ID: 1179457449

View in Genome Browser
Species Human (GRCh38)
Location 21:41508708-41508730
Sequence CCGAGAGACCTGGGACCATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179457449_1179457462 9 Left 1179457449 21:41508708-41508730 CCGGATGGTCCCAGGTCTCTCGG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1179457462 21:41508740-41508762 CCAGGGCGGGAGTGAGGAAGTGG 0: 1
1: 1
2: 2
3: 60
4: 869
1179457449_1179457465 29 Left 1179457449 21:41508708-41508730 CCGGATGGTCCCAGGTCTCTCGG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1179457465 21:41508760-41508782 TGGTGGGACACACCTCAGCCAGG 0: 1
1: 0
2: 4
3: 21
4: 176
1179457449_1179457456 -5 Left 1179457449 21:41508708-41508730 CCGGATGGTCCCAGGTCTCTCGG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1179457456 21:41508726-41508748 CTCGGCACCACCGGCCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 107
1179457449_1179457457 -4 Left 1179457449 21:41508708-41508730 CCGGATGGTCCCAGGTCTCTCGG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1179457457 21:41508727-41508749 TCGGCACCACCGGCCAGGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1179457449_1179457463 12 Left 1179457449 21:41508708-41508730 CCGGATGGTCCCAGGTCTCTCGG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1179457463 21:41508743-41508765 GGGCGGGAGTGAGGAAGTGGTGG 0: 1
1: 0
2: 16
3: 191
4: 1861
1179457449_1179457455 -8 Left 1179457449 21:41508708-41508730 CCGGATGGTCCCAGGTCTCTCGG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1179457455 21:41508723-41508745 TCTCTCGGCACCACCGGCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1179457449_1179457459 3 Left 1179457449 21:41508708-41508730 CCGGATGGTCCCAGGTCTCTCGG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1179457459 21:41508734-41508756 CACCGGCCAGGGCGGGAGTGAGG 0: 1
1: 0
2: 1
3: 25
4: 293
1179457449_1179457464 13 Left 1179457449 21:41508708-41508730 CCGGATGGTCCCAGGTCTCTCGG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1179457464 21:41508744-41508766 GGCGGGAGTGAGGAAGTGGTGGG 0: 1
1: 0
2: 3
3: 48
4: 574
1179457449_1179457454 -9 Left 1179457449 21:41508708-41508730 CCGGATGGTCCCAGGTCTCTCGG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG 0: 1
1: 0
2: 1
3: 4
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179457449 Original CRISPR CCGAGAGACCTGGGACCATC CGG (reversed) Intronic
900297764 1:1960456-1960478 CTGAGACAGCTGGGACCCTCGGG + Intronic
903379343 1:22885983-22886005 CCGAGCCACCTGGCACCCTCAGG - Intronic
904481682 1:30797888-30797910 CCCAGAGTCCTGGGAGGATCAGG + Intergenic
906727305 1:48053548-48053570 CAGAGAGAACTAGGACCAACAGG - Intergenic
910652695 1:89587061-89587083 CGGAGAAAACTAGGACCATCAGG + Intronic
910984328 1:92990980-92991002 GAGAGAGTCCAGGGACCATCTGG + Intergenic
916075145 1:161196338-161196360 CCAAGACACCTGGGTCCATTGGG + Intronic
919923734 1:202181566-202181588 CTGCTAGACCTGGGACCCTCTGG - Intergenic
922898602 1:229119322-229119344 CTGAGAGACCTGGGGCAGTCAGG + Intergenic
1062935010 10:1378974-1378996 CTGAGATACCTGGGGTCATCTGG - Intronic
1066028628 10:31393095-31393117 CCCAAAGAGCTGGGACTATCAGG + Intronic
1071783749 10:88876689-88876711 GCGTGAGTCCTGGGACCATGTGG + Intergenic
1073497937 10:103911316-103911338 AGGACAGCCCTGGGACCATCAGG - Intronic
1076109230 10:127848582-127848604 CCCAGAGAGCTGGGATCAACAGG - Intergenic
1076199276 10:128545457-128545479 CCGAGTGTCCTGGGAGGATCAGG + Intergenic
1076525055 10:131107238-131107260 CCTGCAGAGCTGGGACCATCGGG - Intronic
1076904746 10:133356276-133356298 GCGAGAGACCTGGGACCAGGGGG + Intronic
1077300027 11:1842490-1842512 CCAAGAGACCTGTGCCCATCAGG + Intergenic
1079383516 11:19959165-19959187 CTGAGAGGCCTGAGACAATCTGG - Intronic
1080623303 11:34005611-34005633 CCAATAGACCTGGCACTATCCGG + Intergenic
1081249878 11:40816074-40816096 ATGAGAGACCTGGGTCCACCTGG + Intronic
1084070156 11:66728440-66728462 GCGGGAGGCCCGGGACCATCTGG + Intronic
1084105479 11:66977509-66977531 CCCAGAGACCAGGCCCCATCAGG + Intergenic
1085300778 11:75457011-75457033 CCTAGAGGCCTGGAATCATCTGG - Intronic
1088369336 11:109072299-109072321 GAGAGAGACCTGGGACTATGTGG + Intergenic
1089491312 11:118885888-118885910 CCAGGAGTCCTAGGACCATCTGG + Intronic
1091369652 11:135047484-135047506 CAGAGCCACCTGGGAGCATCAGG + Intergenic
1091600218 12:1913455-1913477 CTGAGAGACCTGGCCCCATCAGG - Intronic
1092067540 12:5604382-5604404 CCTAGAGCCCTGGAACGATCTGG + Intronic
1092241918 12:6840745-6840767 CAGAGAGACTTGGGCCCAGCCGG - Intronic
1096080607 12:48830032-48830054 CCAGGAGACCTGGCACCATGAGG - Exonic
1096601547 12:52733280-52733302 CCAGGAGACCTGGCACCATGAGG + Intergenic
1097430863 12:59504935-59504957 AATAGAGACCTGTGACCATCAGG + Intergenic
1100202331 12:92312586-92312608 CAAAGAGACCTGGGATCATCAGG + Intergenic
1103653716 12:122453946-122453968 TGGACAGACCTGGGCCCATCTGG - Intergenic
1103891107 12:124239757-124239779 CAGAGAGTGCTGGGACCATCAGG - Intronic
1105772804 13:23629287-23629309 CCGAGCCACCTGGGACCCCCAGG - Intronic
1120109002 14:80530859-80530881 CCAAGTGGCCTTGGACCATCTGG - Exonic
1120733263 14:88025851-88025873 CCCAGAAACCTGGGACAATAAGG - Intergenic
1125107859 15:35995080-35995102 CCCTGAGACCTGGAGCCATCTGG - Intergenic
1129870147 15:78934700-78934722 AGGAGAGACCTGGGACCAATGGG + Intronic
1130063003 15:80582991-80583013 CCGGAAGCCCAGGGACCATCTGG + Intronic
1132749215 16:1449652-1449674 CAGAGAGCCCCGGGAACATCAGG + Intronic
1133838276 16:9385821-9385843 ACCAGAGGTCTGGGACCATCTGG + Intergenic
1135422278 16:22313468-22313490 CCTAGAGTCTTGGGACCACCAGG - Intronic
1137394455 16:48106910-48106932 CAGAGACACGTGGGACCTTCTGG + Intronic
1138083675 16:54115188-54115210 TCAAGAGACCTGGGACCACAGGG - Exonic
1138459245 16:57138311-57138333 CTGAGAGACCTGTGGCCATGGGG - Intronic
1140667130 16:77238002-77238024 CTGAGGGCCCTGGGAACATCTGG - Intergenic
1143997907 17:11024023-11024045 CTAAGATACCTGGGACCAGCTGG + Intergenic
1144957616 17:19027112-19027134 CTGAGAGGCCTGGGACCCTGGGG + Intronic
1144977540 17:19147404-19147426 CTGAGAGGCCTGGGACCCTGGGG - Intronic
1148326636 17:46786859-46786881 CAGAGACACCTGGGCCCACCAGG - Intronic
1150784677 17:68152670-68152692 CCAGGAGTCCTGGGACCACCCGG - Intergenic
1152109081 17:78347484-78347506 CCTGGGGCCCTGGGACCATCAGG - Intergenic
1153409794 18:4780945-4780967 TCAAGACACATGGGACCATCTGG - Intergenic
1160517233 18:79485368-79485390 ACGAGAGGCCTGAGACCAACAGG + Intronic
1160660413 19:295610-295632 CCGAGAAAACAAGGACCATCAGG + Intergenic
1161245415 19:3249155-3249177 CTGGGAGACCAGGGACCATAGGG + Intronic
1161579126 19:5071081-5071103 CCCAGGGACCTGGGACCAGGTGG + Intronic
1162543839 19:11315857-11315879 ATGAGACACCTGGGCCCATCTGG + Intronic
1165466477 19:35977831-35977853 GAGAGAGACCTGGGACTGTCCGG + Intergenic
1166007286 19:39916323-39916345 CCGAGGAATCTGGGAACATCTGG + Intronic
1167214382 19:48154738-48154760 CCGGGAGACCGGGGACCAGGTGG - Intronic
927495030 2:23546359-23546381 CAGAGTGACCTGGAATCATCAGG + Intronic
930853525 2:55987373-55987395 CAGAGAGCACTGGGAACATCTGG + Intergenic
935900596 2:107788290-107788312 CCTAGAGACCTGAGAACTTCCGG + Intergenic
943949139 2:194107017-194107039 CTGAAAGACCTGGGACTACCTGG + Intergenic
944497619 2:200324366-200324388 CAGAGAGTCCTGGGACCAGTGGG - Intronic
946201450 2:218073050-218073072 CCAGGAGTCCTGGGAGCATCAGG + Intronic
1168761772 20:354419-354441 CAGAGCCACCTGGGACCATCAGG - Exonic
1171030036 20:21669018-21669040 CTGTGGGACCTGGGACCACCTGG + Intergenic
1175887011 20:62297829-62297851 CAAAGAAAACTGGGACCATCAGG - Intergenic
1178423017 21:32457186-32457208 CTGAGAGAGCTGTGACCATCAGG - Intronic
1179065998 21:38025363-38025385 GCCAGAGATCTGGGACCTTCTGG - Intronic
1179457449 21:41508708-41508730 CCGAGAGACCTGGGACCATCCGG - Intronic
1183933868 22:41250699-41250721 CCGATAGACCTGCGTCCATTGGG + Intronic
1185065034 22:48627911-48627933 CCGGGTCACCTGGGAGCATCTGG - Intronic
953015696 3:39073862-39073884 CCAAGAGACCTGGCCTCATCAGG + Intronic
954466628 3:50658991-50659013 CCCAGAGTCCAGGGACCAGCAGG - Intergenic
961871073 3:129988624-129988646 CCGAGAGAGCTGGAGCCGTCAGG - Intergenic
965223087 3:165952879-165952901 CAGAGAGAACAGGGACCAACTGG + Intergenic
967950265 3:194835073-194835095 GCGTGAGACGTGGAACCATCAGG - Intergenic
968555815 4:1245934-1245956 CCGTGAGAACTGGTACCACCTGG + Intronic
969241682 4:5902865-5902887 CCCAGGGACCTGGGACAAGCAGG + Intronic
973293427 4:48491038-48491060 CCGAGCGAGCTGGGAGCAGCCGG + Exonic
976123126 4:81804670-81804692 CGGTGAGACCTGGGACACTCAGG + Intronic
976613566 4:87053729-87053751 CCAAGAGGACTGGAACCATCTGG - Intronic
977821224 4:101474342-101474364 CTGAGAGAGCTGAAACCATCAGG - Intronic
988309556 5:29540345-29540367 CTGAGAGATTTGTGACCATCAGG - Intergenic
988428071 5:31087261-31087283 CAGTGAGAGCAGGGACCATCTGG + Intergenic
995302055 5:110595756-110595778 CCAAGAGATGTGGGACCATGTGG + Intronic
997232422 5:132254488-132254510 CCTAGAGACCTGAGGCCACCAGG + Intronic
998350096 5:141494844-141494866 CCCAGAGACCCGGCACCAGCGGG + Exonic
999412649 5:151365891-151365913 CCAGGAGACCTGGTACCACCAGG - Intergenic
1000622040 5:163496876-163496898 CCAAGAACCCTGGAACCATCAGG + Intergenic
1001704935 5:173734789-173734811 CTGAGTAACCTGGGAACATCAGG - Intergenic
1003906983 6:10710473-10710495 ACTAGATACCTGAGACCATCAGG + Intergenic
1005124097 6:22426070-22426092 CCAAGAGAGCAGAGACCATCTGG + Intergenic
1009423664 6:63490835-63490857 CCCAAAGGCCTGGGACCAACGGG + Intergenic
1010980478 6:82364609-82364631 CTGAGGGACCTGGGACAAGCAGG - Exonic
1023676241 7:42633096-42633118 CAGAGAGAGCTAGGAGCATCTGG - Intergenic
1035169832 7:157010995-157011017 CCGAGACACGTGGGCCCCTCCGG + Intergenic
1035521110 8:275522-275544 CTGAGAGCCCTGGGCCCATGTGG - Intergenic
1035841441 8:2815766-2815788 CATAGAGAGCTGGGATCATCAGG - Intergenic
1043519445 8:81028097-81028119 CCCAGACACCTGGGGCTATCAGG + Intronic
1048774716 8:137932992-137933014 CCAAGAGTCCTGGGACTCTCGGG + Intergenic
1051137925 9:13944143-13944165 CCGAGAGATGAGGGACCATGTGG - Intergenic
1057552693 9:96063599-96063621 CCGAAGGACTTGGGACCCTCTGG - Intergenic
1191902135 X:66052469-66052491 CCGAGATACCTGGGGCAAACTGG + Intergenic
1192619410 X:72662469-72662491 CCCAGGGACATGGGTCCATCAGG - Intronic
1196179158 X:112671385-112671407 CAGAGAAACCTGTGACCATGAGG - Exonic