ID: 1179457440

View in Genome Browser
Species Human (GRCh38)
Location 21:41508680-41508702
Sequence CACTTTCCACCGGACGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 87}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179457440_1179457455 20 Left 1179457440 21:41508680-41508702 CCACCAGCGTCCGGTGGAAAGTG 0: 1
1: 0
2: 0
3: 2
4: 87
Right 1179457455 21:41508723-41508745 TCTCTCGGCACCACCGGCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1179457440_1179457454 19 Left 1179457440 21:41508680-41508702 CCACCAGCGTCCGGTGGAAAGTG 0: 1
1: 0
2: 0
3: 2
4: 87
Right 1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG 0: 1
1: 0
2: 1
3: 4
4: 78
1179457440_1179457445 -3 Left 1179457440 21:41508680-41508702 CCACCAGCGTCCGGTGGAAAGTG 0: 1
1: 0
2: 0
3: 2
4: 87
Right 1179457445 21:41508700-41508722 GTGCTCCCCCGGATGGTCCCAGG 0: 1
1: 0
2: 2
3: 8
4: 97
1179457440_1179457457 24 Left 1179457440 21:41508680-41508702 CCACCAGCGTCCGGTGGAAAGTG 0: 1
1: 0
2: 0
3: 2
4: 87
Right 1179457457 21:41508727-41508749 TCGGCACCACCGGCCAGGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1179457440_1179457450 5 Left 1179457440 21:41508680-41508702 CCACCAGCGTCCGGTGGAAAGTG 0: 1
1: 0
2: 0
3: 2
4: 87
Right 1179457450 21:41508708-41508730 CCGGATGGTCCCAGGTCTCTCGG 0: 1
1: 0
2: 0
3: 8
4: 123
1179457440_1179457452 14 Left 1179457440 21:41508680-41508702 CCACCAGCGTCCGGTGGAAAGTG 0: 1
1: 0
2: 0
3: 2
4: 87
Right 1179457452 21:41508717-41508739 CCCAGGTCTCTCGGCACCACCGG 0: 1
1: 0
2: 1
3: 12
4: 146
1179457440_1179457456 23 Left 1179457440 21:41508680-41508702 CCACCAGCGTCCGGTGGAAAGTG 0: 1
1: 0
2: 0
3: 2
4: 87
Right 1179457456 21:41508726-41508748 CTCGGCACCACCGGCCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 107
1179457440_1179457444 -10 Left 1179457440 21:41508680-41508702 CCACCAGCGTCCGGTGGAAAGTG 0: 1
1: 0
2: 0
3: 2
4: 87
Right 1179457444 21:41508693-41508715 GTGGAAAGTGCTCCCCCGGATGG 0: 1
1: 0
2: 1
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179457440 Original CRISPR CACTTTCCACCGGACGCTGG TGG (reversed) Intronic
900706703 1:4085249-4085271 CACTTTCCAATGGAAGCTGGGGG + Intergenic
901955404 1:12781453-12781475 CACTTTCCACTGAAACCTGGTGG + Intergenic
901978768 1:13017504-13017526 CACTTTCCACTGAAACCTGGTGG + Intronic
902003313 1:13211434-13211456 CACTTTCCACTGAAACCTGGTGG - Intergenic
902022537 1:13357185-13357207 CACTTTCCACTGAAACCTGGTGG - Intergenic
915402194 1:155631488-155631510 CACTTTCCACTGAAACCTGGTGG + Intergenic
916009903 1:160695177-160695199 CACTTTCCACTGAAACCTGGTGG - Intronic
918627596 1:186675386-186675408 TACTTTCCACAGGTTGCTGGTGG - Exonic
920511737 1:206557060-206557082 CACTTGCCACCGGGGGCGGGTGG + Intronic
922958669 1:229626186-229626208 CTCCTTCCGCCGGACGCCGGCGG - Intergenic
1063000413 10:1913236-1913258 CACTCTCCACTGGACTCAGGTGG + Intergenic
1063193752 10:3720733-3720755 CACTCTGCACAGGGCGCTGGAGG + Intergenic
1063530744 10:6829284-6829306 CACTTTCCACTGAAACCTGGTGG + Intergenic
1068590978 10:58852792-58852814 CATTTTCCACAGCAGGCTGGAGG - Intergenic
1072947591 10:99824573-99824595 CACTTTCCACTGAAACCTGGTGG + Intronic
1073379323 10:103066055-103066077 CACTGACCACAGGCCGCTGGGGG - Intronic
1076877056 10:133221104-133221126 CACTTTCCACCCCACCCTGAGGG + Intronic
1077037630 11:502982-503004 CACTTTCCCCAGGCCCCTGGCGG - Exonic
1082969151 11:59000634-59000656 CACTTTCCACTGAAACCTGGTGG - Intronic
1083394208 11:62378444-62378466 CACTTTCCACTGAAATCTGGTGG + Intronic
1083421045 11:62553469-62553491 CTCTTTCCCCAGGAAGCTGGGGG - Intronic
1086550906 11:88050506-88050528 CACTTTCCACTGGAAGGTGAAGG + Intergenic
1087724237 11:101699398-101699420 CACTTTCCACTGAAACCTGGTGG - Intronic
1089282802 11:117386197-117386219 CACTTTCCACCGTAAGATTGAGG + Intronic
1089471603 11:118725822-118725844 CACTTTCCACTGAAACCTGGTGG + Intergenic
1090474029 11:127003783-127003805 CACTTGGCACCGGAGGCTTGGGG - Intergenic
1094154998 12:27330113-27330135 CACCCTCCACAGGATGCTGGGGG + Intergenic
1097330943 12:58332558-58332580 CACTTTCCACTGAAACCTGGTGG + Intergenic
1102871236 12:116415907-116415929 CACTTTCGGCTGGATGCTGGGGG + Intergenic
1105055392 12:133094280-133094302 CACTTTCCACTGAAATCTGGTGG + Intronic
1105702385 13:22943178-22943200 CACGTTCCAGCAGGCGCTGGAGG - Intergenic
1115855173 14:37622714-37622736 CACTTTCCTCCGCCCGCTGCTGG - Intronic
1119669883 14:76510274-76510296 CAATTTCCAGAGGAAGCTGGGGG - Intergenic
1125505806 15:40266925-40266947 CACTATCAACAGGATGCTGGAGG - Intronic
1139215727 16:65122932-65122954 CACACTCCACCGGGCCCTGGCGG - Intronic
1140244185 16:73233259-73233281 CTCTTTCCTCTGGACTCTGGTGG - Intergenic
1140824619 16:78694284-78694306 CACTTTCCACAGGTCTCTGGGGG - Intronic
1144885631 17:18457415-18457437 CATCTTCCACCGGAAGGTGGAGG + Intergenic
1145146584 17:20486956-20486978 CATCTTCCACCGGAAGGTGGAGG - Intergenic
1150311657 17:64133699-64133721 CAGTTTCCACCGTACACTGAAGG + Intergenic
1152407862 17:80107826-80107848 CCCTTTCTACCTGGCGCTGGAGG + Intergenic
1158696606 18:59709320-59709342 CACTTGCCACAGGTTGCTGGTGG - Intergenic
1163103395 19:15110224-15110246 CACCTTCCACCTGGAGCTGGAGG + Exonic
1163397099 19:17070038-17070060 CTCTCTCCACCAGATGCTGGAGG + Intronic
1163920197 19:20281010-20281032 CACTTTCCACTGCAACCTGGTGG - Intergenic
1164370833 19:27643054-27643076 CACTTTCCACTGAAACCTGGTGG + Intergenic
1165606661 19:37111716-37111738 CACTTTCCACTGAAACCTGGTGG + Intronic
1165718940 19:38064965-38064987 CACTTATCACCAGATGCTGGAGG - Intronic
941043440 2:160648337-160648359 CACTTCCCACTGCATGCTGGGGG + Intergenic
1170323131 20:15123397-15123419 CAGTTTCCACAGGAGGCTAGTGG - Intronic
1179457440 21:41508680-41508702 CACTTTCCACCGGACGCTGGTGG - Intronic
1180838248 22:18943009-18943031 CACTTTCCACTGAAACCTGGTGG - Intergenic
1183038705 22:35160050-35160072 CACTTTCCCCCGGGAGGTGGAGG + Intergenic
1185134650 22:49062743-49062765 CACCTTCTGACGGACGCTGGTGG + Intergenic
1185312580 22:50164522-50164544 CACTCCCCACCGGACACCGGGGG + Intergenic
1185369695 22:50455358-50455380 CCCCTTCTACCGCACGCTGGAGG - Exonic
950462882 3:13135690-13135712 CACTGTGCACAGGACACTGGAGG + Intergenic
960027824 3:113029087-113029109 CACTTTCCACTGAAACCTGGTGG + Intergenic
961297198 3:125894629-125894651 CACTTTCCACTGAAACCTGGTGG - Intergenic
963695697 3:148564219-148564241 CACTTTCCACTGAAACCTGGTGG + Intergenic
963748774 3:149152634-149152656 CACTTTCAACCAGACTCTTGAGG - Intronic
967026256 3:185567370-185567392 CACTTTCCACTGAAACCTGGTGG + Intergenic
967896373 3:194399297-194399319 CACTTTCCACAGGAAGAGGGTGG + Intergenic
968396702 4:244876-244898 CACTTTCCACTGAATTCTGGTGG - Intergenic
969001042 4:3982519-3982541 CACTTTCCAATGAAAGCTGGTGG + Intergenic
980049112 4:128021249-128021271 CACTTTCCACCCAACATTGGTGG + Intronic
985461432 4:190111168-190111190 CACTTTCCACTGAAATCTGGTGG + Intergenic
988380406 5:30491755-30491777 CACTTTCCACTGAAACCTGGTGG + Intergenic
989836874 5:46004845-46004867 CACTTTCCACTGAAACCTGGTGG + Intergenic
997748911 5:136325930-136325952 CCCTTTCCATCTGACACTGGTGG - Intronic
998295965 5:140968728-140968750 CACTTTCAACCTGACCGTGGTGG + Exonic
999234082 5:150080059-150080081 CACTTTCAGCCGGATGCTGATGG + Exonic
999752544 5:154640193-154640215 CACTTTCCACTGAAACCTGGTGG + Intergenic
999952101 5:156662528-156662550 CACTTTCCACTGAAACCTGGTGG + Intronic
1005729930 6:28686840-28686862 CACTTTCCACTGAAACCTGGTGG - Intergenic
1007571908 6:42898830-42898852 CACTTTCCACTGAAACCTGGTGG + Intergenic
1010591879 6:77722017-77722039 CACTTTCCACTGAAACCTGGTGG + Intronic
1015955770 6:138596374-138596396 TAATTTCCACATGACGCTGGAGG - Intronic
1016840325 6:148518771-148518793 ACCTTTCCACCGGGCTCTGGAGG + Intronic
1019976556 7:4587540-4587562 CACTTTCCACTGAAACCTGGTGG + Intergenic
1019977492 7:4596044-4596066 CACTTTCCACTGAAACCTGGTGG + Intergenic
1029966846 7:104749431-104749453 CACTTTCCACTGAAACCTGGTGG + Intronic
1033482082 7:141752633-141752655 CACTTTCCACTGAAACCTGGTGG + Intronic
1036292103 8:7502989-7503011 CACTTTCCACTGAAACCTGGTGG + Intronic
1047797188 8:128269517-128269539 CAATTTCAACAGGACTCTGGAGG - Intergenic
1051360413 9:16277093-16277115 CACTTTCTCCCGGAGGCTGCAGG - Intergenic
1060400544 9:123346323-123346345 CCCTGTCCACCGGCTGCTGGCGG + Intergenic
1062487087 9:136784169-136784191 CACTTTCCACTGAAACCTGGTGG + Intergenic
1200257374 X:154590835-154590857 CACTTTCCACTGAAACCTGGTGG - Intergenic
1200260396 X:154613567-154613589 CACTTTCCACTGAAACCTGGTGG + Intergenic