGGTTCTTTCCTAAAACTGG - Intronic
961590478 3:127976424-127976446 GGAAGATTTTATTCTAAAACGGG - Intronic
962153934 3:132924080-132924102 GCAGTGTTCTTTGCTAAAACTGG - Intergenic
962581746 3:136804284-136804306 GCAGGGTTCTTTGCTAAAACTGG - Intergenic
962926415 3:139998023-139998045 TCAAGGTTTTTTTCTAATACTGG - Intronic
963774405 3:149423371-149423393 GCAGGGCTCTTTGCTAAAACTGG + Intergenic
964212307 3:154241903-154241925 GTAGGGTTCTTTGCTAAAACTGG + Intronic
964275128 3:155001363-155001385 GCAGGGTTTTTTGCTAAAACTGG - Intergenic
964331305 3:155606308-155606330 ACAGAGTTTTTTCCTAAAACGGG - Intronic
965580642 3:170264245-170264267 GCAGTGTTTTTTACTTAAACAGG + Intronic
965971503 3:174561630-174561652 GCAAAGTTGTTTGCTGCAACTGG + Intronic
966594893 3:181717047-181717069 GCAAGGTTTCTTGCCAATGCTGG + Intergenic
968779039 4:2565209-2565231 ACAAGGTTTTGTGGGAAAACTGG + Intronic
969891693 4:10265863-10265885 TTAGGGTTCTTTGCTAAAACTGG + Intergenic
971659084 4:29388995-29389017 GCAAAGTTTGTTGTTAAAACTGG + Intergenic
972374064 4:38454107-38454129 ACAATGTATTTTGCTAAAACTGG + Intergenic
974161062 4:58140009-58140031 GCAATCTTTTTTTCTGAAACAGG + Intergenic
974790921 4:66687929-66687951 GCAACATTTTATTCTAAAACAGG - Intergenic
974842492 4:67313992-67314014 CCAAGGTATTTTGCAAAAATGGG + Intergenic
975431947 4:74303782-74303804 ACAGGATTCTTTGCTAAAACTGG + Intergenic
976332982 4:83852992-83853014 GCAGCGTTCTTTGCTAAAGCTGG - Intergenic
978926182 4:114248437-114248459 GAAAGGTTCTTTGCTAAAACTGG - Intergenic
979292596 4:118994216-118994238 GCAGGGTTTTCTGCTAAAATTGG - Intronic
979300500 4:119081014-119081036 GCAGGATTCTTTGCTAAAACTGG + Intergenic
980240872 4:130173308-130173330 GCAAAGTTTTTTGCTACCCCTGG + Intergenic
980653804 4:135756110-135756132 GCAAGGTTCCTGGCCAAAACTGG + Intergenic
981057872 4:140384424-140384446 AGCAGGATTTTTGCTAAAACTGG - Exonic
981903099 4:149889704-149889726 GTAGGGTTCTTTGCTAAAACTGG - Intergenic
982656047 4:158151097-158151119 GAAAAGTTTTTTTCTAAAATGGG + Intronic
987693766 5:21301872-21301894 GCAGGAGTCTTTGCTAAAACTGG + Intergenic
987854103 5:23396576-23396598 GCAGGGTTCTTTGCTAAAACTGG - Intergenic
988602561 5:32653595-32653617 AACAGGTTCTTTGCTAAAACTGG - Intergenic
988912315 5:35855910-35855932 GAAACGTTATTTGCAAAAACAGG + Intronic
988978182 5:36536268-36536290 TCAGGGTTTTTTCCTAAAAGTGG - Intergenic
989981274 5:50648677-50648699 GCAGTGTTCTTTGCTAAAGCTGG - Intergenic
990276370 5:54201441-54201463 GCCAGGCTCTTTGCTAAAATGGG - Intronic
991069557 5:62461399-62461421 GCAAGATTTCTTGCTAAAATTGG + Intronic
992262430 5:74984716-74984738 GCTGGGCTCTTTGCTAAAACTGG + Intergenic
992288625 5:75262050-75262072 GCAGGGCTCTTTGCTAAAACTGG - Intergenic
992425685 5:76655029-76655051 GCAAGGATTTTTTATAAACCAGG + Intronic
996092010 5:119360676-119360698 GCAAGGATTTTTGCAAACACAGG + Intronic
996973120 5:129396977-129396999 GCAATGTTGTTGCCTAAAACTGG + Intergenic
997384667 5:133463260-133463282 TCAGGATTCTTTGCTAAAACTGG - Intronic
997840212 5:137232705-137232727 GCAAGGTTTTTTGGTAAACATGG - Intronic
998194334 5:140054406-140054428 GGAAGGGTTTTTACTAAAATAGG + Intergenic
998646410 5:144067087-144067109 GCAGTGTTCTTTGCTAAAACTGG + Intergenic
1000273404 5:159709439-159709461 AGCAGGGTTTTTGCTAAAACTGG + Intergenic
1002783688 6:385432-385454 GCATTTTTATTTGCTAAAACTGG + Intergenic
1002875303 6:1204601-1204623 GCAATGTTCTTTGCTAAAGCTGG + Intergenic
1004444098 6:15681911-15681933 TCAGGTTTTTTTGCTCAAACTGG + Intergenic
1004446007 6:15699151-15699173 GCAATGCTCTTTGCAAAAACAGG + Intergenic
1005007480 6:21302838-21302860 GAAAGGTTTTTAGCTACTACAGG - Intergenic
1005557143 6:26998065-26998087 GCAGGAGTCTTTGCTAAAACTGG - Intergenic
1005762273 6:28978138-28978160 GCAGGGTTCTTTGCTAAAACTGG - Intergenic
1007342184 6:41198308-41198330 GCAAGGTTTGGTGCAAAATCAGG - Exonic
1007348263 6:41249432-41249454 GCAAGGTTTGGTGCAAAATCAGG + Intergenic
1008057646 6:46961865-46961887 ACATGGTTATTTGCTAAAATAGG - Intergenic
1008455145 6:51701548-51701570 GCAAAATATTTTCCTAAAACTGG + Intronic
1009835582 6:68997041-68997063 GCAAGGTATTTTATTAAAAATGG + Intronic
1010508825 6:76692122-76692144 GCAGAGTTCTTTGCTAAAACTGG + Intergenic
1011417094 6:87133292-87133314 TTAGGGTTCTTTGCTAAAACTGG - Intergenic
1011779564 6:90771784-90771806 GCAGGATTCTTTGCTAAAACTGG - Intergenic
1012669312 6:102020613-102020635 ACAGGGTTCTTTGCTAAAACTGG + Intronic
1014300857 6:119679632-119679654 AGCAGGATTTTTGCTAAAACTGG + Intergenic
1014854315 6:126380954-126380976 GCAGGGTTCTTTGCTAAAACTGG - Intergenic
1015381438 6:132574041-132574063 GGACAGGTTTTTGCTAAAACAGG - Intergenic
1016583956 6:145662803-145662825 GCTGGGTTCTTTGCTAAAAATGG + Intronic
1016677370 6:146787095-146787117 GCAGGATTTTTTGCTAAAACTGG + Intronic
1016869163 6:148799408-148799430 GCAAGGTTTTTGGCCCAAAGTGG + Intronic
1017069470 6:150561369-150561391 GCAAGCTTTTTTTCTATATCAGG - Intergenic
1017478710 6:154827717-154827739 TCAAGTATTCTTGCTAAAACAGG - Intronic
1020591118 7:10138429-10138451 CCAGGTTCTTTTGCTAAAACTGG - Intergenic
1022378834 7:29840997-29841019 GCAGGGGGTTTTGCCAAAACTGG + Intronic
1023233794 7:38063081-38063103 GAAAGATTTTGTGCTAAAATAGG + Intergenic
1024412938 7:49067605-49067627 CCAAGGTTTTTTTCTAAACACGG + Intergenic
1024707052 7:51972310-51972332 GGCAGGATTTTTGCTAAAACTGG + Intergenic
1025006911 7:55362664-55362686 GCAAGGCTGTTTGCTAAAACTGG + Intergenic
1025963447 7:66245537-66245559 GCAGGGTTCTTTGCTAAAACTGG + Intronic
1026153292 7:67806511-67806533 GCAAATGTTTTTGATAAAACAGG - Intergenic
1026475913 7:70735166-70735188 GTAAGGTTTTATTCTAAAAGAGG - Intronic
1027359502 7:77393565-77393587 TTAAGGTTTTTGGCTAGAACAGG - Intronic
1027410957 7:77917192-77917214 GCAAGGTTAATTGCTCAAAGGGG - Intronic
1028945717 7:96577358-96577380 GCAAGGTTTTTGGTTCATACAGG - Intronic
1031772376 7:125860777-125860799 GCAAGGTTTTTTGGAGAAAAGGG - Intergenic
1032836987 7:135683702-135683724 GAAAGGTATTTTGAGAAAACAGG - Intronic
1033308987 7:140245882-140245904 GCAGGATTCTTTGCTAAGACTGG - Intergenic
1035185774 7:157125089-157125111 GTGGGGTTTTTTGCTAAAAACGG - Intergenic
1035943382 8:3930005-3930027 GCAAGGTTTTCTTCTTACACTGG + Intronic
1036744835 8:11399269-11399291 GCCAGGGTTCTTGTTAAAACTGG + Intronic
1037050797 8:14371389-14371411 GCAAAGGTTATTGCTAATACCGG - Intronic
1040449611 8:47531207-47531229 TAAAGTTTTTTTGCTAAAAATGG + Intronic
1040680127 8:49798467-49798489 GCAGGCTTCTTTGCTAGAACTGG + Intergenic
1040794054 8:51270589-51270611 GCAAGGTATTTTGCAAGAATTGG + Intergenic
1041411293 8:57559316-57559338 AGCAGGGTTTTTGCTAAAACTGG - Intergenic
1041760586 8:61362073-61362095 GCAGAGTTCTTTGCTAAAACTGG + Intronic
1043230556 8:77795022-77795044 GCTGAGTTCTTTGCTAAAACTGG - Intergenic
1043342274 8:79254643-79254665 GCAGGGCTCTTTGCTAAAATTGG + Intergenic
1043631252 8:82337509-82337531 AAAAGGTTCTTTACTAAAACTGG - Intergenic
1044123089 8:88422653-88422675 GCAGGGTTCTTTGCTAAAACTGG - Intergenic
1044340580 8:91041813-91041835 GTAGGGTTCTTTGCTAAAACTGG - Intergenic
1044761145 8:95519023-95519045 GCAAGGTTAAGTGCTAAAAGTGG + Intergenic
1046946083 8:119975643-119975665 TCAGGGTTATTTGCTAAAACTGG + Intronic
1047331833 8:123896237-123896259 GCAAAGTGTGTTGTTAAAACTGG - Intronic
1048388242 8:133933842-133933864 GCAAGATTCTTTGTTAAAACTGG + Intergenic
1048567320 8:135615150-135615172 GCAAGGTTCTTTTTTAAAACTGG + Intronic
1048949464 8:139483380-139483402 GCAAGGTTCTTTGCTAAAATGGG + Intergenic
1050921331 9:11204763-11204785 TCAAGGTTTTTTGGTAGAACTGG - Intergenic
1050988271 9:12110956-12110978 GAAAGTTGTTTTGCTGAAACTGG - Intergenic
1051231293 9:14958117-14958139 GGAAGGGGTTTTGCTAAAATTGG + Intergenic
1052726524 9:32234653-32234675 GCAGTGTTCTTTGCTAAAATTGG - Intergenic
1052804694 9:33002370-33002392 GCCAGGGTCTGTGCTAAAACTGG - Intronic
1053183515 9:35994508-35994530 CCAAGTGTTTTTGCTAACACTGG - Intergenic
1053809822 9:41840561-41840583 GCGGGGATTTTTGCTCAAACTGG + Intergenic
1054620771 9:67346867-67346889 GCGGGGATTTTTGCTCAAACTGG - Intergenic
1055327651 9:75148556-75148578 GCATGAATTTTTGGTAAAACAGG + Intergenic
1055375774 9:75647356-75647378 GCAAGAGTTTTTGCTGAAAGAGG - Intergenic
1055375783 9:75647417-75647439 GCAAGAGTTTTTGCTGAAAGAGG - Intergenic
1056846195 9:90040133-90040155 AGCAGGTTTCTTGCTAAAACTGG + Intergenic
1057377032 9:94534465-94534487 GCAGGGCTCTTTGCTAAAACTGG - Intergenic
1057747465 9:97763403-97763425 GCAAGGTTTTGTGCTATAGGTGG + Intergenic
1057977761 9:99624329-99624351 GCAAGGTATTATCCTAAAAAAGG - Intergenic
1059180659 9:112209579-112209601 GCCAGGATTCTTGCTAAAACTGG + Intergenic
1059278171 9:113112641-113112663 GAATGGTATTTTGTTAAAACTGG + Intergenic
1061494455 9:130963724-130963746 GCAGGGTTCTTTGCTAAAACTGG + Intergenic
1062314908 9:135962090-135962112 TCAAGGCTCTTCGCTAAAACTGG - Intergenic
1185915511 X:4030191-4030213 GAAAGGTTTTTTCCTTAAAGGGG - Intergenic
1185940126 X:4308589-4308611 GGCAGGTTCTTTGCTAAAACTGG + Intergenic
1186216742 X:7308559-7308581 GCAGGGTTGTATGATAAAACTGG - Intronic
1186244340 X:7605132-7605154 GCAGGGTTCTCTGCTAAAACTGG - Intergenic
1186370992 X:8947229-8947251 TCAAGGTTATTTACAAAAACAGG + Intergenic
1186678373 X:11845148-11845170 TTAAAGTTTTTTGCTAAATCTGG + Intergenic
1186858806 X:13651496-13651518 TCAAGGCTTTTTGCTAAAACTGG - Intergenic
1189349300 X:40265084-40265106 GCTAGGTGTTTTACAAAAACGGG + Intergenic
1190110200 X:47584395-47584417 GCAAGGCTCTCGGCTAAAACTGG + Intronic
1190182860 X:48208263-48208285 GACAGGATTTTTGCTGAAACAGG - Intronic
1190186340 X:48237915-48237937 GACAGGATTTTTGCTGAAACAGG - Intronic
1190195736 X:48316865-48316887 GACAGGATTTTTGCTGAAACAGG - Intergenic
1190201747 X:48367650-48367672 GACAGGTTTTTTGCTGAAAAAGG + Intergenic
1190208792 X:48427761-48427783 GACAGGTTTTTTGCTGAAAAAGG - Intergenic
1190379743 X:49828386-49828408 GCAGGGCTCTTTGCTAAAACTGG + Intergenic
1190662436 X:52667226-52667248 GACAGGATTTTTGCTGAAACAGG - Intronic
1190668584 X:52718187-52718209 GACAGGATTTTTGCTGAAACAGG + Intergenic
1190670833 X:52740217-52740239 GACAGGATTTTTGCTGAAACAGG - Intergenic
1194146398 X:90270589-90270611 GCAAGATTTTTTGCTAAAACTGG - Intergenic
1194336955 X:92659921-92659943 GCACAATTATTTGCTAAAACTGG - Intergenic
1194375562 X:93128575-93128597 GAAATGTTATTTGCTAAGACAGG + Intergenic
1194585451 X:95728022-95728044 CAAAGGTTCTTTGCAAAAACAGG - Intergenic
1194770825 X:97902797-97902819 GCAGGGTTCTTTGCTAAAACTGG - Intergenic
1195286191 X:103386544-103386566 AGCAGGATTTTTGCTAAAACTGG + Intergenic
1195652371 X:107298550-107298572 GCAGGGTCCTTTGCTAAAACTGG + Intergenic
1196078155 X:111600373-111600395 GAAGGGTTCTTTGCTAAAACTGG - Intergenic
1196323420 X:114371593-114371615 GCAGGATTATTTGCTAAAACTGG + Intergenic
1197662129 X:129185696-129185718 GCAAGGATTTAAGCTAAAAAAGG - Intergenic
1197796206 X:130300833-130300855 TCAAGGTTTTCTGCAAAAAAGGG + Intergenic
1200492136 Y:3839767-3839789 GCAAGATTTTTTGCTAAAACTGG - Intergenic
1201463565 Y:14255415-14255437 GCAGGGTTCTGTGCTAAAACTGG - Intergenic