ID: 1179457441

View in Genome Browser
Species Human (GRCh38)
Location 21:41508683-41508705
Sequence GAGCACTTTCCACCGGACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 27}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179457441_1179457454 16 Left 1179457441 21:41508683-41508705 CCAGCGTCCGGTGGAAAGTGCTC 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG 0: 1
1: 0
2: 1
3: 4
4: 78
1179457441_1179457459 28 Left 1179457441 21:41508683-41508705 CCAGCGTCCGGTGGAAAGTGCTC 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1179457459 21:41508734-41508756 CACCGGCCAGGGCGGGAGTGAGG 0: 1
1: 0
2: 1
3: 25
4: 293
1179457441_1179457450 2 Left 1179457441 21:41508683-41508705 CCAGCGTCCGGTGGAAAGTGCTC 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1179457450 21:41508708-41508730 CCGGATGGTCCCAGGTCTCTCGG 0: 1
1: 0
2: 0
3: 8
4: 123
1179457441_1179457455 17 Left 1179457441 21:41508683-41508705 CCAGCGTCCGGTGGAAAGTGCTC 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1179457455 21:41508723-41508745 TCTCTCGGCACCACCGGCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1179457441_1179457457 21 Left 1179457441 21:41508683-41508705 CCAGCGTCCGGTGGAAAGTGCTC 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1179457457 21:41508727-41508749 TCGGCACCACCGGCCAGGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1179457441_1179457456 20 Left 1179457441 21:41508683-41508705 CCAGCGTCCGGTGGAAAGTGCTC 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1179457456 21:41508726-41508748 CTCGGCACCACCGGCCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 107
1179457441_1179457452 11 Left 1179457441 21:41508683-41508705 CCAGCGTCCGGTGGAAAGTGCTC 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1179457452 21:41508717-41508739 CCCAGGTCTCTCGGCACCACCGG 0: 1
1: 0
2: 1
3: 12
4: 146
1179457441_1179457445 -6 Left 1179457441 21:41508683-41508705 CCAGCGTCCGGTGGAAAGTGCTC 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1179457445 21:41508700-41508722 GTGCTCCCCCGGATGGTCCCAGG 0: 1
1: 0
2: 2
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179457441 Original CRISPR GAGCACTTTCCACCGGACGC TGG (reversed) Intronic
900208216 1:1440501-1440523 GAGCACTTCCCAGGGGCCGCAGG + Exonic
903441806 1:23393924-23393946 GAGCACGTTCCGCCGCAGGCCGG + Exonic
922958670 1:229626189-229626211 GCGCTCCTTCCGCCGGACGCCGG - Intergenic
923014241 1:230113568-230113590 GAGCACTTTGCATGGGACACTGG - Intronic
1089723839 11:120455242-120455264 GAGCCCTTTCCACCTGAAGATGG - Intronic
1091141555 11:133239517-133239539 AAGCACTTTGCACCTGAGGCTGG - Intronic
1096747682 12:53739131-53739153 GACCACTTTCCACCCTACCCAGG - Intergenic
1104926219 12:132315263-132315285 GAGCACTTTGCAGTGGACACAGG - Intronic
1104926239 12:132315369-132315391 GAGCACTTTGCAGTGGACACGGG - Intronic
1114682684 14:24499445-24499467 GAGCACATTCCCCAGGAAGCAGG - Intergenic
1147440139 17:40443018-40443040 GAGCCCTTTCCACCGCACCCCGG - Intergenic
946290211 2:218738773-218738795 GAGGACATTCCACTGGAAGCTGG - Exonic
1168853443 20:992457-992479 GAGCACTTTCAAACAGAGGCAGG + Intronic
1168890716 20:1294022-1294044 GAGGACTTTCCAGCAGAGGCAGG - Intronic
1175456756 20:59121239-59121261 GAGCACTTTCCAGAGGGAGCAGG + Intergenic
1175680777 20:60986964-60986986 GAGCACTTCCCACAGGCCACAGG - Intergenic
1179457441 21:41508683-41508705 GAGCACTTTCCACCGGACGCTGG - Intronic
1184086515 22:42269496-42269518 GTGCACTGTCCTCTGGACGCCGG - Intronic
955448725 3:59043414-59043436 GAGAACTGTCCACCGGATTCAGG + Intronic
962327926 3:134451176-134451198 GACCACTTTCCAAGGGACTCTGG - Intergenic
985670177 5:1202916-1202938 CTGCACTTTCCACTGGAGGCAGG + Intronic
991449687 5:66738694-66738716 GAGCACTTTCAACCGGGAGGAGG - Intronic
994877749 5:105447156-105447178 GAGCACTTCCCACCTGCCACTGG - Intergenic
1001652800 5:173327711-173327733 GCGCGCTTTGCACCGGACCCGGG + Intronic
1007842837 6:44730762-44730784 GTGCCCTTTCCACTGGAGGCTGG + Intergenic
1021941047 7:25679272-25679294 GGGCACATTCCACAGGACACTGG + Intergenic
1035157966 7:156929630-156929652 GTTCACTTTCCACCTGACTCTGG - Intergenic
1047403817 8:124568501-124568523 GAGCACTGTCCAACTGAGGCTGG + Exonic
1198721441 X:139625447-139625469 GAGCACTGTACTCTGGACGCGGG - Intronic