ID: 1179457443

View in Genome Browser
Species Human (GRCh38)
Location 21:41508690-41508712
Sequence TCCGGGGGAGCACTTTCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 75}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179457443_1179457463 30 Left 1179457443 21:41508690-41508712 CCGGTGGAAAGTGCTCCCCCGGA 0: 1
1: 0
2: 1
3: 2
4: 75
Right 1179457463 21:41508743-41508765 GGGCGGGAGTGAGGAAGTGGTGG 0: 1
1: 0
2: 16
3: 191
4: 1861
1179457443_1179457452 4 Left 1179457443 21:41508690-41508712 CCGGTGGAAAGTGCTCCCCCGGA 0: 1
1: 0
2: 1
3: 2
4: 75
Right 1179457452 21:41508717-41508739 CCCAGGTCTCTCGGCACCACCGG 0: 1
1: 0
2: 1
3: 12
4: 146
1179457443_1179457462 27 Left 1179457443 21:41508690-41508712 CCGGTGGAAAGTGCTCCCCCGGA 0: 1
1: 0
2: 1
3: 2
4: 75
Right 1179457462 21:41508740-41508762 CCAGGGCGGGAGTGAGGAAGTGG 0: 1
1: 1
2: 2
3: 60
4: 869
1179457443_1179457457 14 Left 1179457443 21:41508690-41508712 CCGGTGGAAAGTGCTCCCCCGGA 0: 1
1: 0
2: 1
3: 2
4: 75
Right 1179457457 21:41508727-41508749 TCGGCACCACCGGCCAGGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1179457443_1179457459 21 Left 1179457443 21:41508690-41508712 CCGGTGGAAAGTGCTCCCCCGGA 0: 1
1: 0
2: 1
3: 2
4: 75
Right 1179457459 21:41508734-41508756 CACCGGCCAGGGCGGGAGTGAGG 0: 1
1: 0
2: 1
3: 25
4: 293
1179457443_1179457450 -5 Left 1179457443 21:41508690-41508712 CCGGTGGAAAGTGCTCCCCCGGA 0: 1
1: 0
2: 1
3: 2
4: 75
Right 1179457450 21:41508708-41508730 CCGGATGGTCCCAGGTCTCTCGG 0: 1
1: 0
2: 0
3: 8
4: 123
1179457443_1179457456 13 Left 1179457443 21:41508690-41508712 CCGGTGGAAAGTGCTCCCCCGGA 0: 1
1: 0
2: 1
3: 2
4: 75
Right 1179457456 21:41508726-41508748 CTCGGCACCACCGGCCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 107
1179457443_1179457454 9 Left 1179457443 21:41508690-41508712 CCGGTGGAAAGTGCTCCCCCGGA 0: 1
1: 0
2: 1
3: 2
4: 75
Right 1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG 0: 1
1: 0
2: 1
3: 4
4: 78
1179457443_1179457455 10 Left 1179457443 21:41508690-41508712 CCGGTGGAAAGTGCTCCCCCGGA 0: 1
1: 0
2: 1
3: 2
4: 75
Right 1179457455 21:41508723-41508745 TCTCTCGGCACCACCGGCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179457443 Original CRISPR TCCGGGGGAGCACTTTCCAC CGG (reversed) Intronic
901681573 1:10915883-10915905 TTCAGGGGAGCCCTTTCCACTGG - Intergenic
903287606 1:22286566-22286588 TCTGGGGGAGCACAATCTACAGG - Intergenic
907069028 1:51518352-51518374 TCCCGGGGAGCACTTTTCTTGGG - Intronic
910678542 1:89839703-89839725 TCCGGGGTAGCACATGCAACAGG - Intronic
913199224 1:116482625-116482647 TGAGGTGCAGCACTTTCCACAGG + Intergenic
913376557 1:118158908-118158930 TCTAGGGGAGCCTTTTCCACTGG - Intronic
913943546 1:125134609-125134631 TCCTGGGGAAAACTCTCCACTGG - Intergenic
922972910 1:229758151-229758173 CCCGGAGGAGCACTGTCCAATGG + Intergenic
1066221087 10:33336386-33336408 TCCGTGGGTGCACCTCCCACTGG - Intergenic
1066779082 10:38923585-38923607 TCCTGGGGAAAACTCTCCACCGG - Intergenic
1071431284 10:85609040-85609062 TCCGAGGTAGCATTTTCCAGAGG - Intronic
1075784214 10:125037801-125037823 TCAGGGGCAGCACTTTACTCTGG - Intronic
1076426159 10:130369165-130369187 TCCGGGAATGCACTTTCCCCAGG - Intergenic
1077466090 11:2734413-2734435 GTCGGGGGAGCACTGTCCCCGGG + Intronic
1081440718 11:43077955-43077977 TCAGGGGAAGCCCTTTCCCCGGG - Intergenic
1082867850 11:57916272-57916294 TCCTGTGGAGCAGTTTCCCCAGG + Intergenic
1083245980 11:61428906-61428928 TCCTGGGGAGTAAATTCCACAGG + Intronic
1091400695 12:178972-178994 TGCGGGGGAGGACATCCCACTGG + Intergenic
1112328529 13:98459862-98459884 GCCACGGGAGCACTTTCCTCTGG + Intronic
1113881909 13:113631740-113631762 GCCGGGTGAGCACTTCCCTCTGG + Exonic
1121324877 14:93014006-93014028 TGCGGGGCTGCACTTTCCAGAGG - Intronic
1128919762 15:71599624-71599646 GCCAGGGGAGCACATACCACGGG - Intronic
1139488208 16:67271245-67271267 ACCCAGGGAGCACTTCCCACAGG - Exonic
1145708382 17:26944264-26944286 TCCTGGGGAAAACTCTCCACCGG - Intergenic
1150974911 17:70074558-70074580 TCCTGGAGAGCACTGACCACGGG + Intronic
1153227143 18:2907592-2907614 TCATGGGGAGCACTTCCCAGTGG - Intronic
1160756506 19:759995-760017 CCGGGAGGAGCACTGTCCACTGG - Exonic
1161154676 19:2726569-2726591 TCTGGGGCAGCAGTTCCCACGGG + Intronic
1161694452 19:5758210-5758232 TGCGTGGGGGCAGTTTCCACAGG + Intronic
1163485226 19:17581412-17581434 TCCCGGGCAGCACTGTCCAGTGG - Exonic
1166117301 19:40663662-40663684 TCCCGGGGAGGACCTCCCACAGG - Intergenic
927128496 2:20036113-20036135 TCCGGGGGAGAAATTTCAAGTGG - Intronic
935211929 2:100945806-100945828 TCCTGGGGAACAATTTCCAGAGG - Intronic
936027849 2:109047056-109047078 TCGGTGGGAGGACTTCCCACTGG - Intergenic
946727109 2:222671702-222671724 TCCGGCCGGGCACTTCCCACAGG + Intergenic
946788520 2:223274393-223274415 TCAGTGGAAGCACTTCCCACTGG - Intergenic
1171411787 20:24952705-24952727 TCAGGGGGTGCCCTTTCCATGGG - Intronic
1171721805 20:28570751-28570773 TCCATGGGAGCAGTTTCCAGTGG + Intergenic
1171862245 20:30411825-30411847 TCCATGGGAGCAGTTTCCAGTGG - Intergenic
1179457443 21:41508690-41508712 TCCGGGGGAGCACTTTCCACCGG - Intronic
1180295359 22:10929440-10929462 TCCATGGGAGCAGTTTCCAGTGG + Intergenic
1180413309 22:12636607-12636629 TCCATGGGAGCAGTTTCCAGTGG - Intergenic
1182323122 22:29491214-29491236 TGCCAGGGCGCACTTTCCACTGG + Exonic
1183719369 22:39553405-39553427 CCCGGTGGAGCACATTCCTCTGG - Intergenic
1184130496 22:42514211-42514233 TCCGGGGGAGCACAGGCCGCCGG + Exonic
1184140672 22:42576033-42576055 TCCGGGGGAGCACAGGCCGCCGG + Intergenic
1184153183 22:42649933-42649955 TCCGGGAGCGCACAGTCCACTGG - Intergenic
1184611783 22:45608637-45608659 TCAGGGGAAGCAGTTTCAACTGG - Intergenic
1184669686 22:46006205-46006227 GGGAGGGGAGCACTTTCCACTGG + Intergenic
1184872200 22:47247901-47247923 TCCGGGTGAGCAGGTTCAACAGG + Intergenic
1203290783 22_KI270735v1_random:36257-36279 TCCTGGGGAAAACTCTCCACCGG + Intergenic
953882247 3:46696664-46696686 TCCAGGAGAGAACATTCCACAGG + Intergenic
957549927 3:81691009-81691031 TCCTGTGGAGCACTGTACACAGG + Intronic
961754746 3:129121245-129121267 TCCGAGGGAGCGCCTTCCAGGGG + Intronic
962176164 3:133157843-133157865 ACCGGGGGAGCTCATTCCCCTGG - Intronic
967129876 3:186460521-186460543 TCGGGGGAAGCCCTTTCCAAAGG + Intergenic
968625054 4:1623287-1623309 TCCTGGGCAGCACCTTCCTCAGG + Intronic
972275650 4:37555143-37555165 TCCTAGGAAGCACTTACCACTGG + Intronic
988413918 5:30921421-30921443 TGGAGTGGAGCACTTTCCACTGG + Intergenic
992888234 5:81180596-81180618 ACCCTGGGAGCACTTTTCACAGG + Intronic
1000961388 5:167605502-167605524 TCCAGGGGAACACTTCTCACTGG - Intronic
1001215025 5:169848023-169848045 TCCTGGGGAACAATTTCCTCAGG + Intronic
1001659529 5:173380417-173380439 TCCAGGGGAGTACTGGCCACTGG - Intergenic
1005312240 6:24569960-24569982 TCCAGGGTAGCACTTTCCACTGG + Exonic
1012903680 6:105038379-105038401 TCGGAGGCAGCAGTTTCCACAGG - Intronic
1023738052 7:43251951-43251973 TCTGGGGGGGTACATTCCACGGG + Intronic
1024243686 7:47454133-47454155 TCTGGGGGCGCCCATTCCACTGG + Intronic
1034946132 7:155263154-155263176 TCGGGGTGAGCACTTCCCTCTGG + Intergenic
1034946176 7:155263298-155263320 TCAGGGTGAGCACTTCCCTCTGG + Intergenic
1048045021 8:130765084-130765106 TCCCGGTGTGCACTTTCCACTGG + Intergenic
1052982506 9:34459179-34459201 TCAGTGGGAGCACTTACCAGAGG - Intronic
1060212856 9:121721065-121721087 TCCTGGGGATCACTGTCCATGGG + Intronic
1060783819 9:126433411-126433433 TCTGGGGGAGCCCTTGGCACTGG + Intronic
1061118547 9:128629347-128629369 TCCTGGGGGGCATTTTCCCCGGG + Intronic
1061845795 9:133387321-133387343 GCCGTGGGAGCACTGCCCACTGG - Intronic
1202802237 9_KI270720v1_random:10541-10563 TCCATGGGAGCAGTTTCCAGTGG + Intergenic
1186501101 X:10051249-10051271 TCTGGGGCAGCACTGTCCAATGG - Intronic
1187039269 X:15576322-15576344 TCCTGGAGGGCACTATCCACTGG + Intronic
1189566723 X:42249407-42249429 TCAGGGGGAGCACGGTACACAGG - Intergenic