ID: 1179457454

View in Genome Browser
Species Human (GRCh38)
Location 21:41508722-41508744
Sequence GTCTCTCGGCACCACCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 78}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179457440_1179457454 19 Left 1179457440 21:41508680-41508702 CCACCAGCGTCCGGTGGAAAGTG 0: 1
1: 0
2: 0
3: 2
4: 87
Right 1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG 0: 1
1: 0
2: 1
3: 4
4: 78
1179457449_1179457454 -9 Left 1179457449 21:41508708-41508730 CCGGATGGTCCCAGGTCTCTCGG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG 0: 1
1: 0
2: 1
3: 4
4: 78
1179457439_1179457454 20 Left 1179457439 21:41508679-41508701 CCCACCAGCGTCCGGTGGAAAGT 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG 0: 1
1: 0
2: 1
3: 4
4: 78
1179457448_1179457454 -8 Left 1179457448 21:41508707-41508729 CCCGGATGGTCCCAGGTCTCTCG 0: 1
1: 1
2: 0
3: 15
4: 129
Right 1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG 0: 1
1: 0
2: 1
3: 4
4: 78
1179457443_1179457454 9 Left 1179457443 21:41508690-41508712 CCGGTGGAAAGTGCTCCCCCGGA 0: 1
1: 0
2: 1
3: 2
4: 75
Right 1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG 0: 1
1: 0
2: 1
3: 4
4: 78
1179457437_1179457454 22 Left 1179457437 21:41508677-41508699 CCCCCACCAGCGTCCGGTGGAAA 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG 0: 1
1: 0
2: 1
3: 4
4: 78
1179457447_1179457454 -7 Left 1179457447 21:41508706-41508728 CCCCGGATGGTCCCAGGTCTCTC 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG 0: 1
1: 0
2: 1
3: 4
4: 78
1179457441_1179457454 16 Left 1179457441 21:41508683-41508705 CCAGCGTCCGGTGGAAAGTGCTC 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG 0: 1
1: 0
2: 1
3: 4
4: 78
1179457446_1179457454 -6 Left 1179457446 21:41508705-41508727 CCCCCGGATGGTCCCAGGTCTCT 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG 0: 1
1: 0
2: 1
3: 4
4: 78
1179457438_1179457454 21 Left 1179457438 21:41508678-41508700 CCCCACCAGCGTCCGGTGGAAAG 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG 0: 1
1: 0
2: 1
3: 4
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179457454 Original CRISPR GTCTCTCGGCACCACCGGCC AGG Intronic
900226517 1:1535824-1535846 CTCTCCCGCCACCCCCGGCCTGG + Intronic
900382285 1:2391054-2391076 GTTTCTGGACAGCACCGGCCAGG + Intronic
900884160 1:5403654-5403676 GTCTCTGGGCAACACTGGGCTGG - Intergenic
901494220 1:9612267-9612289 CTCTCTGGGCACTTCCGGCCAGG - Intronic
903889372 1:26559177-26559199 GTCACTCGGCACCACCACCCTGG - Intronic
905675324 1:39820637-39820659 CTCCCTCGGCACCACGGGACTGG - Intergenic
906658038 1:47562932-47562954 GTCTGTTGGCTCCACCAGCCTGG + Intergenic
909907795 1:81220951-81220973 GCCTCTCGGCACCAACAGCCTGG + Intergenic
920528602 1:206685641-206685663 CGCACTCGGCACCGCCGGCCCGG - Intronic
1067582183 10:47452765-47452787 GTCTCCCTCCCCCACCGGCCAGG + Intergenic
1071692789 10:87839954-87839976 GTCTCTGGCCACCACTGGCAGGG - Intronic
1083583395 11:63839371-63839393 GCCTCCCCGCACCCCCGGCCGGG + Exonic
1083827469 11:65211625-65211647 CCCACTCAGCACCACCGGCCTGG + Exonic
1084316740 11:68350029-68350051 GTCTCTCAGCACTCCCAGCCTGG + Intronic
1089555904 11:119315936-119315958 GTCACTCGACACCATCTGCCTGG + Intronic
1090973614 11:131663496-131663518 GTCTGTCTGCAGCACGGGCCAGG + Intronic
1091184611 11:133636614-133636636 GTCTCTGGGCATCACTGGCAGGG - Intergenic
1092408289 12:8235668-8235690 CTCTCACGGTACCACAGGCCTGG - Intergenic
1092791212 12:12072353-12072375 GCCTCTCAGCACACCCGGCCAGG + Intronic
1096967734 12:55641828-55641850 GGCTCTCGGGACGACAGGCCTGG + Intergenic
1101441393 12:104706689-104706711 GGCTCTCAACACCACCTGCCTGG + Intronic
1103320025 12:120087052-120087074 TGCTCTCGGCGCCACCTGCCGGG + Intronic
1104216929 12:126742555-126742577 TTCTCTTGGCACCGCCGGGCTGG + Intergenic
1106428591 13:29657874-29657896 GTCTCTGGCCAGCACCAGCCTGG - Intergenic
1106928985 13:34643391-34643413 GTCTGTCAGCACCACTGGTCTGG + Intergenic
1112324919 13:98437748-98437770 TTCTCTCGGTCCCACCAGCCTGG + Exonic
1113812837 13:113152996-113153018 GTCTCTCCTCCCCACTGGCCCGG - Intergenic
1118030429 14:61812901-61812923 GGCTCGCGGCAGCAGCGGCCGGG + Intergenic
1123718302 15:23044869-23044891 GTCCCCCGGCACCTCTGGCCAGG - Intergenic
1123718844 15:23046783-23046805 GCCCCTCGGCACCTCCGGCCAGG - Intergenic
1123719049 15:23047489-23047511 GCCTCCCAGCACCTCCGGCCAGG - Intergenic
1123719340 15:23048494-23048516 GCCTCCCAGCACCTCCGGCCAGG - Intergenic
1126544780 15:49861508-49861530 CTCTCTCAGCATCACTGGCCTGG + Intronic
1130540084 15:84816273-84816295 GTCTGTGGGCACTTCCGGCCGGG + Intergenic
1132069097 15:98759902-98759924 GTCTCACGGTACCACGGGACAGG - Intronic
1132645707 16:998403-998425 GGCTCTGGGCGCCACCTGCCTGG - Intergenic
1132947268 16:2538350-2538372 GTCTGTCAGCGCCCCCGGCCAGG - Intronic
1132968448 16:2673106-2673128 GTCTGTCAGCGCCCCCGGCCAGG + Intergenic
1136392404 16:29973916-29973938 CTCTCTCCGCACCACAGCCCCGG - Exonic
1142957305 17:3530649-3530671 GTCTCTCGTCACCACCTGCCTGG - Intronic
1147541971 17:41367943-41367965 GTCGATCTGCACCACCAGCCTGG + Exonic
1152627299 17:81393600-81393622 GTCTCCCGGCTCCGGCGGCCGGG - Intergenic
1153948055 18:10034070-10034092 ATCTCTTGGCACCAGCAGCCTGG - Intergenic
1158234800 18:55301016-55301038 GTCCCTCAGCACATCCGGCCTGG + Intronic
1160700017 19:501718-501740 GTCTCCCGACACCACCTCCCCGG + Exonic
1160700025 19:501742-501764 GTCTCCCGACACCACCTCCCAGG + Exonic
1160903857 19:1442923-1442945 GTCTCTGGGCAGCACTGGCCAGG + Intergenic
1163179915 19:15592027-15592049 GTTTCCTGGCACCACCAGCCTGG - Intergenic
1163781419 19:19251070-19251092 GTCTCTCCACACCAGGGGCCAGG + Exonic
1167703673 19:51065792-51065814 GTCTCCAGGCACCCCCGACCTGG + Intergenic
932329670 2:70890913-70890935 GTCTCTAGGAGCCACTGGCCTGG - Intergenic
938135881 2:128756041-128756063 GTCCCACGGGACCACCTGCCAGG + Intergenic
1169549258 20:6685355-6685377 GTCTCACGGCATCATGGGCCTGG - Intergenic
1170930868 20:20768534-20768556 GCCGGTCGGCGCCACCGGCCAGG + Intergenic
1173895214 20:46545836-46545858 GGCTCTGGGCCCCACAGGCCAGG - Exonic
1175963540 20:62648794-62648816 GCCTCTTGTCCCCACCGGCCAGG + Intronic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1179593608 21:42427708-42427730 GTTTCTCCGCACCAGGGGCCTGG - Intronic
1180004640 21:45014660-45014682 CTCTCTCGGCTCCCCTGGCCCGG - Intergenic
1184036835 22:41922421-41922443 TTCTCTGGGGACCACAGGCCAGG + Intergenic
949895436 3:8764700-8764722 GACTCTGGCCACCACCAGCCTGG - Intronic
964041755 3:152269243-152269265 GTCCCTCAGCACCTCCTGCCCGG + Intronic
968950259 4:3687827-3687849 GGCTCACGCCACCACCTGCCTGG - Intergenic
968996363 4:3948154-3948176 CTCCCACGGCACCACAGGCCTGG - Intergenic
969306445 4:6328692-6328714 GTCTCTCAACCCCACCTGCCTGG - Intronic
969817603 4:9698065-9698087 CTCCCACGGCACCACAGGCCTGG + Intergenic
970218950 4:13787459-13787481 ATTTCTAGGCACCACAGGCCTGG + Intergenic
970324459 4:14909033-14909055 TTCTCTGGGCCCCACCAGCCAGG + Intergenic
973107317 4:46356368-46356390 GTCTCTCCACACCCCTGGCCAGG + Intronic
984839143 4:184051985-184052007 GTCTCCCTGCCCCACCTGCCAGG - Intergenic
988909799 5:35827618-35827640 TTCTCTCAGGACCACCAGCCTGG - Intergenic
1007761856 6:44137993-44138015 GTATCTCCCCACCTCCGGCCAGG - Intronic
1016222381 6:141691177-141691199 GTGCCACTGCACCACCGGCCTGG - Intergenic
1025850417 7:65239451-65239473 GTCTGTGGACACCACGGGCCAGG + Intergenic
1029278825 7:99424038-99424060 GGCTCCCGGGACCAGCGGCCAGG + Intronic
1031949194 7:127874173-127874195 GTGTCTCTGCCCCACCTGCCAGG + Intronic
1039449944 8:37664717-37664739 GTGTCACGGCACCTCCAGCCTGG - Intergenic
1049474600 8:142790841-142790863 GCCTGTGGGCACCACCAGCCAGG - Intergenic
1055432397 9:76257543-76257565 GTCTCTCTGCACCTCCCACCAGG + Intronic
1057690128 9:97276517-97276539 GTGGCTCGGCCCCACCTGCCTGG + Intergenic
1060278418 9:122199504-122199526 GTCTCCTAGCACCACCGGCAAGG + Intronic
1062730328 9:138104873-138104895 GTCTCTGGGCAGCACTGGCTGGG + Intronic
1196828706 X:119759774-119759796 GTCTCCTGTAACCACCGGCCTGG + Exonic
1198286249 X:135194683-135194705 CTCTGTTGTCACCACCGGCCTGG + Intergenic