ID: 1179457447

View in Genome Browser
Species Human (GRCh38)
Location 21:41508706-41508728
Sequence GAGAGACCTGGGACCATCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179457447_1179457455 -6 Left 1179457447 21:41508706-41508728 CCCCGGATGGTCCCAGGTCTCTC 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1179457455 21:41508723-41508745 TCTCTCGGCACCACCGGCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1179457447_1179457462 11 Left 1179457447 21:41508706-41508728 CCCCGGATGGTCCCAGGTCTCTC 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1179457462 21:41508740-41508762 CCAGGGCGGGAGTGAGGAAGTGG 0: 1
1: 1
2: 2
3: 60
4: 869
1179457447_1179457459 5 Left 1179457447 21:41508706-41508728 CCCCGGATGGTCCCAGGTCTCTC 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1179457459 21:41508734-41508756 CACCGGCCAGGGCGGGAGTGAGG 0: 1
1: 0
2: 1
3: 25
4: 293
1179457447_1179457464 15 Left 1179457447 21:41508706-41508728 CCCCGGATGGTCCCAGGTCTCTC 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1179457464 21:41508744-41508766 GGCGGGAGTGAGGAAGTGGTGGG 0: 1
1: 0
2: 3
3: 48
4: 574
1179457447_1179457457 -2 Left 1179457447 21:41508706-41508728 CCCCGGATGGTCCCAGGTCTCTC 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1179457457 21:41508727-41508749 TCGGCACCACCGGCCAGGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1179457447_1179457456 -3 Left 1179457447 21:41508706-41508728 CCCCGGATGGTCCCAGGTCTCTC 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1179457456 21:41508726-41508748 CTCGGCACCACCGGCCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 107
1179457447_1179457463 14 Left 1179457447 21:41508706-41508728 CCCCGGATGGTCCCAGGTCTCTC 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1179457463 21:41508743-41508765 GGGCGGGAGTGAGGAAGTGGTGG 0: 1
1: 0
2: 16
3: 191
4: 1861
1179457447_1179457454 -7 Left 1179457447 21:41508706-41508728 CCCCGGATGGTCCCAGGTCTCTC 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG 0: 1
1: 0
2: 1
3: 4
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179457447 Original CRISPR GAGAGACCTGGGACCATCCG GGG (reversed) Intronic
900245734 1:1635184-1635206 GAGTGACCCGGGACCATGTGTGG - Intronic
900256964 1:1702341-1702363 GAGTGACCCGGGACCATGTGTGG - Intronic
900564245 1:3324580-3324602 GAGCGACCTGGCACCCTCCCTGG + Intronic
900787355 1:4656955-4656977 CTGAGACCTGGGACAGTCCGGGG - Intronic
901038159 1:6348830-6348852 CAGAGACCAGGGACCAGCGGAGG - Intronic
902230136 1:15022532-15022554 GAGAGACTTGGGCCCATCCATGG - Intronic
905650934 1:39656588-39656610 GAGAGACATGGAATCATCAGTGG + Intergenic
906727303 1:48053546-48053568 GAGAGAACTAGGACCAACAGGGG - Intergenic
910652697 1:89587063-89587085 GAGAAAACTAGGACCATCAGGGG + Intronic
916862963 1:168825927-168825949 GAGAGAACTGAGACCATGAGTGG + Intergenic
1063002043 10:1933356-1933378 AAGAGGCCTCGGACAATCCGTGG - Intergenic
1067362296 10:45594254-45594276 GAGAGACCTGCGTACATTCGGGG - Intronic
1067558677 10:47289418-47289440 AAGAGACCAGGGAGCATCCTGGG - Intergenic
1067748963 10:48957516-48957538 CTGAGACCTGGGACCCTCGGAGG - Intronic
1072521294 10:96232186-96232208 GAGGGAGCTGGGACCCTCTGTGG - Intronic
1074410241 10:113221928-113221950 GAGGGTGCTGGGACCATCCCTGG - Intergenic
1074524522 10:114252459-114252481 GACAGAGCTGGAACCAGCCGAGG + Intronic
1077502928 11:2917329-2917351 GACCCACCTGGGACCATCCTGGG + Intronic
1084616043 11:70236583-70236605 GAGGCACCTGGGACCAGCAGAGG + Intergenic
1084767994 11:71324921-71324943 GAGAGAATTGGACCCATCCGTGG + Intergenic
1087723714 11:101695388-101695410 GAGAGACCTTGGACAATACCTGG - Intronic
1088369338 11:109072301-109072323 GAGAGACCTGGGACTATGTGGGG + Intergenic
1089701428 11:120246479-120246501 GAGAGTGCTGCGAGCATCCGTGG - Exonic
1090954559 11:131502862-131502884 GAGAGACCTGAGATCAACCTTGG + Intronic
1091600216 12:1913453-1913475 GAGAGACCTGGCCCCATCAGGGG - Intronic
1091937074 12:4442706-4442728 AAGAGGCCTGGGACCAACCCAGG - Intronic
1103794308 12:123492931-123492953 GAGAAACCTTGGACAATACGTGG - Intronic
1103812513 12:123627099-123627121 GAGAGTCCTGGAAGCAGCCGTGG - Exonic
1104743188 12:131193801-131193823 GAGATGCCTGGGAGCATCCATGG + Intergenic
1106207323 13:27612297-27612319 GAGAGAGCTGGGACCATGGCAGG - Intronic
1111698511 13:91656971-91656993 GAGAGACCTGGGAACAATCCAGG + Intronic
1113738848 13:112697126-112697148 GGGAGCCCTGGGGCCTTCCGTGG + Intronic
1118501089 14:66363324-66363346 GAGACACCTGGGACCAGCCAAGG + Intergenic
1120200425 14:81533190-81533212 GACAGACCAGGGACCATCTCAGG + Intronic
1122150915 14:99725764-99725786 CTGAGAAATGGGACCATCCGTGG + Intronic
1122413535 14:101537941-101537963 GAGAGAGAGGGGACCCTCCGGGG + Intergenic
1123171062 14:106373448-106373470 GAGAGTCCTGGGGACATCTGAGG + Intergenic
1129771359 15:78205332-78205354 AAGAGATCTGGGAGCCTCCGAGG + Intronic
1131527505 15:93164243-93164265 GAGAGTCATGGGACCCTGCGGGG + Intergenic
1132299034 15:100765237-100765259 GAGAGATCTGGGGCCATGGGCGG - Intergenic
1132591003 16:726469-726491 GAGTCACCTGGGACCAACAGAGG - Exonic
1133164887 16:3939281-3939303 GGGAGACCTGGGGCCAGCCGGGG + Intergenic
1133838279 16:9385823-9385845 CAGAGGTCTGGGACCATCTGGGG + Intergenic
1134409615 16:13993134-13993156 CAGAGACCTGTGATCATCCAGGG + Intergenic
1135858186 16:26031333-26031355 GGGTGAGCTGGGACCATCCCTGG - Intronic
1137404407 16:48178491-48178513 CAGAGCCCTGAGACCATCCCAGG - Intronic
1142656940 17:1400477-1400499 GAGAGACCTGGGTCAGACCGGGG + Intergenic
1143409853 17:6702315-6702337 GAGAAACCTGGGCCCTGCCGCGG - Intronic
1148674740 17:49438756-49438778 GAGAGACCTGGGATCGTGTGTGG + Intronic
1151215589 17:72574692-72574714 GTGTGAACCGGGACCATCCGAGG - Intergenic
1151674630 17:75591121-75591143 TGGGGACCTGGGACCCTCCGAGG - Intergenic
1152573292 17:81129748-81129770 GAGCTGCCAGGGACCATCCGAGG - Intronic
1157379121 18:47195056-47195078 AAGAGCCCTGGGACCCTCAGAGG + Intergenic
1161245417 19:3249157-3249179 GGGAGACCAGGGACCATAGGGGG + Intronic
1161979533 19:7623480-7623502 GAGAGAGCTGTGACCCTCCAAGG + Intronic
1164536038 19:29087298-29087320 GAGAGACCAGGGTCCCACCGTGG + Intergenic
1164589751 19:29500192-29500214 GAGGCACATGGGTCCATCCGAGG - Intergenic
1165178287 19:33946150-33946172 GAGAGAGCTGGGATCATTTGAGG + Intergenic
1168176209 19:54629760-54629782 CAGGGACCTGGGACCATCAAGGG - Intronic
1168288752 19:55347078-55347100 GAGAGCACTGGGGCCCTCCGGGG - Exonic
925897573 2:8484906-8484928 GAGAAGCCTGGGACCAGCTGGGG - Intergenic
927929592 2:27035620-27035642 GAGCTACGTGGGATCATCCGAGG + Exonic
932068187 2:68589143-68589165 GAGCGGCCTGGGACCTTCCCAGG + Intronic
935746438 2:106193880-106193902 CAGAGACCTGGGGCCGCCCGAGG + Intronic
940037969 2:149330261-149330283 GAGAGATTTGGGACCTTCCCGGG - Intronic
941281701 2:163560030-163560052 GGGAGACCTGGGACCAGGCGAGG - Intergenic
948311804 2:236992771-236992793 GAGAGTACTGGGACCACCAGCGG + Intergenic
1171817891 20:29804748-29804770 GAGAAACCTTGGACAATCCCTGG - Intergenic
1172098238 20:32471002-32471024 CAGGGACCTGGGAGCATCCCAGG + Intronic
1172581460 20:36051624-36051646 GAGAGAAATGGGACCATGGGAGG + Intergenic
1173722834 20:45274351-45274373 GAGAGGCCTGGGACCAGAGGGGG + Intergenic
1178749097 21:35283735-35283757 GAGTGTCCTGGGACCTTCCTGGG - Intronic
1179098224 21:38334679-38334701 TAGCGACCTGAGACCATCTGTGG + Intergenic
1179183661 21:39066643-39066665 GAGAGAGCTGGCACCACCCCAGG + Intergenic
1179457447 21:41508706-41508728 GAGAGACCTGGGACCATCCGGGG - Intronic
950488010 3:13284228-13284250 GAGAGACCTCAGACCCTCCAGGG + Intergenic
952648457 3:35692061-35692083 GAGAGATCTGGGACCAAGCATGG + Intronic
953494904 3:43377581-43377603 GAGAGGTCTGTGACCATCCAAGG + Intronic
954379640 3:50212813-50212835 GGCAGACCTGAGACCATCAGGGG + Intronic
954440657 3:50520207-50520229 GAGAAACCTGGGACAATACCTGG - Intergenic
954619384 3:51986906-51986928 GGGAGACCTGGGCCCACCCCAGG + Intronic
956124276 3:65996742-65996764 GGGACAGCTGGGACCATCGGAGG + Intronic
960963829 3:123090922-123090944 GAGAGACATGTGACCTTCAGTGG + Intronic
968799448 4:2732667-2732689 GAGAGACCTGGGACCTGCTCCGG - Intergenic
968920062 4:3517871-3517893 GCGAGGCCTGTGACCACCCGTGG + Intronic
968962636 4:3753202-3753224 GAGGGACCTGGGACCAGCCCGGG - Intergenic
981300872 4:143184959-143184981 GAGAGTGCTGGGATCAGCCGGGG - Exonic
985540756 5:486342-486364 GTGAGTCATGGGGCCATCCGAGG - Intronic
988919676 5:35928831-35928853 GAAAGACCTGGGACCACCGTGGG + Intronic
989837420 5:46009557-46009579 GAGAGACCTTGGACAATACCTGG + Intergenic
991447627 5:66717150-66717172 GATAGTCCTGGGCCCATCCTGGG - Intronic
992828209 5:80569933-80569955 GAGAGACCCAGGGCCAGCCGAGG - Intronic
992895332 5:81240330-81240352 GAGAGACCAGGGAGGATCTGAGG + Intronic
994853439 5:105086353-105086375 GAGAGAACTGGGTCCATCCAGGG - Intergenic
998501658 5:142637956-142637978 GAGAAAGCTGAGACCATCTGTGG + Intronic
998525930 5:142843215-142843237 GAGAGACTTGGGAGCATGCCTGG - Intronic
1001591653 5:172869497-172869519 GAGGGACCTGAGCCCAGCCGAGG - Intronic
1001704933 5:173734787-173734809 GAGTAACCTGGGAACATCAGGGG - Intergenic
1004635540 6:17464455-17464477 CAGAGACCTGAGACCCTCCCTGG + Intronic
1006284353 6:33081381-33081403 GAGATACATGAGACCATCCAGGG + Intronic
1008808133 6:55456722-55456744 GAGAGAGCTGGAACCATGCTGGG - Intronic
1013489218 6:110629047-110629069 AAGAGAGATGGGACCATCAGAGG - Intronic
1017508990 6:155095375-155095397 GAGAGAGCAGGGAAGATCCGTGG + Intronic
1019277618 7:184160-184182 GGGAGGCCGGGCACCATCCGTGG - Intergenic
1019494525 7:1331590-1331612 CAGAGACCTGGCTCCATCCCAGG - Intergenic
1023397178 7:39762080-39762102 GACAAACCTTTGACCATCCGCGG - Intergenic
1023851489 7:44152663-44152685 GAGAGCCCAGGGACCAACTGAGG + Intronic
1026933744 7:74239806-74239828 CAGAGACCTGGCACCCTCCTGGG - Intronic
1031865775 7:127037394-127037416 GAGAGACCTGGGCTCTTCCTTGG - Intronic
1032541403 7:132705936-132705958 GTGAGACCTGGGACCTGCCAGGG - Intronic
1035265033 7:157685593-157685615 GAGGGACCCGGGGCCAGCCGAGG + Intronic
1037754721 8:21703390-21703412 TGGGGACCTGGGAACATCCGAGG - Intronic
1040431163 8:47343825-47343847 GGGAGAACTGGGTCCATCCAAGG + Intronic
1046917035 8:119688923-119688945 GAAGGGCCTGGGACCTTCCGAGG + Intergenic
1050602071 9:7263034-7263056 GAGAAGCCTAGAACCATCCGAGG - Intergenic
1056749592 9:89338023-89338045 CAAACACCTGGGACCATCCCAGG - Intronic
1061154651 9:128850572-128850594 GAGAAACCTCGGACAATACGCGG - Intronic
1061155270 9:128856788-128856810 GAGAAACCTTGGACAATACGTGG - Intronic
1061593562 9:131614204-131614226 GAGAGAGCAGGGAGCATCTGTGG - Intronic
1185778779 X:2828766-2828788 GAGAGACCCGGGAACCGCCGGGG - Intronic
1185966189 X:4606873-4606895 GAGAGAACTGGGATCATCATGGG + Intergenic
1185989866 X:4881650-4881672 CAGAGTTCTGGGACCATCCAAGG + Intergenic
1196820082 X:119694433-119694455 GAGAGACCTGGGCCCGCCAGAGG + Intergenic
1197726768 X:129781738-129781760 GAGAGACCTGGGGAAATCCCAGG - Intronic
1201686737 Y:16713061-16713083 CAGAGTTCTGGGACCATCCAAGG - Intergenic