ID: 1179457437

View in Genome Browser
Species Human (GRCh38)
Location 21:41508677-41508699
Sequence TTTCCACCGGACGCTGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 64}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179457437_1179457452 17 Left 1179457437 21:41508677-41508699 CCCCCACCAGCGTCCGGTGGAAA 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1179457452 21:41508717-41508739 CCCAGGTCTCTCGGCACCACCGG 0: 1
1: 0
2: 1
3: 12
4: 146
1179457437_1179457454 22 Left 1179457437 21:41508677-41508699 CCCCCACCAGCGTCCGGTGGAAA 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG 0: 1
1: 0
2: 1
3: 4
4: 78
1179457437_1179457445 0 Left 1179457437 21:41508677-41508699 CCCCCACCAGCGTCCGGTGGAAA 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1179457445 21:41508700-41508722 GTGCTCCCCCGGATGGTCCCAGG 0: 1
1: 0
2: 2
3: 8
4: 97
1179457437_1179457444 -7 Left 1179457437 21:41508677-41508699 CCCCCACCAGCGTCCGGTGGAAA 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1179457444 21:41508693-41508715 GTGGAAAGTGCTCCCCCGGATGG 0: 1
1: 0
2: 1
3: 5
4: 96
1179457437_1179457456 26 Left 1179457437 21:41508677-41508699 CCCCCACCAGCGTCCGGTGGAAA 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1179457456 21:41508726-41508748 CTCGGCACCACCGGCCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 107
1179457437_1179457450 8 Left 1179457437 21:41508677-41508699 CCCCCACCAGCGTCCGGTGGAAA 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1179457450 21:41508708-41508730 CCGGATGGTCCCAGGTCTCTCGG 0: 1
1: 0
2: 0
3: 8
4: 123
1179457437_1179457457 27 Left 1179457437 21:41508677-41508699 CCCCCACCAGCGTCCGGTGGAAA 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1179457457 21:41508727-41508749 TCGGCACCACCGGCCAGGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1179457437_1179457455 23 Left 1179457437 21:41508677-41508699 CCCCCACCAGCGTCCGGTGGAAA 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1179457455 21:41508723-41508745 TCTCTCGGCACCACCGGCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179457437 Original CRISPR TTTCCACCGGACGCTGGTGG GGG (reversed) Intronic
907156099 1:52335651-52335673 TTTCCACCATACTCTGGTGTTGG + Intronic
908416465 1:63917790-63917812 TTGCCACCTGCCCCTGGTGGAGG + Intronic
912418697 1:109529158-109529180 TGTCCTCAGGCCGCTGGTGGAGG - Intergenic
914430782 1:147619152-147619174 TCGCCACTGGACACTGGTGGAGG - Exonic
915233189 1:154461325-154461347 CTTCCACAAGAAGCTGGTGGAGG + Intronic
916184907 1:162121526-162121548 TTTCCAGAGGAAGATGGTGGAGG + Intronic
920334971 1:205239033-205239055 TATCCCCGGGAGGCTGGTGGAGG - Intronic
921071380 1:211660989-211661011 TTTCCAGCGGGCCCTGATGGTGG - Intronic
1073438372 10:103536118-103536140 TTTCCAGCTGATCCTGGTGGGGG + Intronic
1077635954 11:3841251-3841273 CTTCCCGCGGAGGCTGGTGGGGG - Intergenic
1078420373 11:11206750-11206772 TTTCCACCAGGCGCTGAAGGTGG + Intergenic
1080685794 11:34513739-34513761 TTTCCACTGCACGCTGGTGCTGG - Intronic
1084757138 11:71246727-71246749 TATCCCCCGGAAGCTGGTGAGGG + Intronic
1085126364 11:74005286-74005308 TTTCCTCCGGACCCTGCTTGAGG + Intronic
1091301368 11:134510230-134510252 TCTCCACTGGACGCTGTCGGGGG - Intergenic
1094753309 12:33438938-33438960 GTTCCACCGGCCGCTGGTCCCGG - Intronic
1095980480 12:47971037-47971059 TTTCCACCTGACCCTAGTGCAGG + Intergenic
1103332577 12:120164470-120164492 GTACCACCGGGCTCTGGTGGCGG - Exonic
1108051172 13:46440625-46440647 CAGCCACCGGACACTGGTGGAGG + Intergenic
1109543727 13:63814245-63814267 CAGCCACCGGACACTGGTGGAGG + Intergenic
1112290492 13:98141786-98141808 TTTCCAGGGGCTGCTGGTGGTGG + Intergenic
1118046196 14:61974167-61974189 TTTCTGCCTGACCCTGGTGGTGG + Intergenic
1128585434 15:68845371-68845393 TTGCCACGGGATGCAGGTGGAGG - Intronic
1137083970 16:36099795-36099817 TTTCCACCTAACTGTGGTGGTGG + Intergenic
1142874453 17:2843053-2843075 ATTCCACCGGGGGCTGGTGTGGG + Intronic
1144794127 17:17879563-17879585 CTTCCACCGTACACTGTTGGAGG - Intronic
1146494358 17:33307702-33307724 TTTCCATTGCAAGCTGGTGGGGG + Intronic
1152199716 17:78938263-78938285 TTTCCCCCGGAGGCAGGTGGAGG + Intergenic
1152753964 17:82079220-82079242 TGACCACCGCACGCTGCTGGAGG - Exonic
1156910254 18:42403596-42403618 TTTCCAAGGGAAGCTGTTGGTGG - Intergenic
1160317917 18:77865697-77865719 GTTCCACCGGATTCTGCTGGTGG + Intergenic
1162833125 19:13299157-13299179 CTTGGACCGGCCGCTGGTGGTGG - Exonic
1168654677 19:58118429-58118451 GTGACACCGGACGCTGGGGGCGG + Intergenic
933348913 2:81127893-81127915 TTTCCATGGGACTGTGGTGGGGG - Intergenic
1171797782 20:29579839-29579861 TTACCTCCGGAATCTGGTGGAGG + Intergenic
1171972158 20:31571154-31571176 TTTCCATGGGACTCTGATGGTGG - Exonic
1172196070 20:33092448-33092470 TCTCCCCCAGACGCTGGTTGGGG + Exonic
1174515090 20:51085864-51085886 TTTCCACTGGAAGCTGTAGGGGG - Intergenic
1176069415 20:63218299-63218321 CCTCCACCGGAGGCTGGAGGAGG - Intergenic
1178855192 21:36244899-36244921 TGTAAACCGGACTCTGGTGGTGG + Intronic
1179457437 21:41508677-41508699 TTTCCACCGGACGCTGGTGGGGG - Intronic
956779000 3:72589754-72589776 TTCCCACCAGACGCTGGTTGAGG + Intergenic
961237680 3:125381742-125381764 TGAGCACCGGACGCTGGAGGAGG + Intergenic
962135022 3:132722992-132723014 AGTGGACCGGACGCTGGTGGAGG + Intergenic
962244888 3:133784205-133784227 CTTCTACCAGACGCTGGTGCTGG + Intronic
962620247 3:137170760-137170782 TTTACACTGGAGGCTGTTGGAGG + Intergenic
968298130 3:197593001-197593023 TTTCCACTGGAAGCAGCTGGGGG + Intergenic
968443806 4:638104-638126 GTTCCACCAAACGCTGGTGAGGG - Intronic
968999743 4:3970560-3970582 TTTCCAGCTGACACTGCTGGAGG - Intergenic
970430508 4:15984890-15984912 TTTCCACAGGCCGGGGGTGGAGG - Intronic
975728213 4:77313074-77313096 TTTCCAACTGACGCTTGTGTTGG - Intronic
978174760 4:105716682-105716704 TTTCCATGGGAGGTTGGTGGGGG - Intronic
980049113 4:128021252-128021274 TTTCCACCCAACATTGGTGGTGG + Intronic
985670180 5:1202922-1202944 TTTCCACTGGAGGCAGGTCGGGG + Intronic
990203704 5:53406377-53406399 ATTCCACCTGAAGTTGGTGGTGG - Intergenic
990548700 5:56850712-56850734 TTTCCATCGGAGGCTTGGGGAGG - Intronic
1001485814 5:172118987-172119009 TTTCCACTGGCTGTTGGTGGTGG + Intronic
1004860832 6:19803307-19803329 TTCCCACGGGTCGCTGCTGGTGG - Intergenic
1013137417 6:107295915-107295937 TTCCCACAGGATGATGGTGGTGG - Intronic
1018434994 6:163751533-163751555 TTTCCACGGGACCCAGGTGTCGG + Intergenic
1033420514 7:141200888-141200910 TTTCCACAGGGCGGTGCTGGAGG - Intronic
1039478516 8:37854810-37854832 TCCCCACCGGACGATGGTGGTGG + Intergenic
1043794608 8:84520829-84520851 TTTCCATAGGATGCAGGTGGTGG - Intronic
1045013799 8:97981491-97981513 TTTCCACTGCAAGCTGGTGAGGG + Intronic
1045290710 8:100830289-100830311 TTTCCACCAGTGGGTGGTGGAGG - Intergenic
1048405378 8:134114043-134114065 TTTCCTCTGGACTCTGGGGGAGG - Intergenic
1061898392 9:133660418-133660440 TTTCCCCAGGACCCTTGTGGGGG + Intergenic
1061990337 9:134155232-134155254 TTTGCACCTGGCGCTGATGGTGG + Intronic
1190261605 X:48801329-48801351 TTGCCACTGGACGTTGGTGGTGG - Intergenic
1190333247 X:49248397-49248419 TCTCCACCACAAGCTGGTGGGGG - Exonic