ID: 1179457446

View in Genome Browser
Species Human (GRCh38)
Location 21:41508705-41508727
Sequence AGAGACCTGGGACCATCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 114}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179457446_1179457462 12 Left 1179457446 21:41508705-41508727 CCCCCGGATGGTCCCAGGTCTCT 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1179457462 21:41508740-41508762 CCAGGGCGGGAGTGAGGAAGTGG 0: 1
1: 1
2: 2
3: 60
4: 869
1179457446_1179457454 -6 Left 1179457446 21:41508705-41508727 CCCCCGGATGGTCCCAGGTCTCT 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG 0: 1
1: 0
2: 1
3: 4
4: 78
1179457446_1179457457 -1 Left 1179457446 21:41508705-41508727 CCCCCGGATGGTCCCAGGTCTCT 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1179457457 21:41508727-41508749 TCGGCACCACCGGCCAGGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1179457446_1179457464 16 Left 1179457446 21:41508705-41508727 CCCCCGGATGGTCCCAGGTCTCT 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1179457464 21:41508744-41508766 GGCGGGAGTGAGGAAGTGGTGGG 0: 1
1: 0
2: 3
3: 48
4: 574
1179457446_1179457456 -2 Left 1179457446 21:41508705-41508727 CCCCCGGATGGTCCCAGGTCTCT 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1179457456 21:41508726-41508748 CTCGGCACCACCGGCCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 107
1179457446_1179457463 15 Left 1179457446 21:41508705-41508727 CCCCCGGATGGTCCCAGGTCTCT 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1179457463 21:41508743-41508765 GGGCGGGAGTGAGGAAGTGGTGG 0: 1
1: 0
2: 16
3: 191
4: 1861
1179457446_1179457455 -5 Left 1179457446 21:41508705-41508727 CCCCCGGATGGTCCCAGGTCTCT 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1179457455 21:41508723-41508745 TCTCTCGGCACCACCGGCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1179457446_1179457459 6 Left 1179457446 21:41508705-41508727 CCCCCGGATGGTCCCAGGTCTCT 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1179457459 21:41508734-41508756 CACCGGCCAGGGCGGGAGTGAGG 0: 1
1: 0
2: 1
3: 25
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179457446 Original CRISPR AGAGACCTGGGACCATCCGG GGG (reversed) Intronic
900619804 1:3581495-3581517 AGGGACCGGGGACCAACCCGGGG + Intronic
902871363 1:19315503-19315525 AGAGACCAGGGAGCACCGGGAGG - Intronic
903261820 1:22135755-22135777 AGAGACCTAGGACCATGCTAAGG - Intronic
904305170 1:29584174-29584196 AGAGACCTGGGAAAATCCACTGG + Intergenic
904481684 1:30797891-30797913 AGAGTCCTGGGAGGATCAGGAGG + Intergenic
905253307 1:36664169-36664191 AGGGCCCTGGGACCATGGGGAGG + Intergenic
910647541 1:89529970-89529992 GGAGATCTGGGACCATACTGGGG + Intronic
912625592 1:111203084-111203106 AGAGGCCTGGGACCGTGCAGTGG - Intronic
912680090 1:111723496-111723518 AGATACCTGGGCCAATCAGGTGG + Exonic
912879036 1:113390695-113390717 TGAGCCCAGGGACCAGCCGGCGG + Intergenic
917444827 1:175098453-175098475 AGAGACCAGGGAGGTTCCGGTGG + Exonic
917447278 1:175117063-175117085 AGAGACCAGGGAGGTTCCGGTGG + Exonic
917448048 1:175123521-175123543 AGAGACCAGGGAGGTTCCGGTGG + Exonic
919899682 1:202034768-202034790 AGGGCCCTGGGACCAGCTGGTGG + Intergenic
922661604 1:227435178-227435200 AGAGAGCTGGGACCAACAGATGG - Intergenic
1067558676 10:47289417-47289439 AGAGACCAGGGAGCATCCTGGGG - Intergenic
1072429079 10:95355629-95355651 AGTGAACTGGCACCATCCCGTGG - Intronic
1072982787 10:100113713-100113735 AGAGACCAGGGACCATCACATGG - Intergenic
1074983227 10:118636029-118636051 AGAGACCTGGGAGCTCCAGGGGG - Intergenic
1076138766 10:128063437-128063459 AGAGCCATGGGGCCAGCCGGGGG - Intronic
1077480668 11:2812949-2812971 AGAGACCTGAGGCCATGAGGGGG - Intronic
1077502929 11:2917330-2917352 ACCCACCTGGGACCATCCTGGGG + Intronic
1082847190 11:57735868-57735890 AGAGACCAGTGACCATGCAGTGG - Intronic
1083208992 11:61170945-61170967 AGAGCCCTCGGACCAGCTGGAGG + Intergenic
1085809431 11:79667100-79667122 ACAGACCAGGGACCATAAGGAGG + Intergenic
1087502929 11:98982114-98982136 AGGGACCTGGGAACCTCAGGTGG + Intergenic
1088369339 11:109072302-109072324 AGAGACCTGGGACTATGTGGGGG + Intergenic
1089847708 11:121471418-121471440 GCAGACCTGGGACCAGCCGTTGG - Intronic
1090401946 11:126454574-126454596 AGAGACCTGGGAGCAGACAGAGG + Intronic
1091087546 11:132736821-132736843 TCAGAGCTGGGACCACCCGGTGG + Intronic
1098217428 12:68235095-68235117 AGAGAGCAGGTACCATCCAGAGG - Intergenic
1101676242 12:106919380-106919402 AGAGAACTGTGACCTTTCGGAGG + Intergenic
1103903644 12:124316271-124316293 AGAGGCCTGGGACCTACCTGGGG + Intergenic
1107123471 13:36819636-36819658 AGACACTTCGGACCCTCCGGGGG + Exonic
1113830121 13:113289121-113289143 AGACACCTGGGTTCATCCTGAGG + Intergenic
1115485935 14:33911425-33911447 CGAGCCCTGGGTCCATCCCGTGG + Intergenic
1118501090 14:66363325-66363347 AGACACCTGGGACCAGCCAAGGG + Intergenic
1120223834 14:81767502-81767524 AGAGACCAGGGACCATGGAGTGG + Intergenic
1125712703 15:41799738-41799760 AGGTACTTGGGACCATCCTGAGG - Intronic
1126432579 15:48601911-48601933 AGATACCTGGGGCCATGCTGAGG - Intronic
1127581635 15:60343922-60343944 AGAGTCCTGGGAGCAGCAGGAGG + Intergenic
1128066913 15:64770857-64770879 AGAGCCCTGGGACCACTGGGTGG - Intronic
1128628922 15:69243240-69243262 GGAGACCTGAGACCACCTGGTGG - Intronic
1128716827 15:69914600-69914622 AGAGAGCTGGGACCTCCCAGTGG - Intergenic
1129771360 15:78205333-78205355 AGAGATCTGGGAGCCTCCGAGGG + Intronic
1130286687 15:82561278-82561300 AGAGACCTGGGACAATGAGTAGG + Intronic
1130406843 15:83610141-83610163 AAAGGCCTGGGAGCATCCTGAGG + Intronic
1131335187 15:91542259-91542281 AGAGACCTGGGACCCACAGAAGG - Intergenic
1132732630 16:1370345-1370367 AGCGACCTGGGACCTGGCGGGGG + Intronic
1134368089 16:13597791-13597813 AGAGCCCTGGGACCTTCCAAAGG - Intergenic
1136551720 16:30985623-30985645 AGAGACCTTGGCTCATCCAGGGG - Intronic
1136690715 16:32026101-32026123 AGACACCTGGGACCCACAGGTGG - Intergenic
1136791301 16:32969662-32969684 AGACACCTGGGACCCACAGGTGG - Intergenic
1136878513 16:33884270-33884292 AGACACCTGGGACCCACAGGTGG + Intergenic
1138083674 16:54115185-54115207 AGAGACCTGGGACCACAGGGAGG - Exonic
1139001417 16:62515131-62515153 ACACACCAGGGACCATACGGGGG - Intergenic
1141170419 16:81687257-81687279 TGAGACCTGGGCCCCTCCTGGGG + Intronic
1203093510 16_KI270728v1_random:1231124-1231146 AGACACCTGGGACCCACAGGTGG - Intergenic
1142832587 17:2560178-2560200 AGATAGCTGGGACCAGCCTGAGG + Intergenic
1143125370 17:4638463-4638485 AGAGACTTGGGTCCCTCTGGTGG - Intronic
1143403132 17:6658646-6658668 AGAGACTTGGGTCCCTCTGGTGG + Intergenic
1145737107 17:27240676-27240698 AGAGGGCTGAGACCATCCTGAGG - Intergenic
1147153579 17:38532244-38532266 AGACACCTGGGACCCGCAGGTGG - Exonic
1148857537 17:50586946-50586968 AGAGACCTGGGACCTCTGGGTGG + Intronic
1149153723 17:53600867-53600889 AGAGACTTGGGACCCTGAGGTGG - Intergenic
1151491509 17:74434347-74434369 ATGCACCTGGGACCATCCAGAGG + Intronic
1152868505 17:82738036-82738058 AGAGGGCTGGGCCCATCAGGCGG - Intronic
1157451966 18:47795595-47795617 GGAGACCAGGGACCTTCCTGAGG - Intergenic
1158963138 18:62602841-62602863 AGAGCCCTGGGCCACTCCGGGGG + Intergenic
1161373958 19:3929357-3929379 AGGGACCTGGGGCCTTCCTGGGG + Intergenic
1163246912 19:16101776-16101798 AGAGACCAGGGACCATCACATGG + Exonic
1163507876 19:17719137-17719159 AGAGAGCTGGGAGCATCCATAGG + Intergenic
1163720651 19:18896615-18896637 ACAGTCTTGGGACCATCCCGTGG + Intronic
925107197 2:1301871-1301893 AGGAACCTGGGAACATCAGGAGG + Intronic
925826211 2:7850598-7850620 AGAGCCCTGGGGCCATCCTAAGG + Intergenic
928108233 2:28486639-28486661 AGATGCCTGGGCCCATCTGGGGG + Intronic
932001506 2:67889291-67889313 AGAGACCTGGGCTCCTCCAGGGG + Intergenic
934560505 2:95310746-95310768 AGAGAGCTGGGACCACACTGCGG + Intronic
942601099 2:177642010-177642032 AGAGACCTGGGACCAAACCCTGG - Intronic
946325982 2:218985003-218985025 AGGTACCAGGGACCAGCCGGAGG - Exonic
1174765983 20:53254649-53254671 AGTGACCTGTGACCATCATGTGG - Exonic
1179098225 21:38334680-38334702 AGCGACCTGAGACCATCTGTGGG + Intergenic
1179457446 21:41508705-41508727 AGAGACCTGGGACCATCCGGGGG - Intronic
1182621846 22:31622748-31622770 AGAGCTCTGGGACCATCTAGTGG - Intronic
1182935390 22:34217288-34217310 AAAGAGCTGGGACCAACTGGTGG + Intergenic
1183328201 22:37205647-37205669 AAAGACCTGGGAACCCCCGGGGG + Exonic
949248920 3:1959196-1959218 AGAGACCTGGGAGGAGCTGGAGG + Intergenic
951898541 3:27634150-27634172 AGAGACCAGGGACCATCACATGG + Intergenic
952530826 3:34260113-34260135 CGAGACCTGGGACCCTCTAGAGG + Intergenic
953474318 3:43193126-43193148 GGAGCCCTGGGACCATACTGGGG + Intergenic
954422744 3:50427183-50427205 AGAAACCAGGGAGCATGCGGTGG - Intronic
968962635 4:3753201-3753223 AGGGACCTGGGACCAGCCCGGGG - Intergenic
985778048 5:1855462-1855484 GGACACCGGGGACCATCCTGAGG + Intergenic
990066991 5:51728807-51728829 AGAGAATTGGGCCCATCTGGTGG - Intergenic
999384036 5:151141633-151141655 AGAGACCAGAGAGCATCCAGAGG - Intronic
999412648 5:151365888-151365910 GGAGACCTGGTACCACCAGGAGG - Intergenic
1003341507 6:5225945-5225967 ATAGACCTGGGACAATGTGGTGG - Intronic
1003570630 6:7254231-7254253 AGAGTCCTGGGGCCATGGGGAGG - Intergenic
1019388967 7:774577-774599 TGACACCTGGTACCAGCCGGAGG - Intronic
1023998587 7:45176923-45176945 AGGGGCCTGGGAACATCCTGAGG - Intronic
1025806091 7:64836059-64836081 AGCGCCCTGGCACCACCCGGAGG - Intergenic
1027270415 7:76515601-76515623 AGGGAGCTGGGCCCATCCTGGGG + Intronic
1033271523 7:139936931-139936953 AGAGAGCTGGTAGCATCCTGTGG - Intronic
1033756422 7:144400997-144401019 AGAGATCTGGGGTCATCCTGGGG - Intronic
1041065130 8:54075408-54075430 AGAGACCCGGGAGCATCCCGAGG + Intronic
1042465998 8:69130777-69130799 AGAGACCAGGGACCATCACATGG + Intergenic
1053321483 9:37102633-37102655 AGGAATCTGGCACCATCCGGTGG + Intergenic
1053562596 9:39211269-39211291 AGAGATCTGGGACTATCTAGAGG - Intronic
1054134554 9:61407770-61407792 AGAGATCTGGGACTATCTAGAGG + Intergenic
1054718549 9:68581422-68581444 AGAGACCAGGGACCCTAGGGTGG - Intergenic
1056827083 9:89883894-89883916 ATAGCCCTGGGACTCTCCGGTGG + Intergenic
1057164427 9:92914743-92914765 AGAGACTTGGGTCCCTCTGGTGG + Intergenic
1062042255 9:134409492-134409514 AGAGCCTGGGGGCCATCCGGCGG - Intronic
1185778778 X:2828765-2828787 AGAGACCCGGGAACCGCCGGGGG - Intergenic
1189641598 X:43078613-43078635 AGAGAGCTGGGACATTTCGGAGG + Intergenic
1190282076 X:48937564-48937586 AGAGAAATGGGACCCTCAGGGGG - Intronic
1192694288 X:73398496-73398518 GGAAACCTGGGAGCATCTGGAGG + Intergenic
1193920830 X:87423947-87423969 ACATACCTGGGACAATCGGGGGG - Intergenic
1196538818 X:116881633-116881655 AGGCACCAGGGACCATCCTGGGG - Intergenic
1196734041 X:118969052-118969074 AGAGAAGTGAGACCATCCTGCGG - Intergenic