ID: 1179457448

View in Genome Browser
Species Human (GRCh38)
Location 21:41508707-41508729
Sequence CGAGAGACCTGGGACCATCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 129}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179457448_1179457464 14 Left 1179457448 21:41508707-41508729 CCCGGATGGTCCCAGGTCTCTCG 0: 1
1: 1
2: 0
3: 15
4: 129
Right 1179457464 21:41508744-41508766 GGCGGGAGTGAGGAAGTGGTGGG 0: 1
1: 0
2: 3
3: 48
4: 574
1179457448_1179457459 4 Left 1179457448 21:41508707-41508729 CCCGGATGGTCCCAGGTCTCTCG 0: 1
1: 1
2: 0
3: 15
4: 129
Right 1179457459 21:41508734-41508756 CACCGGCCAGGGCGGGAGTGAGG 0: 1
1: 0
2: 1
3: 25
4: 293
1179457448_1179457456 -4 Left 1179457448 21:41508707-41508729 CCCGGATGGTCCCAGGTCTCTCG 0: 1
1: 1
2: 0
3: 15
4: 129
Right 1179457456 21:41508726-41508748 CTCGGCACCACCGGCCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 107
1179457448_1179457455 -7 Left 1179457448 21:41508707-41508729 CCCGGATGGTCCCAGGTCTCTCG 0: 1
1: 1
2: 0
3: 15
4: 129
Right 1179457455 21:41508723-41508745 TCTCTCGGCACCACCGGCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1179457448_1179457454 -8 Left 1179457448 21:41508707-41508729 CCCGGATGGTCCCAGGTCTCTCG 0: 1
1: 1
2: 0
3: 15
4: 129
Right 1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG 0: 1
1: 0
2: 1
3: 4
4: 78
1179457448_1179457457 -3 Left 1179457448 21:41508707-41508729 CCCGGATGGTCCCAGGTCTCTCG 0: 1
1: 1
2: 0
3: 15
4: 129
Right 1179457457 21:41508727-41508749 TCGGCACCACCGGCCAGGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1179457448_1179457465 30 Left 1179457448 21:41508707-41508729 CCCGGATGGTCCCAGGTCTCTCG 0: 1
1: 1
2: 0
3: 15
4: 129
Right 1179457465 21:41508760-41508782 TGGTGGGACACACCTCAGCCAGG 0: 1
1: 0
2: 4
3: 21
4: 176
1179457448_1179457463 13 Left 1179457448 21:41508707-41508729 CCCGGATGGTCCCAGGTCTCTCG 0: 1
1: 1
2: 0
3: 15
4: 129
Right 1179457463 21:41508743-41508765 GGGCGGGAGTGAGGAAGTGGTGG 0: 1
1: 0
2: 16
3: 191
4: 1861
1179457448_1179457462 10 Left 1179457448 21:41508707-41508729 CCCGGATGGTCCCAGGTCTCTCG 0: 1
1: 1
2: 0
3: 15
4: 129
Right 1179457462 21:41508740-41508762 CCAGGGCGGGAGTGAGGAAGTGG 0: 1
1: 1
2: 2
3: 60
4: 869

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179457448 Original CRISPR CGAGAGACCTGGGACCATCC GGG (reversed) Intronic
900386466 1:2413113-2413135 GGCGAGACCCGGGACCTTCCAGG + Intronic
900546133 1:3230276-3230298 CGTGAGACCTAGCAACATCCAGG - Intronic
900619802 1:3581493-3581515 CCAGGGACCGGGGACCAACCCGG + Intronic
902230197 1:15022851-15022873 TGAGGGACCCAGGACCATCCAGG - Intronic
904172201 1:28599265-28599287 AGAGAGAGCTGGGACTTTCCCGG - Intronic
906603962 1:47151870-47151892 AGAGTGACCTGGGAACATCATGG + Intergenic
906799403 1:48722860-48722882 CCTGAGAACTGTGACCATCCTGG - Intronic
910112213 1:83694783-83694805 CCAGAGACATGGGCACATCCAGG - Intergenic
910984329 1:92990981-92991003 AGAGAGTCCAGGGACCATCTGGG + Intergenic
912230366 1:107785771-107785793 CCAGAGACCTGATACTATCCAGG + Intronic
913211146 1:116583502-116583524 TAAGAGACCTGGCACCACCCTGG + Intronic
917818229 1:178732507-178732529 CAGGAGATCTGAGACCATCCTGG - Intronic
918299822 1:183192913-183192935 CAGGAGACCTGAGACCATCGTGG - Intronic
920495838 1:206454369-206454391 GGAGAGACCTGGGACCGGCTTGG + Intronic
922698731 1:227745615-227745637 CGAGACAGCTGAGACCATCAAGG - Intronic
1063102529 10:2962965-2962987 CAACAGTCCAGGGACCATCCCGG + Intergenic
1064151776 10:12871630-12871652 TGAGAGACCTGGGACCATCCTGG + Intergenic
1065589682 10:27252011-27252033 CTGGAGTCCTGGGACCACCCAGG - Intergenic
1067362297 10:45594255-45594277 CGAGAGACCTGCGTACATTCGGG - Intronic
1067558678 10:47289419-47289441 AAAGAGACCAGGGAGCATCCTGG - Intergenic
1070156163 10:73836845-73836867 GGAGGGACCTGGGACCCACCAGG - Intronic
1070645383 10:78198534-78198556 CGACAGTCTTGGGACCAACCAGG - Intergenic
1073497936 10:103911315-103911337 GGACAGCCCTGGGACCATCAGGG - Intronic
1075334752 10:121600514-121600536 CAAGTGACCTCAGACCATCCAGG + Intergenic
1075587647 10:123669111-123669133 CCAGTGCCCTGGGACCCTCCAGG + Intronic
1077502927 11:2917328-2917350 GGACCCACCTGGGACCATCCTGG + Intronic
1077711803 11:4544749-4544771 AGAGACACCTGGGACTATCTAGG - Intergenic
1081580656 11:44349374-44349396 CCAGAGACCAGGTACCAGCCAGG - Intergenic
1083901661 11:65646386-65646408 CGGGAGACCTGGGACCACTCCGG - Intronic
1085640385 11:78189253-78189275 CGGGAGATCTGGGTGCATCCTGG + Intronic
1085993419 11:81879955-81879977 TGAGAGACCTTGAGCCATCCAGG - Intergenic
1088369337 11:109072300-109072322 AGAGAGACCTGGGACTATGTGGG + Intergenic
1089577954 11:119460038-119460060 AGAGACAACTGGGACCCTCCAGG - Intergenic
1090473999 11:127003655-127003677 CAAGAGACCTGGAGCCAGCCTGG - Intergenic
1091600217 12:1913454-1913476 TGAGAGACCTGGCCCCATCAGGG - Intronic
1092241917 12:6840744-6840766 AGAGAGACTTGGGCCCAGCCGGG - Intronic
1092800605 12:12162212-12162234 CGAGAGCTCTGGGACTATCTAGG + Exonic
1097430864 12:59504936-59504958 ATAGAGACCTGTGACCATCAGGG + Intergenic
1103653715 12:122453945-122453967 GGACAGACCTGGGCCCATCTGGG - Intergenic
1103752951 12:123179217-123179239 CGAGAGATCTGAGACCAGTCAGG + Intronic
1108246106 13:48515937-48515959 GGGGAGACCTGGTTCCATCCGGG - Intronic
1110569931 13:76992213-76992235 CCCGAGACCCGGGACCAGCCCGG - Exonic
1113078580 13:106492683-106492705 CGAGAGGGCTGTGAGCATCCTGG - Exonic
1122692417 14:103537632-103537654 CCAGAGGCCTGGGCCCAACCTGG + Intergenic
1124436844 15:29657268-29657290 CGAGAGATTTGCGACCATCCTGG - Intergenic
1128228197 15:66017469-66017491 AGACAGACCTGGCCCCATCCAGG - Intronic
1129032500 15:72629182-72629204 CGAGAGCCCTGGCCCCATCCTGG - Intergenic
1129470454 15:75750793-75750815 CGAGAGCCCTGGCCCCGTCCTGG - Intergenic
1132313907 15:100877403-100877425 CCAGTGACATGGGACCACCCTGG + Intergenic
1133164886 16:3939280-3939302 GGGGAGACCTGGGGCCAGCCGGG + Intergenic
1133838278 16:9385822-9385844 CCAGAGGTCTGGGACCATCTGGG + Intergenic
1134409614 16:13993133-13993155 CCAGAGACCTGTGATCATCCAGG + Intergenic
1136284928 16:29235074-29235096 GGAGACAGCTGTGACCATCCTGG - Intergenic
1142317436 16:89356951-89356973 CAAGTGACCTGTGACCATCTTGG + Intronic
1142656939 17:1400476-1400498 CGAGAGACCTGGGTCAGACCGGG + Intergenic
1144039288 17:11394251-11394273 CAAGAGACCTGAGAACTTCCAGG + Intronic
1146341137 17:32020870-32020892 CTGGAGTCCTGGGACCACCCCGG + Intronic
1147594116 17:41705781-41705803 TCAGGGACCTGGGACCAGCCTGG + Intergenic
1150784676 17:68152669-68152691 CAGGAGTCCTGGGACCACCCGGG - Intergenic
1152046613 17:77940835-77940857 TGTGAGACCCGGGACCATTCCGG - Intergenic
1152903904 17:82960278-82960300 CGGCAGGCCTGGGACCATCGCGG + Intronic
1159806364 18:72962577-72962599 CAAGAGATCGAGGACCATCCTGG - Intergenic
1160073055 18:75645283-75645305 CGTGAGACTGGGGACCATCCAGG + Intergenic
1160786188 19:901130-901152 CGAGACAGCTGGGCCCACCCCGG - Intronic
1161373956 19:3929355-3929377 CCAGGGACCTGGGGCCTTCCTGG + Intergenic
1161473891 19:4473981-4474003 CAGGACACCTGGGACTATCCAGG - Intronic
1162283956 19:9723908-9723930 CAGGAGATCTGAGACCATCCTGG - Intergenic
1164491117 19:28714995-28715017 CGAGAGACCTGGGGCCTTACAGG + Intergenic
1168176210 19:54629761-54629783 ACAGGGACCTGGGACCATCAAGG - Intronic
926148120 2:10409329-10409351 CGATGCATCTGGGACCATCCAGG - Intronic
927689947 2:25201493-25201515 GGAGAGATCTGTGGCCATCCAGG + Intergenic
927773560 2:25884482-25884504 GGAGTGATCTGGGACCAGCCTGG + Intergenic
927957873 2:27220745-27220767 CAGGAGATCTGAGACCATCCTGG + Intronic
933320871 2:80774068-80774090 TGAGAAACCTGGGAACATCATGG - Intergenic
939912175 2:147996092-147996114 CAAGAGATCCGAGACCATCCTGG + Intronic
940037970 2:149330262-149330284 GGAGAGATTTGGGACCTTCCCGG - Intronic
944807738 2:203298822-203298844 CAAGAGATTTGAGACCATCCTGG + Intronic
946111976 2:217427884-217427906 CTAGAAATCTGGGAACATCCTGG - Intronic
947491070 2:230594558-230594580 CGGGAGACCTGGAAACTTCCTGG - Intergenic
1171237148 20:23536180-23536202 CAAGAGCCCGGGCACCATCCAGG - Intergenic
1173705355 20:45106354-45106376 CAAGAGCCCTGTGACTATCCTGG - Intergenic
1173872984 20:46353197-46353219 TGAGAGGCCTGGGACCAGACTGG + Intronic
1175401443 20:58701810-58701832 CGAGTCACCCGGGAACATCCCGG + Intronic
1176213376 20:63936632-63936654 CAGGAGATCTGAGACCATCCTGG + Intergenic
1177160088 21:17538208-17538230 CAGGAGATCTGAGACCATCCTGG - Intronic
1178147776 21:29759326-29759348 CAGGAGACTTGAGACCATCCTGG - Intronic
1178749098 21:35283736-35283758 GGAGTGTCCTGGGACCTTCCTGG - Intronic
1179065996 21:38025362-38025384 CCAGAGATCTGGGACCTTCTGGG - Intronic
1179457448 21:41508707-41508729 CGAGAGACCTGGGACCATCCGGG - Intronic
1182619598 22:31611628-31611650 GGAGACCCCTGGCACCATCCAGG + Intronic
950449129 3:13055810-13055832 AGAGTGACCTCGGAACATCCTGG + Intronic
950488009 3:13284227-13284249 AGAGAGACCTCAGACCCTCCAGG + Intergenic
950645061 3:14372091-14372113 CTGGAGACCTGGGATCAGCCAGG + Intergenic
952981607 3:38740593-38740615 CCAGAGACCTGGGTCCACCCTGG + Intronic
954174297 3:48831570-48831592 CCAGAGGCCTAGGACCAGCCTGG - Intronic
960547284 3:118930228-118930250 AGAGAGCCCTGGGAGTATCCAGG - Exonic
961403490 3:126663412-126663434 GGTGAGACCTGGTACCAGCCTGG - Intergenic
962277738 3:134029020-134029042 CGTGAGAGCTGTGACCTTCCTGG + Intronic
962580627 3:136794840-136794862 TGATCGACCTGGGACTATCCAGG + Intergenic
963236974 3:142964898-142964920 CAAGAGATTTGAGACCATCCTGG + Intronic
968962637 4:3753203-3753225 GGAGGGACCTGGGACCAGCCCGG - Intergenic
969348197 4:6582146-6582168 GGAGACACCTTGGGCCATCCTGG + Intronic
969590400 4:8118699-8118721 CGATAGTCCTGGCACCAGCCTGG + Intronic
974756426 4:66214445-66214467 CAGGAGATCTGAGACCATCCTGG + Intergenic
976895391 4:90104056-90104078 GGAGAGACCTGGGAGAATTCTGG + Intergenic
977894028 4:102344645-102344667 CGCGCGACCCGGGGCCATCCTGG + Exonic
988919675 5:35928830-35928852 AGAAAGACCTGGGACCACCGTGG + Intronic
990496016 5:56348798-56348820 CAGGAGATCTGAGACCATCCTGG + Intergenic
991447628 5:66717151-66717173 GGATAGTCCTGGGCCCATCCTGG - Intronic
994853440 5:105086354-105086376 GGAGAGAACTGGGTCCATCCAGG - Intergenic
997346921 5:133198801-133198823 CGAGTGACCTGGGGACATCATGG - Exonic
1000443100 5:161286129-161286151 GGAGAGACCAGGGACCCACCAGG + Intergenic
1001477146 5:172058678-172058700 CTAGAAACCTGAGACCAGCCTGG + Intronic
1001647809 5:173295252-173295274 CCAGAGGCCTGGGAGCATCCAGG - Intergenic
1003215188 6:4103023-4103045 CAGGAGTCCTGGGACCATGCCGG + Intronic
1003836532 6:10077535-10077557 CAAGAGATTTGAGACCATCCTGG - Intronic
1004263505 6:14129281-14129303 CCAGAGACCGAGGCCCATCCAGG - Intronic
1006284352 6:33081380-33081402 TGAGATACATGAGACCATCCAGG + Intronic
1006859302 6:37159404-37159426 CGTGCCACCTGGGATCATCCTGG + Intergenic
1008808134 6:55456723-55456745 TGAGAGAGCTGGAACCATGCTGG - Intronic
1022194548 7:28051429-28051451 CAAGAGATTTGAGACCATCCTGG - Intronic
1023178629 7:37458485-37458507 CAAGAGATCTGAGACCATCCTGG - Intergenic
1026933745 7:74239807-74239829 ACAGAGACCTGGCACCCTCCTGG - Intronic
1030849281 7:114462579-114462601 TAAGAGATCTGAGACCATCCTGG - Intronic
1032541404 7:132705937-132705959 GGTGAGACCTGGGACCTGCCAGG - Intronic
1034007354 7:147488691-147488713 TGAGTGACCTGTGATCATCCAGG + Intronic
1037841010 8:22245287-22245309 CGAGACTCCCGGGACCACCCAGG - Exonic
1038476237 8:27870482-27870504 GGAGAGACCTGGGCCCCTCCAGG - Exonic
1040544027 8:48382909-48382931 CAAGAGATCGGAGACCATCCTGG + Intergenic
1047758160 8:127934431-127934453 CGAGAGAGCCCAGACCATCCTGG - Intergenic
1049532656 8:143162174-143162196 CTACTGACCTGGGACCACCCTGG - Intergenic
1049584113 8:143425125-143425147 CAGGAGACCAGTGACCATCCAGG + Intronic
1049711205 8:144064149-144064171 CCAGAGACCTGGGACAGTTCTGG - Intergenic
1051029295 9:12655831-12655853 TGAGAGACCTGAGAATATCCAGG + Intergenic
1052330350 9:27261073-27261095 CAAGAGACCTGGGACCATGGAGG + Intergenic
1057620570 9:96630887-96630909 AGAGAGACCTGTGACCGGCCAGG - Intergenic
1059283494 9:113153866-113153888 GTAGAGACCTGGGACTAACCTGG - Intronic
1062046947 9:134428719-134428741 CGAGAGTCCTGGGACCCTGCTGG + Intronic
1203561764 Un_KI270744v1:63945-63967 CGCGGGACCTGGGACCAGCGAGG + Intergenic
1185966188 X:4606872-4606894 GGAGAGAACTGGGATCATCATGG + Intergenic
1187221728 X:17333402-17333424 AGAAAGACCAGGGAGCATCCTGG + Intergenic
1195044277 X:101042159-101042181 AGAAAGAGCTGTGACCATCCTGG + Exonic
1195293316 X:103450031-103450053 TGAGAAAGCTGGGACCCTCCTGG + Intergenic
1195300406 X:103524588-103524610 GGAGAGAGCTAGGACCCTCCTGG - Intergenic
1196271539 X:113717519-113717541 CAGGAGATCTGAGACCATCCTGG - Intergenic
1198022322 X:132671129-132671151 CCTGAGACCAGGGACCATCCTGG + Intronic