ID: 1179457222

View in Genome Browser
Species Human (GRCh38)
Location 21:41507996-41508018
Sequence AGGGGGCATCGGCGGGTCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 180}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179457217_1179457222 -9 Left 1179457217 21:41507982-41508004 CCTCCGGGCGGGGCAGGGGGCAT 0: 1
1: 0
2: 3
3: 14
4: 228
Right 1179457222 21:41507996-41508018 AGGGGGCATCGGCGGGTCCCAGG 0: 1
1: 0
2: 0
3: 18
4: 180
1179457204_1179457222 15 Left 1179457204 21:41507958-41507980 CCGCGCTCCTCACACCCGCTTTC 0: 1
1: 0
2: 2
3: 15
4: 208
Right 1179457222 21:41507996-41508018 AGGGGGCATCGGCGGGTCCCAGG 0: 1
1: 0
2: 0
3: 18
4: 180
1179457212_1179457222 0 Left 1179457212 21:41507973-41507995 CCGCTTTCACCTCCGGGCGGGGC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1179457222 21:41507996-41508018 AGGGGGCATCGGCGGGTCCCAGG 0: 1
1: 0
2: 0
3: 18
4: 180
1179457210_1179457222 1 Left 1179457210 21:41507972-41507994 CCCGCTTTCACCTCCGGGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1179457222 21:41507996-41508018 AGGGGGCATCGGCGGGTCCCAGG 0: 1
1: 0
2: 0
3: 18
4: 180
1179457202_1179457222 24 Left 1179457202 21:41507949-41507971 CCTGCCGCGCCGCGCTCCTCACA 0: 1
1: 0
2: 2
3: 17
4: 175
Right 1179457222 21:41507996-41508018 AGGGGGCATCGGCGGGTCCCAGG 0: 1
1: 0
2: 0
3: 18
4: 180
1179457205_1179457222 8 Left 1179457205 21:41507965-41507987 CCTCACACCCGCTTTCACCTCCG 0: 1
1: 0
2: 0
3: 10
4: 171
Right 1179457222 21:41507996-41508018 AGGGGGCATCGGCGGGTCCCAGG 0: 1
1: 0
2: 0
3: 18
4: 180
1179457203_1179457222 20 Left 1179457203 21:41507953-41507975 CCGCGCCGCGCTCCTCACACCCG 0: 1
1: 0
2: 0
3: 28
4: 225
Right 1179457222 21:41507996-41508018 AGGGGGCATCGGCGGGTCCCAGG 0: 1
1: 0
2: 0
3: 18
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179457222 Original CRISPR AGGGGGCATCGGCGGGTCCC AGG Exonic
900001432 1:16920-16942 AGGGGGCAATGCCGGGGCCCAGG + Intergenic
900021152 1:187442-187464 AGGGGGCAATGCCGGGGCCCAGG + Intergenic
900113880 1:1020510-1020532 AGGGGGGGTCGCCGGGTCCCGGG + Intronic
900270177 1:1782984-1783006 AAGGGGCACCAGAGGGTCCCAGG + Intergenic
900464986 1:2821220-2821242 AGGGGGCCAAGGAGGGTCCCAGG + Intergenic
900585538 1:3430725-3430747 AGGGAGCTCCCGCGGGTCCCTGG - Intronic
900626569 1:3611305-3611327 AGGCGGCCCCGGCGGCTCCCCGG + Exonic
902186709 1:14730899-14730921 AGTGGGCATCTGGGAGTCCCTGG - Intronic
903263311 1:22142775-22142797 CGGGGGCAGCGGCCGGTGCCAGG - Intronic
905441873 1:38001050-38001072 TGGGGGCATCTGCTGGTGCCTGG - Intronic
907442164 1:54485829-54485851 CGGGGGCAGCCACGGGTCCCAGG - Intergenic
912331688 1:108826066-108826088 AGGTGTAATCGGAGGGTCCCTGG - Intronic
915886069 1:159722680-159722702 AGGGGGCATCTGCCCTTCCCTGG + Intergenic
922741531 1:228016814-228016836 AGGGGGCAGGGGAGGGTGCCAGG + Intronic
924090069 1:240492744-240492766 AGGGGGCACAGGTGGGACCCGGG + Exonic
924462173 1:244269355-244269377 AAGGGGCATCGGGGGTTGCCCGG + Intergenic
1070257631 10:74825525-74825547 AGGCGGCGGCGGTGGGTCCCGGG + Intergenic
1070923773 10:80205167-80205189 GGAGGGCGTCGGCGGGTCGCGGG - Intronic
1071530621 10:86388314-86388336 AGGGGGCACGGGTGGATCCCAGG - Intergenic
1072800727 10:98390687-98390709 ATGGGGCAGCGGCTGGCCCCTGG + Exonic
1073045023 10:100632016-100632038 AGGGGGCATTGGCCGGGCCTGGG - Intergenic
1073423437 10:103442076-103442098 AGGGGGCAGCGGCCAGTCCCAGG + Intronic
1073989126 10:109243224-109243246 AGGGGGGATCTGCGGTTTCCAGG + Intergenic
1075948914 10:126460706-126460728 AGGGGGCCTCGGTGGGACCTGGG - Intronic
1077334727 11:1998194-1998216 GGGGGCCAGCTGCGGGTCCCTGG + Intergenic
1083743690 11:64723688-64723710 AGGGGGACTCGGTGGGTCCATGG + Intergenic
1084978306 11:72815100-72815122 AGGGGGCATCAGGGGGCCCCGGG + Intronic
1087046902 11:93850342-93850364 GGGGGGCACGGGCGGGGCCCCGG - Intronic
1087936159 11:104036772-104036794 AGAGGGCATGGGCGGCTCACTGG - Exonic
1089359349 11:117875948-117875970 AGGGGGCAATGGCGGACCCCAGG + Intronic
1089459381 11:118643842-118643864 AGGGGGCCGCTGCGGGTCCGGGG - Exonic
1202817710 11_KI270721v1_random:53376-53398 GGGGGCCAGCTGCGGGTCCCTGG + Intergenic
1091374518 12:17035-17057 AGGGGGCAATGCCGGGGCCCAGG + Intergenic
1096102414 12:48978039-48978061 AGGGGACGTCGGAGGGGCCCGGG + Intergenic
1096610383 12:52797115-52797137 AGGGGGCATGGGCGACTCTCAGG - Intergenic
1104654953 12:130567590-130567612 ACTGGGCATCGGCACGTCCCTGG + Intronic
1104946025 12:132415237-132415259 TGGGGGCATCCTCGGGCCCCTGG - Intergenic
1109327190 13:60882024-60882046 AAGGGGCATCAGTGGGTGCCAGG - Intergenic
1113853851 13:113433307-113433329 AGGTGGGATCGGGGGGACCCTGG - Intronic
1119219323 14:72893452-72893474 CGGGGGAAGCAGCGGGTCCCGGG - Intronic
1121754652 14:96392392-96392414 AGGGGGCATTGGTGGTGCCCAGG - Intronic
1122145945 14:99688876-99688898 AGGGGGCATCGGCTCTGCCCAGG - Intronic
1122937540 14:104967013-104967035 TGGGGGCAGAGGAGGGTCCCTGG + Intronic
1123023159 14:105411598-105411620 AGGGGACAACGGCGGGGCCCGGG - Intronic
1125608014 15:40953172-40953194 AGGGGGCACCCGCCGGGCCCAGG - Exonic
1125677830 15:41511978-41512000 GGAGGGAATCGGCGGGGCCCGGG + Intronic
1128799895 15:70490617-70490639 GAGGGGCAGCGGCGGGTCCCTGG - Intergenic
1132105433 15:99059390-99059412 AGGCGGGATCGGCGCGACCCCGG + Intergenic
1132452076 15:101974018-101974040 AGGGGGCAATGCCGGGGCCCAGG - Intergenic
1132454817 16:16603-16625 AGGGGGCAATGCCGGGGCCCAGG + Exonic
1132649411 16:1013814-1013836 AGGGGGCCTGGGCGGGGCCTGGG + Intergenic
1132650754 16:1020556-1020578 TGGGGGCATCTGCAGCTCCCTGG + Intergenic
1132889295 16:2196232-2196254 AGGGGACGTTGTCGGGTCCCCGG - Intronic
1133119564 16:3597745-3597767 AGAGGCCATCAGCAGGTCCCGGG - Intronic
1135811258 16:25588730-25588752 AGGGGGCAGGGGAGGGTTCCAGG - Intergenic
1137223834 16:46482555-46482577 ACGGGGAATCAGCAGGTCCCTGG + Intergenic
1138420009 16:56892869-56892891 AAGGGGCGTTGGCGGGGCCCTGG + Intronic
1138556202 16:57772557-57772579 AGGGGGCATCGGGGTGGCCTTGG - Intronic
1141792859 16:86248559-86248581 AGGGGGCATTGGCCAGGCCCAGG - Intergenic
1142610759 17:1108376-1108398 AGGGAGCATCTGCTGGGCCCTGG - Intronic
1143205793 17:5138746-5138768 AGAGGGCACAGGCGGGACCCCGG + Intronic
1143634562 17:8156906-8156928 AGGGAGCCTCGGTGGGACCCAGG - Intronic
1143660325 17:8320759-8320781 AGGGGGCCTCGTGGGGTCTCAGG - Intronic
1144625693 17:16843426-16843448 AGGGAGCCTCTGCGGGCCCCTGG + Intergenic
1144880738 17:18429294-18429316 AGGGAGCCTCTGCGGGCCCCTGG - Intergenic
1145151497 17:20515093-20515115 AGGGAGCCTCTGCGGGCCCCTGG + Intergenic
1146162847 17:30569343-30569365 AGGGAGCCTCTGCGGGCCCCTGG + Intergenic
1146283404 17:31559383-31559405 AGGGGGCGGCGGCGGCCCCCAGG + Intergenic
1146842818 17:36167049-36167071 AGAGGGCACAGGCGGGACCCCGG - Intronic
1146871031 17:36378901-36378923 AGAGGGCACAGGCGGGACCCCGG - Intronic
1146878389 17:36429983-36430005 AGAGGGCACAGGCGGGACCCCGG - Intronic
1146882338 17:36451129-36451151 AGAGGGCACAGGCGGGACCCCGG - Intergenic
1146901464 17:36592069-36592091 GGGGGGCATCGGCGCGGCCGTGG + Exonic
1147068358 17:37933979-37934001 AGAGGGCACAGGCGGGACCCCGG + Intronic
1147073915 17:37979525-37979547 AGAGGGCACAGGCGGGACCCCGG - Intronic
1147085436 17:38059063-38059085 AGAGGGCACAGGCGGGACCCCGG - Intronic
1147095830 17:38137476-38137498 AGAGGGCACAGGCGGGACCCCGG + Intergenic
1147101383 17:38183029-38183051 AGAGGGCACAGGCGGGACCCCGG - Intergenic
1147183962 17:38703964-38703986 GGGGGGCCGCGGCGGGCCCCAGG + Intergenic
1147652826 17:42071968-42071990 AAGGGGCATGGGGGGGCCCCTGG - Intergenic
1148108516 17:45132065-45132087 TGGGGTCATCCGAGGGTCCCGGG - Intronic
1148603034 17:48908526-48908548 AGGCGGCAACGGCGGGCGCCGGG + Exonic
1149496511 17:57121772-57121794 AGGGGGCAGGGGCGGGGCACTGG - Intergenic
1151538980 17:74754989-74755011 AGGTGGCCATGGCGGGTCCCAGG + Intronic
1152362839 17:79840318-79840340 AGGGGACTTCGTGGGGTCCCGGG + Intergenic
1152631873 17:81414144-81414166 AGGGGGCCACGGCTGGTCCTGGG - Intronic
1153715034 18:7839143-7839165 AGTGGGCATTTGGGGGTCCCTGG - Intronic
1155345520 18:24853219-24853241 AGGTGGCCTCTGCAGGTCCCTGG - Intergenic
1156489047 18:37485649-37485671 AGGGCGCGTCGGCGGGCCCGGGG - Intronic
1160125908 18:76171257-76171279 AGGAGGCAGAGGCGGGTCACTGG - Intergenic
1160551788 18:79698156-79698178 GGGGAGCATCCGCGGCTCCCGGG + Intronic
1160873232 19:1286336-1286358 GGGGGGCGTTGGGGGGTCCCCGG - Intronic
1161405882 19:4090882-4090904 AAGGGGCAGCGGCGTGTGCCAGG + Intronic
1161468701 19:4445924-4445946 AGGGGGCCTGGGCAGGTCCCTGG - Intronic
1162100213 19:8334645-8334667 AGGAGGCAGCGGCGGGGGCCCGG - Exonic
1163462770 19:17448705-17448727 AGGGGGCGCCCGCGGGGCCCCGG - Intronic
1165065799 19:33227032-33227054 ACGGGGCGGGGGCGGGTCCCTGG + Intergenic
1165144883 19:33724666-33724688 AGGGGGCAGGGGCAGGGCCCAGG - Intronic
1166766026 19:45252310-45252332 AGGTGGCATCTGGGGGCCCCGGG - Intronic
1167040835 19:47021572-47021594 AGGAGGTGTCGGCGGGGCCCCGG - Intronic
1167244571 19:48365465-48365487 AGGGGGCTTCTGTGGGCCCCAGG - Intronic
1167394447 19:49218826-49218848 AGGGGGCCTCACCAGGTCCCGGG - Intergenic
1167601160 19:50455601-50455623 AGGTGGCATCGATGGGTACCTGG + Exonic
1167645319 19:50702590-50702612 AGGGGGCCCCGGGGGCTCCCTGG - Exonic
1167735657 19:51293199-51293221 AGGGGCCACCTGCTGGTCCCTGG - Intergenic
1168293008 19:55366127-55366149 CGGGGGCGCCGGCGGGTCCGGGG + Exonic
925648717 2:6065901-6065923 AAGGGGCATCGCCTTGTCCCAGG + Intergenic
926235616 2:11041219-11041241 AGGGGGCAAGGGCTGGTGCCTGG - Intergenic
930177557 2:48315379-48315401 GGTGGGCAGAGGCGGGTCCCGGG + Intronic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
933924012 2:87076115-87076137 ACGCGGCCTCGGCGGGGCCCGGG - Intergenic
935651533 2:105386330-105386352 TGCGGGCCTCTGCGGGTCCCCGG - Intronic
936568293 2:113596494-113596516 AGGGGGCAATGCCGGGGCCCAGG - Intergenic
936938543 2:117860091-117860113 AGGCGGCATAGGAGGGTTCCCGG - Intergenic
938122182 2:128641824-128641846 AGGCGGCATCGGAAGGCCCCTGG - Intergenic
942150916 2:173075678-173075700 TGGGGGCCTCGGCGGGTGCCGGG + Intronic
948646208 2:239406692-239406714 AGGGCGCATCTGCGGGGCCCAGG + Intergenic
1169131365 20:3167835-3167857 ACCGGGCCTCGGAGGGTCCCAGG - Exonic
1176178880 20:63740474-63740496 CGGGGGCGGCGGCGGGGCCCCGG + Exonic
1178411404 21:32366485-32366507 AGGGGGCCTCGGAGGCTTCCAGG - Intronic
1178865098 21:36320410-36320432 CGGGGGCTGCGGCGGGGCCCGGG + Intronic
1179457222 21:41507996-41508018 AGGGGGCATCGGCGGGTCCCAGG + Exonic
1180837217 22:18935968-18935990 CGGGGGCTTCTGCCGGTCCCGGG - Intronic
1182237239 22:28884636-28884658 AGTGGGGATCGGGGGTTCCCTGG + Intronic
1183227921 22:36563211-36563233 AGGGGGCATCAGTGAGTCCAAGG + Intergenic
1183313930 22:37127040-37127062 AGGGGGCAGTGGGAGGTCCCAGG + Exonic
1203287310 22_KI270734v1_random:161267-161289 CGGGGGCTTCTGCCGGTCCCGGG - Intergenic
949981660 3:9505926-9505948 GGGGGGCAGCGGCGGGAGCCAGG - Intronic
952816450 3:37451971-37451993 GGGGCGCCCCGGCGGGTCCCAGG + Intergenic
955400337 3:58586888-58586910 CGGTGGCATCGGAGGGCCCCCGG + Intronic
959385668 3:105702283-105702305 AAGAGGCATTGGCGGGTCTCTGG + Exonic
961299822 3:125915683-125915705 CGGGGCCAGCGGCGGGCCCCAGG - Intergenic
961361478 3:126370855-126370877 TGGGGGCAGCTGAGGGTCCCTGG - Intergenic
961743199 3:129046639-129046661 AGGAGGCGTCGCCGGGGCCCCGG + Intergenic
968745396 4:2357300-2357322 GAGGGGCATTGGCAGGTCCCGGG - Intronic
970111112 4:12639194-12639216 AGGGAGCATCTTCGGGTCGCGGG - Intergenic
972186399 4:36533416-36533438 AGTGGCCATGGGCTGGTCCCTGG - Intergenic
985673782 5:1219829-1219851 AGAGGGCATCAGCAGGGCCCTGG + Intronic
985783001 5:1880768-1880790 AGGCGGCAGCGGCTGGTGCCAGG + Exonic
986152531 5:5140424-5140446 AGGGGCCACCGGAGGGTCCCCGG - Exonic
996769677 5:127073118-127073140 ACGGGGCATCGGCGAATCACTGG + Intronic
997963349 5:138338604-138338626 ATGGGGCGTCCGCTGGTCCCCGG - Intronic
1002187645 5:177462020-177462042 AGGGGGCTGCGGCGAGGCCCCGG - Intronic
1002888634 6:1316488-1316510 CGGGGGCATTGGAGGGTCCTGGG + Intergenic
1006092283 6:31635139-31635161 AGGGGGCAGAGGCTGCTCCCGGG - Exonic
1006337429 6:33427981-33428003 TGGGGGCGGCGGCGGGGCCCGGG - Intronic
1006986556 6:38179448-38179470 AGGTGGCAGCAGCAGGTCCCAGG + Intronic
1008662948 6:53687497-53687519 AGGAGGCATGTGCGGGGCCCAGG + Intergenic
1008956370 6:57221344-57221366 AGGAGCCATCGGCAGTTCCCAGG - Intronic
1012472976 6:99591163-99591185 AGGGGGGTTCCGCGGGGCCCTGG + Intergenic
1013299175 6:108786999-108787021 AGGGGGCAACGGCTGACCCCGGG + Intergenic
1013615841 6:111842366-111842388 AGTGGGCATGGGCGGGTTGCAGG - Intronic
1013619331 6:111873035-111873057 AGGCGGCTCCGGGGGGTCCCCGG + Exonic
1019265932 7:117617-117639 CGGGGGGATCGGCGGCTGCCGGG - Intergenic
1019265946 7:117649-117671 CGGGGGGATCGGCGGCTCCCGGG - Intergenic
1019265960 7:117681-117703 CGGGGGGATCGGCGGCTCCCGGG - Intergenic
1019265974 7:117713-117735 CGGGGGGATCGGCGGCTCCCGGG - Intergenic
1019265988 7:117745-117767 CGGGGGGATCGGCGGCTCCCGGG - Intergenic
1019266002 7:117777-117799 CGGGGGGATCGGCGGCTCCCGGG - Intergenic
1019277281 7:182405-182427 CGGGGGGATCGGCGGCTCCCGGG - Intergenic
1019277295 7:182437-182459 CGGGGGGATCGGCGGCTCCCGGG - Intergenic
1019576018 7:1738007-1738029 TGGGGGCATCTGCCTGTCCCAGG - Intronic
1020252729 7:6483199-6483221 AGGAGGCCTCGGCGGTCCCCGGG + Intronic
1022136189 7:27451133-27451155 AGGGGGCATGTGGGGATCCCTGG + Intergenic
1023940377 7:44765503-44765525 AGGGGGCAGCGCCGGGGCCCAGG - Exonic
1025673548 7:63628358-63628380 AGGGGCCACAGGCTGGTCCCCGG - Intergenic
1029616953 7:101665106-101665128 AGGGGGCCTCTGCGGGACTCTGG - Intergenic
1031134791 7:117873206-117873228 AAGGGGCACCGGAGAGTCCCGGG + Intronic
1034344253 7:150376550-150376572 AGGGAGCAGGGGCGGGTCCTTGG + Intronic
1034558102 7:151862782-151862804 AGGGGGCACTGGTAGGTCCCTGG + Intronic
1034963202 7:155374872-155374894 AGGGGGCTTCCGTGGGTCCGCGG - Intergenic
1035298401 7:157880450-157880472 AGGGGGCACCGGCAGCTCCTGGG + Intronic
1037880779 8:22572465-22572487 AGGGGGCATCTCAGGGCCCCAGG + Intronic
1039193138 8:34999788-34999810 CGGGGGCACCGGGGGGTCGCAGG - Intergenic
1040289445 8:46116823-46116845 AGGTGGCATGGGCGGGCCCTTGG - Intergenic
1041044813 8:53879761-53879783 ACGGGACATTGGCGGCTCCCGGG + Intronic
1043512011 8:80959128-80959150 TGGTGGCAGCTGCGGGTCCCTGG - Intergenic
1049398953 8:142416306-142416328 ACGGCGGAGCGGCGGGTCCCCGG - Intergenic
1049564568 8:143331521-143331543 GGGGGGCATGGGCGGGTACACGG - Intronic
1049855362 8:144858358-144858380 AGTGGACCTCGGTGGGTCCCTGG - Intergenic
1049884237 9:17031-17053 AGGGGGCAATGCCGGGGCCCAGG + Intergenic
1053196047 9:36119799-36119821 AAGGGGAATCGGAGGGGCCCAGG + Intronic
1055069801 9:72154566-72154588 AGGGTGCATCTTTGGGTCCCAGG - Intronic
1057054251 9:91949318-91949340 TGGGGGCGCCGGCGGCTCCCGGG - Intronic
1058099922 9:100907671-100907693 AGGGGGCATCTGCAGCTGCCAGG + Intergenic
1060113940 9:120926473-120926495 AGGGGGCCACAGCTGGTCCCTGG + Intronic
1062318077 9:135978023-135978045 AGGGGGAATGGGGGTGTCCCAGG - Intergenic
1062596229 9:137301123-137301145 AGCCGGCATCGGCGCGTCCCGGG + Exonic
1203760998 EBV:12994-13016 AGGGTGCCTCCCCGGGTCCCAGG + Intergenic
1203761927 EBV:16066-16088 AGGGTGCCTCCCCGGGTCCCAGG + Intergenic
1203762856 EBV:19138-19160 AGGGTGCCTCCCCGGGTCCCAGG + Intergenic
1203763785 EBV:22210-22232 AGGGTGCCTCCCCGGGTCCCAGG + Intergenic
1203764714 EBV:25282-25304 AGGGTGCCTCCCCGGGTCCCAGG + Intergenic
1203765643 EBV:28354-28376 AGGGTGCCTCCCCGGGTCCCAGG + Intergenic
1203766572 EBV:31426-31448 AGGGTGCCTCCCCGGGTCCCAGG + Intergenic
1203767501 EBV:34498-34520 AGGGTGCCTCCCCGGGTCCCAGG + Intergenic
1198480163 X:137033720-137033742 AGGGGGCGTCGTGGGCTCCCAGG + Intergenic
1200257956 X:154594995-154595017 AGGTCGCATCGACGGGTCCTGGG - Intergenic
1200401565 X:156023125-156023147 AGGGGGCAATGCCGGGGCCCAGG - Intergenic