ID: 1179458255

View in Genome Browser
Species Human (GRCh38)
Location 21:41514571-41514593
Sequence GACCCCTAGAAATTTCACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 696
Summary {0: 1, 1: 25, 2: 176, 3: 231, 4: 263}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179458251_1179458255 -10 Left 1179458251 21:41514558-41514580 CCCCACACCACTGGACCCCTAGA 0: 108
1: 152
2: 127
3: 118
4: 273
Right 1179458255 21:41514571-41514593 GACCCCTAGAAATTTCACTAAGG 0: 1
1: 25
2: 176
3: 231
4: 263
1179458247_1179458255 20 Left 1179458247 21:41514528-41514550 CCTTCACCTTAGAAAAGGCAACT 0: 1
1: 0
2: 0
3: 14
4: 234
Right 1179458255 21:41514571-41514593 GACCCCTAGAAATTTCACTAAGG 0: 1
1: 25
2: 176
3: 231
4: 263
1179458248_1179458255 14 Left 1179458248 21:41514534-41514556 CCTTAGAAAAGGCAACTCAATAG 0: 1
1: 0
2: 3
3: 9
4: 171
Right 1179458255 21:41514571-41514593 GACCCCTAGAAATTTCACTAAGG 0: 1
1: 25
2: 176
3: 231
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179458255 Original CRISPR GACCCCTAGAAATTTCACTA AGG Intronic
901444562 1:9300130-9300152 GACCCCGAGAAATTTCACTAAGG - Intronic
901904119 1:12393090-12393112 GATCCCTAGAAATTTTGCTGAGG + Intronic
904179555 1:28656386-28656408 AACCCCTAGAAATTTCACTGAGG + Intergenic
904880409 1:33692214-33692236 GACTCCTTGAAATTCCAATAAGG + Intronic
905354010 1:37368378-37368400 GACCCCTAGAAATTTTACTGAGG - Intergenic
905465158 1:38147689-38147711 GACCCCAAGAAATTTTACTGAGG - Intergenic
906879616 1:49576052-49576074 GTACCCTAGAAATTTTACTGAGG - Intronic
907597280 1:55731719-55731741 TACCCCTAAAAATTTTACTGAGG - Intergenic
908695862 1:66841061-66841083 GACACCCAGAAACTTCACTGAGG + Intronic
909172672 1:72315870-72315892 GACCCCTAGAAATTTTACTGAGG + Intergenic
909549013 1:76877574-76877596 GACCCCTAGAAATTTTACTGAGG + Intronic
909576849 1:77185447-77185469 GATCCCTAGAAATTTTACTGAGG - Intronic
909810892 1:79930937-79930959 GATCCCTAGAAATTTTACTGAGG - Intergenic
910036937 1:82800044-82800066 GCACCGTAGAAATTTCATTAAGG - Intergenic
910561837 1:88599570-88599592 GACCCCTAGAAATTTTACTGAGG - Intergenic
910588148 1:88901315-88901337 GACCTCTAGAAATTTTACTAAGG - Intergenic
910639043 1:89440385-89440407 GACCTGTAGAAATTTAACTGAGG + Intergenic
910790251 1:91043310-91043332 GACCCCTAGAAATTTTACTGAGG - Intergenic
911109163 1:94164616-94164638 GACCCCTAGAAATTTTACTGAGG + Intronic
911135676 1:94437369-94437391 GGGCCCTAGGATTTTCACTATGG - Intronic
911257391 1:95647775-95647797 GAGCCCTAGAAATTTTACTCAGG + Intergenic
911631659 1:100190466-100190488 GACCTCTACAAATTTCATTGTGG - Exonic
911738457 1:101362329-101362351 GGCCCCTAGAACTTTTACTGAGG + Intergenic
911883505 1:103270046-103270068 GACCCCTAGAAATTTTACTGAGG - Intergenic
911981964 1:104579671-104579693 GACCTCTAGAAATTATACTGAGG + Intergenic
912129977 1:106588462-106588484 GATGCCTAGAAATTTTACTAAGG + Intergenic
913039509 1:115008809-115008831 GACCCCTAGGAATTTTACTGAGG + Intergenic
915641206 1:157228277-157228299 GACTCCTAGAAACATTACTAAGG + Intergenic
915667731 1:157460055-157460077 GACCCCTAGAAATTTTACTGAGG + Intergenic
915668275 1:157464664-157464686 GACTCCTAGAAACATTACTAAGG - Intergenic
916017412 1:160762390-160762412 AACCCCTAGAAATTTCACTGAGG + Intergenic
916106401 1:161435738-161435760 GACCCCTAGAAATTTTACTGAGG + Intergenic
916285255 1:163099126-163099148 GACCCCAAGAAATTTTACTGAGG - Intergenic
917217274 1:172691324-172691346 GACCCCTAGAAATTTTACTGAGG + Intergenic
917462653 1:175245787-175245809 GACCCGTAGAAATTTTACTGAGG - Intergenic
918755785 1:188338218-188338240 GACCCCTAGAAATTTTACTGAGG + Intergenic
918774432 1:188610336-188610358 GATCCCTAGAAATTTTACTGAGG - Intergenic
918815013 1:189170817-189170839 GACCCCTGGAAATTTTCCTGAGG - Intergenic
918918288 1:190672287-190672309 GACCCCTAAAAATTCTACTGTGG + Intergenic
918958184 1:191237539-191237561 GACCCCTAGAAATTTTACAGAGG - Intergenic
919124680 1:193380190-193380212 ACTCCCTAGAAATTTCACTGAGG + Intergenic
919241701 1:194923795-194923817 GATCCCTAGAAATTTTACTGAGG - Intergenic
920197362 1:204237958-204237980 TACCCCTGGAAATTTTACTGAGG - Intronic
920466792 1:206193665-206193687 GAACCCTAGAAATTTCGGAACGG - Intronic
921619772 1:217312725-217312747 GACCCTTAGAAATTTCACTGAGG - Intergenic
921911507 1:220554117-220554139 GACTCCTGGGAATTTCACTGAGG + Intronic
922781111 1:228252982-228253004 GACCCCTAGACATTTTACTGAGG + Intronic
923253630 1:232199844-232199866 GAACTCTAGAAATTTTACTGAGG + Intergenic
923490789 1:234482222-234482244 AAACCCTGGAAATATCACTATGG - Intergenic
924477827 1:244396892-244396914 GACCCCTAGAAATTTCACTGAGG + Intergenic
924491781 1:244545186-244545208 GACTGCAAGAAATTTCACTGAGG - Intronic
924840844 1:247708242-247708264 GAACCCTAGAAATTTTACTGAGG + Intergenic
924847195 1:247785557-247785579 GACCCCTAGACATTTTACTGAGG + Intergenic
1064234041 10:13556763-13556785 GACAACTAGAAATTTAAATAGGG + Intergenic
1064422847 10:15205175-15205197 GACCCCTATTAATCTCAGTAGGG - Intergenic
1064517702 10:16168645-16168667 GACCCCTAGAAATTTTACTGAGG + Intergenic
1064545757 10:16448547-16448569 GACCCCTGGACATTTTACTGAGG + Intronic
1066167101 10:32799655-32799677 GATCCCTAGAAATTTTACTGAGG + Intronic
1066543660 10:36476074-36476096 GACCCCTAGAAATTTTACTGAGG - Intergenic
1067125614 10:43512952-43512974 GACCCCTAGAAATTTTACTGAGG + Intergenic
1067333076 10:45339806-45339828 GACCCCTAGAAATGTTACTGAGG - Intergenic
1067754410 10:48994128-48994150 GAACCCTAGAAATTTTACTGAGG + Intergenic
1068393069 10:56424219-56424241 GTACCCTAAAAATTTCACTGAGG - Intergenic
1068447151 10:57138185-57138207 GACCCCTAGAAATTTTACTAAGG - Intergenic
1068837282 10:61568788-61568810 GACCCCTAGAAATTTTACTGAGG + Intergenic
1069145660 10:64889748-64889770 GACCTCTAGAAATTTCATAAAGG - Intergenic
1069192375 10:65506781-65506803 GATCCCTAGAAATTTTACTGAGG + Intergenic
1069790901 10:71019989-71020011 GACCCCTAGAAATTTTACTTAGG + Intergenic
1071267151 10:83974411-83974433 GACCCCTAAAAATTTTACTAAGG + Intergenic
1071364529 10:84884936-84884958 GACTCCTAGAAATTTTACTGAGG + Intergenic
1071937622 10:90548865-90548887 TAGCCCTAGAAATTTTACTGAGG - Intergenic
1071942847 10:90608188-90608210 GACCCCCAGAAATTTTACTGAGG + Intergenic
1071950862 10:90701347-90701369 GACCTCTAGAAACTTCACAGAGG + Intergenic
1072209326 10:93232088-93232110 GACCCCTAGAAATTTCACTGAGG + Intergenic
1072360408 10:94653732-94653754 GACCCCTTGAAATTTTACAGAGG - Intergenic
1073273998 10:102292185-102292207 GGCCCCTAGAACTTTTTCTAAGG + Intronic
1073473333 10:103737482-103737504 GATCCCAAGAAATATCATTAGGG + Intronic
1073957737 10:108892053-108892075 GACCCCTAAAAATTTTACTGAGG + Intergenic
1074235716 10:111582542-111582564 GACTGCTAGAAGTTTCACTGAGG + Intergenic
1074244119 10:111670314-111670336 GACCCCTAGAAATTTTACTGAGG + Intergenic
1075606724 10:123816988-123817010 GACCCCTAGAAATTTTTCTGAGG - Intronic
1075735156 10:124660106-124660128 AACCCCTAGAAAGTTCGCTCTGG - Intronic
1076123226 10:127952944-127952966 GACCCCTAGAAATTTCACTGAGG - Intronic
1076927481 10:133499637-133499659 GACCCTTAGAAATTTTACTGAGG + Intergenic
1077380940 11:2237100-2237122 GACCCCTAGACGTTTCCCTGAGG - Intergenic
1077396424 11:2325611-2325633 GACTCCTAAAAATTTCACCGAGG - Intergenic
1077751149 11:4971360-4971382 GACCCCCAGACTTTTCACTTAGG - Intronic
1079990146 11:27237993-27238015 GAGCCCCAGACATCTCACTAGGG + Intergenic
1080020191 11:27552076-27552098 GACCCCTAGAAATTTAACTGAGG + Intergenic
1080558031 11:33434818-33434840 GACCCCTAGAAATTTTACTGAGG + Intergenic
1081065528 11:38535310-38535332 GACCACTAGAAATTTTACTGAGG + Intergenic
1081609000 11:44547442-44547464 GAACCCTAGAAATTTTACTGAGG - Intergenic
1081984455 11:47291406-47291428 GATGCCTAGAAAGCTCACTAAGG - Intronic
1082671635 11:56042620-56042642 GACCCCTACACATTTTACTGAGG - Intergenic
1082999598 11:59279445-59279467 GACCCCCAGAAATTTTACTGAGG - Intergenic
1083093077 11:60220688-60220710 AACCCCTAGAAATTTTACTGAGG - Intronic
1083112300 11:60423234-60423256 GATCCCTAGAAATTTCACTGAGG + Intergenic
1085684516 11:78609661-78609683 ATCCCCTAGAAATTTCACCAAGG - Intergenic
1085685896 11:78621759-78621781 GACCCCTAGAAATTTTACTGAGG - Intergenic
1086834053 11:91599956-91599978 GACTCCTAGAAATTTTACTGAGG - Intergenic
1087021656 11:93609153-93609175 GATCTCTACCAATTTCACTAAGG + Intergenic
1088191724 11:107234927-107234949 GACCCCTAGAAATTTTACTGAGG + Intergenic
1088265354 11:107983194-107983216 GACCCCTAGAAATTTTAATGAGG - Intergenic
1088449290 11:109964929-109964951 GAGCCCTAGAAATTTTACTGAGG - Intergenic
1088836584 11:113582952-113582974 GACCCCTAGAAATTTTACTGAGG - Intergenic
1089139536 11:116274818-116274840 CACCCCCAGAGATTTCACTTAGG - Intergenic
1089473794 11:118742078-118742100 GATCCCCAGGAATTTCACTGAGG + Intergenic
1090221673 11:125032010-125032032 GACCCCTAGACATTTTACTGAGG + Intronic
1090707653 11:129353921-129353943 GACTCCTAGTACTTTCACTGAGG - Intergenic
1091051669 11:132378318-132378340 GAGCCATAGAAATTTCACTGAGG - Intergenic
1091103422 11:132896832-132896854 GACTCTTAGAAATTTCACCAAGG - Intronic
1091703277 12:2677893-2677915 GACCCCTATAAAGTTCAGTTTGG + Intronic
1092093228 12:5821224-5821246 GACCCCTAGAAATTTTACTGAGG - Intronic
1092381378 12:7999756-7999778 GACCCCTGGAAATTTTACTGAGG - Intergenic
1092922580 12:13245793-13245815 GACCCCTAGAAATTTCAATGAGG + Intergenic
1093031934 12:14296377-14296399 GACCCCTAGAAATTCTACTGAGG + Intergenic
1093036232 12:14334907-14334929 GACCCCTAGAAATTTTACTGAGG - Intergenic
1093048987 12:14485388-14485410 GGACCCTAGAAATTTTACTGAGG + Intronic
1093049736 12:14491398-14491420 GACCCCTAGAAATTTTACTGAGG + Intronic
1093645670 12:21583246-21583268 GACCCCTATAAATTTTACTGAGG - Intronic
1094102461 12:26778827-26778849 GACCTCTAGAAATTTTACTGAGG - Intronic
1094260645 12:28494476-28494498 GACCTCCAGAAATTTTACTGAGG + Intronic
1094797413 12:33992144-33992166 GAGCCTTAGAAAATTCAATAAGG - Intergenic
1095110157 12:38286122-38286144 GAGCCTTAGAAAATTCAATAAGG - Intergenic
1095121573 12:38425276-38425298 GACACCTAGAAATTTTACTGAGG + Intergenic
1095844454 12:46730380-46730402 GACCCCTTGAAATTTTACTGAGG + Intergenic
1095856299 12:46864111-46864133 GACCCCTAGAAACTTTACTGAGG + Intergenic
1096288641 12:50322525-50322547 GACCCCTAGAAATTTTACGGAGG - Intergenic
1096457537 12:51799873-51799895 GGCCCCTAGAAATTTCACTGAGG + Intronic
1097821451 12:64132600-64132622 GACCTCTAAAAATTTTACTGAGG + Intronic
1097843425 12:64343194-64343216 GACCCCTAGAAATTTTACCGAGG + Intronic
1098716029 12:73829373-73829395 GGACCCTAGAAATTTTACTAAGG - Intergenic
1098733239 12:74065206-74065228 GACCCCTAGAAATTTTACTGAGG - Intergenic
1098807148 12:75034547-75034569 GACCTCTAGAAATTTCACTTAGG - Intergenic
1099183447 12:79493024-79493046 GACCCCTAAAAATTTTAGTGAGG + Intergenic
1099228847 12:80000267-80000289 GACCCCTTGGAATTTTACAATGG + Intergenic
1099365864 12:81764950-81764972 GACCCCTAGAAATTTTACTGAGG - Intergenic
1099508496 12:83506749-83506771 GATCCCTAGAAATTTTACCGAGG - Intergenic
1099526305 12:83722696-83722718 GACCACTAAAAATTTTACTGAGG - Intergenic
1099578024 12:84405027-84405049 GATCCCTAGAAATTTTACTGAGG - Intergenic
1099667262 12:85648053-85648075 GACCCATGGAAAATTCAATATGG + Intergenic
1099735725 12:86564604-86564626 GATCCCCAGAAATTTTACTAAGG - Intronic
1099804470 12:87500066-87500088 GTATCCTGGAAATTTCACTAAGG + Intergenic
1099834096 12:87885780-87885802 GACCTCTTGAAATTTTACCAAGG + Intergenic
1099995120 12:89769962-89769984 GAGTCCTACAAATTTCACTGAGG + Intergenic
1100241214 12:92712041-92712063 GACCCCTAGAAATTTTACTGAGG + Intergenic
1100714969 12:97295901-97295923 GGCCCCTAAAATCTTCACTAAGG + Intergenic
1101222566 12:102656628-102656650 GACCCTTAGAAATTTCACTGAGG - Intergenic
1101264064 12:103065682-103065704 GGCCCCTAGAAATTTTACGAAGG - Intergenic
1101534733 12:105606540-105606562 GACCCCTAGAAATTTTACTGAGG + Intergenic
1102211293 12:111129115-111129137 GAGCCCTAGATATTTCACTGAGG + Intronic
1103035548 12:117653628-117653650 GACCCCTAGCAATTTTACTGAGG - Intronic
1103396464 12:120611013-120611035 GACCCCTAGAAATTTTACTGAGG - Intergenic
1105740043 13:23314740-23314762 GACCCCTAAAAATTTTACTGAGG - Intronic
1106525498 13:30537281-30537303 TATCCCCATAAATTTCACTATGG + Intronic
1108166790 13:47701601-47701623 GGCCTCTAGAAATTTCACTGAGG - Intergenic
1108587181 13:51880586-51880608 CACCCGTAGAAATTACACTCTGG + Intergenic
1108904224 13:55449536-55449558 GACCCCTAGAAATTTAACTAAGG - Intergenic
1109293166 13:60499696-60499718 GACCCCTAGAAATTTTCCTGAGG - Intronic
1109392264 13:61708517-61708539 GACTCCAGGAAATTTCACTGAGG - Intergenic
1109582985 13:64365704-64365726 GACCCCTAAAAATTTCACTGAGG - Intergenic
1109712739 13:66181260-66181282 ACCCCCTAGAAATTTTACTGAGG + Intergenic
1109933351 13:69245610-69245632 GACCCCTAGAAATTTCACTGAGG + Intergenic
1109951088 13:69502647-69502669 GACCCCTAGAAATTTTACTGAGG + Intergenic
1110377111 13:74806041-74806063 GACCCCTGGAAATTTTACTGAGG - Intergenic
1110792629 13:79602099-79602121 GACCCCTGCAAACTTCAGTAGGG + Intergenic
1111061066 13:83019447-83019469 TATCCCTAGAAATTTCACTAAGG + Intergenic
1111275943 13:85946946-85946968 TACCTCTAAAAATTTCTCTAAGG + Intergenic
1111317438 13:86581370-86581392 GACCCTTAGGAATTTTACTCAGG - Intergenic
1111918118 13:94382889-94382911 GAGCCCTGGAAATTTAACTATGG - Intronic
1112249992 13:97770668-97770690 GATCCCTAGAAATTTTACTGAGG + Intergenic
1113111641 13:106829974-106829996 GACGCCTAAAAATTTTACTGAGG + Intergenic
1113396127 13:109949426-109949448 AAACCCTAGAAATTTTACTGAGG - Intergenic
1114175701 14:20317712-20317734 GACCCACAGAAATTACACTCTGG + Intronic
1114205809 14:20570341-20570363 GACCCCTAGAAATTTTACTGAGG - Intergenic
1114606081 14:23998276-23998298 GAGCCCTAGAATTTTCAGAATGG + Intronic
1114611676 14:24046232-24046254 GAGCCCTAGAATTTTCAGAATGG + Intergenic
1114758322 14:25284312-25284334 GACCCCTAGAAATTTTACTGAGG + Intergenic
1114905445 14:27120858-27120880 AACCCCTAGAAATTTTACTGAGG + Intergenic
1115059646 14:29173458-29173480 CACCCCTAGAAATTTTACTGAGG - Intergenic
1115070740 14:29319194-29319216 GACCTCTAGAAATTTCACTGAGG - Intergenic
1115310914 14:31976926-31976948 GACCCATAGAAATTTCAGTGAGG + Intergenic
1116058843 14:39896502-39896524 GAGCCCTAGAAATTTTACTGAGG - Intergenic
1116068033 14:40008739-40008761 GACCCCCAGAAATTTTACTGAGG - Intergenic
1116158444 14:41237102-41237124 GACGCCTAGAAATTTTACTGAGG + Intergenic
1116308100 14:43283873-43283895 GACCTCTAGAAATTTCACTGAGG + Intergenic
1117001532 14:51375869-51375891 GGCCCCTAAAAATTTTACTGAGG - Intergenic
1117216776 14:53559748-53559770 GACCTCTAGAAATTCTACTGAGG - Intergenic
1117634068 14:57723942-57723964 GACCCCTAGAAATTTTACTGAGG - Intronic
1118073024 14:62266946-62266968 GACCCCTAAAAATGTGATTAAGG + Intergenic
1118501780 14:66368951-66368973 GACCCCTAGACACTTCACTGAGG - Intergenic
1118880832 14:69824436-69824458 GACCTCTAGAAATTTTACTGAGG + Intergenic
1119107632 14:71939275-71939297 GACCCCTAGAAATTTTATTGGGG + Intronic
1120082090 14:80227966-80227988 GACCCCTAGAAATTTTACTAAGG + Intronic
1120973647 14:90230391-90230413 GGCCCCTAGAAATTTTATTGAGG - Intergenic
1121371310 14:93360820-93360842 GACCCCTAAAAATTTTACTGAGG - Intronic
1124509546 15:30311660-30311682 GGCCCCTAGAAACTTCACTGAGG - Intergenic
1124734014 15:32227002-32227024 GGCCCCTAGAAACTTCACTGAGG + Intergenic
1126168583 15:45675046-45675068 GACCCCAAGAAAGTTCATTCTGG + Intronic
1126756917 15:51934129-51934151 GTCCCCCAGAAACTTCACTGAGG + Intronic
1127161586 15:56192743-56192765 GACCTCTACAAATTTCATCAGGG + Intronic
1128642741 15:69351777-69351799 GATCCCTAGAAATTACACCGAGG - Intronic
1131935320 15:97497788-97497810 GATTCCTAGAAATTTCACCAAGG + Intergenic
1132305792 15:100811314-100811336 GATCCCTAGAAATGTCACTGAGG + Intergenic
1135625941 16:23995065-23995087 GACCCCTAGAAATTTCACTGAGG - Intronic
1136250876 16:29004155-29004177 AACCCCTAGACATTTTACTGAGG - Intergenic
1137690877 16:50426543-50426565 GGCCCCTAGAAAGTTCTTTATGG + Intergenic
1138868323 16:60850354-60850376 GGACCCTAGAAATTTTACTGAGG - Intergenic
1141559609 16:84858474-84858496 GACCCCTGTAAATTTTACCAAGG + Intronic
1143050176 17:4118785-4118807 AACCCCTAAAAATTTCACTGAGG + Intronic
1143442382 17:6985374-6985396 AACCCCCAGAAATTTCTCTCTGG - Intronic
1146237915 17:31185516-31185538 AAGCCCTAGAAATTTTACTGAGG - Intronic
1146836290 17:36113571-36113593 GACCCCTAGAAATTTTACTGAGG - Intergenic
1146850870 17:36220604-36220626 AATCCCTAGAAATTTTACTGAGG - Intronic
1147324911 17:39665547-39665569 CACCCCCAGAAATTTCTCCAGGG - Intronic
1149427035 17:56565238-56565260 GACCCCAAGAAATTTCACTGGGG - Intergenic
1153184334 18:2470321-2470343 GACCTCTGGAAGTTTCACTCAGG - Intergenic
1153217760 18:2836042-2836064 GAACCCTAGAAATTTTACTGAGG + Intergenic
1153585682 18:6617640-6617662 GACCCCTAGAAGTTTGCCTATGG - Intergenic
1154068403 18:11130670-11130692 GACCCCTAGAAATTGTACTGAGG - Intronic
1154273294 18:12938233-12938255 GATCCCTAGAAATTTCACTGAGG + Intergenic
1154506112 18:15042436-15042458 GACCCCTAGAAATTTTACTGAGG - Intergenic
1155234330 18:23804391-23804413 GACCCTTAGAAATTTAACTGAGG + Intronic
1155741824 18:29298424-29298446 GACCCCCAAAATTTTCACTGAGG + Intergenic
1156303798 18:35858268-35858290 CATCCCTAGAAATTTTACTGAGG - Intergenic
1156606305 18:38671326-38671348 GACCCCTAGAAATTTTACTGAGG - Intergenic
1156990372 18:43401219-43401241 GACCCCTAGAAATTTTACTGAGG + Intergenic
1157341145 18:46779651-46779673 GACCCCTAGAAATTTTACTGAGG - Intergenic
1157846153 18:51005771-51005793 GAGTCCTAGAAATTTCACTGAGG - Intronic
1157954805 18:52085085-52085107 GACCTCCAGAAATGTCATTAGGG - Intergenic
1157999916 18:52606104-52606126 GACTTCTAGAAAATTTACTATGG - Intronic
1158372446 18:56824039-56824061 GAACCCTAGATATCTCACCAAGG - Intronic
1158941909 18:62412430-62412452 GAGCCTTAGAAACTTCACAATGG - Intergenic
1159264590 18:66064065-66064087 GACCACTCTAAATTTCACTGAGG - Intergenic
1159277090 18:66235087-66235109 GACCCCTAGACATTTTACTTAGG - Intergenic
1159559171 18:69975791-69975813 AACCGCTAGAAATTTTACTGAGG + Intergenic
1159632969 18:70770462-70770484 GACCCCTCTAAATATCAATATGG + Intergenic
1159726111 18:71961694-71961716 GAACCCTTTAAATTTCACTAGGG - Intergenic
1159909414 18:74131068-74131090 CACACCAAGAAATTTCAATAGGG + Intronic
1160092397 18:75839576-75839598 GACACCTAGAAATTTCACTGAGG - Intergenic
1161156995 19:2737237-2737259 GGCCACTAGCAATTTCACCATGG + Exonic
1162650522 19:12085446-12085468 CACTCCTAAAAATTTCACTGCGG + Intergenic
1163274837 19:16277059-16277081 GAACCCTTGAAATGGCACTAAGG - Intergenic
1164123753 19:22291442-22291464 CACCCCCAGCAATTTCACTACGG + Intronic
1164200093 19:23010817-23010839 GACCCCTAGAAATTTTACTGAGG + Intergenic
1165839246 19:38777742-38777764 GACACTTAGAAATCTCACTTTGG + Intergenic
1166619757 19:44285890-44285912 TAGCACTAGAAATTTCACTTAGG - Intronic
1167951469 19:53031177-53031199 GACCCCTAGAAATTTCACTGAGG - Intergenic
1168539405 19:57197814-57197836 GACCCCTAGAAATTTTACTGAGG + Intronic
925460659 2:4060006-4060028 GACCCCTAGAAATTTTACTGAGG - Intergenic
926083020 2:10004106-10004128 GTCCCCTAGAAATGTTACTGAGG - Intergenic
927008662 2:18879321-18879343 GATCCCTAGAAATTTTACTGAGG - Intergenic
927018647 2:18995217-18995239 GACCCCTAATAACTTCAGTAGGG + Intergenic
927660362 2:24988224-24988246 GACTCCTAGAAATTTTACTGAGG - Intergenic
928487150 2:31744305-31744327 AATTCCTAGAAACTTCACTAAGG + Intergenic
929269884 2:39961207-39961229 AACCCCTAGAAATTTTACTGAGG + Intergenic
929550202 2:42885594-42885616 GACCTCTAGAAATTTCACTGAGG - Intergenic
930536669 2:52652700-52652722 AACCCCTAGAAATTTTACTGCGG + Intergenic
930602048 2:53454845-53454867 GACCCCTATTAACTTCAATAGGG + Intergenic
930607280 2:53505708-53505730 GACCCCTACTAACTTCAATAGGG + Intergenic
930852258 2:55973637-55973659 GACCCCTAGAAATTTCACTGAGG + Intergenic
932264129 2:70352430-70352452 GACCCCTAGAAAATTAACAATGG + Intergenic
932975720 2:76597599-76597621 GACCCCTAGACATTTTACTAAGG - Intergenic
933144389 2:78833670-78833692 GGACCCTAGAAATCACACTATGG + Intergenic
933530256 2:83500737-83500759 GACCCAGAGAAAATTCATTAAGG - Intergenic
933539103 2:83616357-83616379 GACACCTAGAAATTCCACATAGG - Intergenic
935425173 2:102911764-102911786 GACCCCTAGAAATTCTACTGAGG + Intergenic
935823168 2:106914749-106914771 GACCTCCAGAAATTTCACTGAGG - Intergenic
935944675 2:108274792-108274814 GACCCTTAGAAATTTCATGGAGG + Intergenic
936085117 2:109462024-109462046 AACCCCTAGAAATTTCACTGAGG + Intronic
936641166 2:114314253-114314275 GATCCCTAGAAATTTCAATGAGG - Intergenic
937852629 2:126649150-126649172 GACTCCAAGAAATTTTACTGAGG + Intergenic
938375483 2:130802916-130802938 GACCCCCAGAAATTTCACTGAGG - Intergenic
938614868 2:132987219-132987241 GACCCCTATTAACTTCAGTAGGG - Intronic
939069002 2:137517419-137517441 GACCCCTAGAAATTTTACTGAGG - Intronic
939192025 2:138928087-138928109 GACACCTAGCAGTTTCATTATGG - Intergenic
939213800 2:139211802-139211824 GACCCCTAGAAAATTTACTGAGG - Intergenic
939365937 2:141231401-141231423 GACCCCTATTAATTTCAATAGGG + Intronic
939633420 2:144552223-144552245 GATGCCTAGATATTTCATTAAGG + Intergenic
939788741 2:146546515-146546537 GACCCCTAGAAGTCTTACTGAGG + Intergenic
940171381 2:150833153-150833175 GACCCCTAGAAATTTTACTAAGG + Intergenic
940605991 2:155924796-155924818 GACCCCTAGAAATTTTACTGAGG + Intergenic
941330731 2:164174999-164175021 GATCCCTAGAAATTTTACAGAGG + Intergenic
941667951 2:168260692-168260714 GACCCCTAGAAATTTTACTGAGG - Intergenic
943006837 2:182395456-182395478 GACCCCTAGAAACTTCCCTGAGG - Intronic
943388067 2:187226700-187226722 GACACCTAGAAATTTTACTGAGG - Intergenic
944222338 2:197315073-197315095 GACCTCCAGAAACTTCACTAAGG - Intergenic
944594487 2:201248576-201248598 GGCCACTAGAAATTACACAATGG - Intronic
944625861 2:201568143-201568165 GACCCCTAGAAATTTCACTGAGG + Intronic
944975222 2:205042174-205042196 GTCCCCTTTAAATGTCACTAAGG - Intronic
945725905 2:213471932-213471954 GACCCCTAGAAAGTTTACTGAGG + Intronic
945855039 2:215058757-215058779 GAGCCCTATAAATGTCACTGAGG - Intronic
946527928 2:220540405-220540427 GACCCCTAGAAATTTTACTGAGG + Intergenic
946703842 2:222438230-222438252 GACCCCTAGATATTTTACTGAGG + Intronic
946790860 2:223299324-223299346 GACCCCTAGAAAGTTTACTGAGG - Intergenic
947066071 2:226226937-226226959 TGCCCCTAGAAATGTCACTGAGG - Intergenic
948116999 2:235500757-235500779 GACCCCTTTAAATTTCATTAGGG + Intronic
948340482 2:237246732-237246754 AACTCCTAGAAATTTCGCTGAGG + Intergenic
948955156 2:241283881-241283903 GACCCCTAGGATTTTCAGAATGG - Intronic
1169736099 20:8839191-8839213 GACTCCTAGGAATTTCACTGAGG - Intronic
1170092360 20:12604548-12604570 GACCCCTAGAAATTTTGCTGAGG + Intergenic
1170154312 20:13255802-13255824 GACCCCTTGTAGTTTCACTTAGG - Intronic
1171330124 20:24330086-24330108 GAAACCTAGAAATTTCACTGAGG + Intergenic
1171409881 20:24939064-24939086 GGGCCCTAGAAATTTCACTAAGG + Intergenic
1171436052 20:25125529-25125551 GGGCCACAGAAATTTCACTAAGG - Intergenic
1176791742 21:13326588-13326610 GACCCCTAGAAATTTTACTGAGG + Intergenic
1176998096 21:15579772-15579794 GACACCTAGAAATTTTACTGAGG - Intergenic
1177318449 21:19491487-19491509 GACTACTGAAAATTTCACTAAGG + Intergenic
1177913108 21:27055773-27055795 GACCCCTAGAAATTTTACTGAGG - Intergenic
1177933761 21:27317370-27317392 GATCCCTAGAAATGTTACTGAGG + Intergenic
1177940967 21:27410920-27410942 GACCCCTAGAAATTTTACTGAGG + Intergenic
1177991135 21:28037590-28037612 GACCCCTGGAAATTTTACTGAGG + Intergenic
1178063348 21:28875785-28875807 GATCCCTACCAATTTCACTAAGG + Exonic
1179383461 21:40920625-40920647 GACCCTTGAAAATTTCACTAAGG - Intergenic
1179415212 21:41192949-41192971 GACCCCTAGAAATTTTACTGAGG + Intronic
1179458255 21:41514571-41514593 GACCCCTAGAAATTTCACTAAGG + Intronic
1181367501 22:22389379-22389401 GACACCTAGAAATTTTATTGAGG + Intergenic
1181420590 22:22795393-22795415 GGCCCGTAGAAATTTTACTGAGG - Intronic
1182430529 22:30296124-30296146 GACCTCTAGACATTTCATTCGGG + Intronic
1184603626 22:45558807-45558829 GACCCCTAGAAATTTTACTGAGG + Intronic
1184638766 22:45857452-45857474 GACCACTAGAAATCTCATTGAGG + Intergenic
949125730 3:443583-443605 GACTCCTAGAAATTTTACTGAGG + Intergenic
949170103 3:987032-987054 GACCCCTAGAAATTTTACTGAGG + Intergenic
949245809 3:1924490-1924512 GACCCATAGAAATTTTACTGAGG - Intergenic
949417667 3:3831318-3831340 GACCCCTAAAAATTTTACTGAGG + Intronic
949445543 3:4130618-4130640 GACCCCTAAAAATTGTACTGAGG - Intronic
949638715 3:6012078-6012100 GACCCCTAGAAATTTTACTGAGG - Intergenic
950566947 3:13775082-13775104 GACCCCTAGAAGTTTCGCCAAGG - Intergenic
951122509 3:18945130-18945152 GACCTCTAGAAATTTTACTGAGG - Intergenic
951291586 3:20877172-20877194 GACCCCTAGAAATTTTACTGAGG + Intergenic
951491914 3:23280289-23280311 CACCACTAAAAATTACACTAAGG - Intronic
951970821 3:28442304-28442326 GACTCCTAGAAATTTTGCTGAGG + Intronic
952587727 3:34912808-34912830 GAATCCTAGAAATTTCACTGAGG + Intergenic
954511555 3:51130092-51130114 GACTCCTAGAAATTTTACTGAGG + Intronic
955119329 3:56040840-56040862 TACCCTTAGAAAATTCTCTAAGG - Intronic
956306808 3:67835185-67835207 GACCCCTAGAAATTTCACTGAGG - Intergenic
956360397 3:68440999-68441021 GACCCCTAGAAATTTTACTGAGG - Intronic
957247649 3:77734325-77734347 GACCCTTAGAAGTTTTACTGAGG + Intergenic
957298542 3:78362044-78362066 GACCCTTACAAATTTCACTGAGG + Intergenic
958179912 3:90046915-90046937 GATCCCTTGAAATTTCACTGAGG + Intergenic
958762162 3:98321886-98321908 GAGCCCTGGAAATTTTACCAAGG + Intergenic
958934241 3:100240201-100240223 GACTCCTAGAAATTTTACTGAGG - Intergenic
959100211 3:102001529-102001551 GAACCCTAGAAACTTCACTGAGG + Intergenic
959203719 3:103279677-103279699 GACCCCTAGAAATTTTACTGAGG + Intergenic
959226840 3:103597715-103597737 GACCCCTGGAAATTTTACTGAGG + Intergenic
959439452 3:106358743-106358765 GACCCCTAGGAATTTTACTGAGG - Intergenic
959746075 3:109777712-109777734 GACCCCTAGAAATTTTACTGAGG + Intergenic
959997802 3:112697883-112697905 GACCCCTAGAAATTTTACTGAGG - Intergenic
960349462 3:116575262-116575284 GACCCCTAGAAATTTTATTGAGG - Intronic
961262788 3:125616070-125616092 GATCCCTAGAAATTTCCCTGAGG - Intergenic
961426929 3:126855760-126855782 GACCCCTATTAACTTCAGTAGGG + Intronic
961711042 3:128828440-128828462 GACCCCTAGATATTTTACTGCGG + Intergenic
963331880 3:143923812-143923834 GACCCCTAGAAATTTTACTGAGG + Intergenic
963355725 3:144207271-144207293 GACCCCTGGAAATTTTACTGAGG + Intergenic
965251586 3:166350247-166350269 GACCCCTAGAAGTTCTACTGAGG + Intergenic
965958104 3:174396245-174396267 GACCCCTAGAAATTTTACTGAGG - Intergenic
966044393 3:175531360-175531382 GACACCTAGAAATTTTTCTGAGG + Intronic
966197527 3:177328243-177328265 GATCTCTAGAAACTTCACTCAGG + Intergenic
966445622 3:179998120-179998142 GACCCCTAGAAATTTTACTGAGG - Intronic
967831704 3:193925557-193925579 GACCCCTAGAAATTTTACTGAGG - Intergenic
970553408 4:17207164-17207186 GATGCCTAGAAATTACACGAAGG - Intergenic
970859607 4:20686805-20686827 GATCCCTAGAAATTTGACTGCGG + Intergenic
971101083 4:23466848-23466870 GACCCCTAGAAATTTTACTAAGG + Intergenic
971460605 4:26891812-26891834 GACCCTTAGAAATTTCACCGAGG + Intronic
971817162 4:31504627-31504649 GACCCCTAGAAATTTCCCTGAGG - Intergenic
971868532 4:32205214-32205236 GAGCTCTAGACATTTCTCTATGG + Intergenic
971979355 4:33733303-33733325 GACCCCTAGAAATTTTACTTAGG + Intergenic
972047965 4:34693102-34693124 AACCCCTAGACATTTCACTGAGG + Intergenic
972805842 4:42528898-42528920 GACCCCTAGAAATTTTACTGGGG - Intronic
973102866 4:46294320-46294342 GACCCCTAGAAATTTTACTGAGG - Intronic
973118369 4:46488604-46488626 GACCCCTAGAAATTTTACTGAGG - Intergenic
973143629 4:46798170-46798192 GACTCCTAGAAATTTCACTGAGG - Intronic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
974557555 4:63471459-63471481 GAGCCCTAGAAATGTCACTGAGG - Intergenic
974564728 4:63567875-63567897 GACCCCTAGAAATTTTATTGAGG - Intergenic
975024412 4:69531195-69531217 GACCCTAAGAAACTTCACTGAGG - Intergenic
975386780 4:73767947-73767969 GACCCCTGGAAATTTTGCTGAGG + Intergenic
976034260 4:80796255-80796277 GACCTCTAGAAATTTTACTGAGG + Intronic
977031558 4:91890969-91890991 GACCACTAGAAATTTTACTGAGG - Intergenic
977031669 4:91891785-91891807 GACCACTAGAAATTTTACTGAGG + Intergenic
977069852 4:92371447-92371469 GACCCCTAGGATTTTCAGAATGG - Intronic
977430704 4:96927773-96927795 GACCCCTGGAAATTTTACTGAGG - Intergenic
977465933 4:97382950-97382972 GATCCCTAGAAATTTTACTGAGG - Intronic
977490137 4:97700505-97700527 GACCCCTAGAAATTTTACTGAGG + Intronic
977546754 4:98391994-98392016 GATGCCCAGTAATTTCACTAAGG - Exonic
977701807 4:100030326-100030348 GATCCCTAGAAATTTGACTGAGG + Intergenic
977753212 4:100634241-100634263 GGCCCCTAGAAATTTCACTGAGG + Intronic
977833335 4:101618605-101618627 GACCCCTAGGAATTTTACTGAGG + Intronic
977847146 4:101779664-101779686 GACCACTAGAAATTTCACTGAGG + Intronic
977930471 4:102744258-102744280 GACCCCTAGAAATTTTACTGAGG + Intronic
978341656 4:107725987-107726009 GACCCCTAGAAATTTTACTGAGG + Intergenic
978432401 4:108646544-108646566 AACCCCTAGACATTTCCCTGAGG + Intergenic
978899143 4:113927271-113927293 GACCCATAGAAATTTTACTGAGG + Intronic
979533096 4:121789716-121789738 GACTCCTAGAAATTTTAAGAAGG + Intergenic
979595781 4:122532567-122532589 GATCCCTTGAAATTTAACTGAGG + Intergenic
979766951 4:124474156-124474178 AACCCCTATAAATTTTACTGAGG - Intergenic
979888622 4:126062610-126062632 GACACCTAGAAATTTCACTGAGG + Intergenic
979898461 4:126189494-126189516 GACCCCTAAAAATGTTACTGAGG + Intergenic
980385896 4:132087838-132087860 CACCACTAGAAATTTCACTTAGG + Intergenic
980405952 4:132354230-132354252 GACATCTAGAAATTTTACTGAGG + Intergenic
980497594 4:133605800-133605822 GATCCCTAGAAATTTTACTGAGG + Intergenic
980582326 4:134771231-134771253 AAGCCCGAGAAATTTCACTGAGG + Intergenic
980602101 4:135039040-135039062 GATCCCTAGAAATTTTCCTGAGG - Intergenic
980629470 4:135413848-135413870 TACCCCTAGAAATTTTACTGAGG - Intergenic
980957665 4:139445482-139445504 GACCCCTAGAAATTTTACTGAGG - Intergenic
981441095 4:144782850-144782872 AACCCTGAGAAATTTCACTATGG + Intergenic
981462752 4:145031367-145031389 GACCCCTAGAAATTTTACTGAGG - Intronic
981834939 4:149043507-149043529 AACCCCTAGAAATTTTACCGAGG - Intergenic
981979416 4:150773070-150773092 GAGCCCTAGAAATTTCACTGAGG + Intronic
982354428 4:154450864-154450886 GACCCCTAGACATTTCACTGAGG - Intronic
982623408 4:157733372-157733394 GACCCCTAGAAATTTTACTGAGG + Intergenic
982835471 4:160116204-160116226 GAAACCTAGAAATTTTATTAAGG - Intergenic
982847703 4:160273857-160273879 GACCCCTAAGAATTTTACTGAGG - Intergenic
983027323 4:162754852-162754874 GACCCCTGGAAATTTTAGTGAGG - Intergenic
983184997 4:164691136-164691158 GACCCCTAGAAATTTTACTAAGG - Intergenic
983582604 4:169324372-169324394 GACCTCTAGACATTTAACTGAGG - Intergenic
984060353 4:174982463-174982485 GACCCCTAGAAATTTTACTGAGG + Intergenic
985714718 5:1448955-1448977 GACCCACAGAAAGTTCACCAAGG - Intergenic
986037099 5:3950871-3950893 GACCCCTAGAAATTTTACTGAGG + Intergenic
986087053 5:4462280-4462302 GACCCCTAGAAATTTTACTGAGG - Intergenic
986261659 5:6152672-6152694 GACTCCTAGAAATTTTACTGAGG + Intergenic
986742851 5:10719067-10719089 GACCCTTAGAAATTTTACTGAGG - Intronic
986938391 5:12919188-12919210 GACCGCTAGAAATTTTACTGAGG + Intergenic
986959776 5:13198784-13198806 GACCCCTAGAAATTTTACTGAGG - Intergenic
987153114 5:15061237-15061259 GACTCCTAGAAATTTTACTGAGG - Intergenic
987657201 5:20822089-20822111 GACCCCTAGAAATTCTACTGAGG + Intergenic
987906387 5:24083075-24083097 GACCCATAGATATTTCACTCAGG - Intronic
988056628 5:26105699-26105721 GACCCCTAGGTATTTTACTGAGG + Intergenic
988079890 5:26401853-26401875 GACCCCTAGAAATTTTACTGAGG + Intergenic
988092546 5:26562174-26562196 GACCCCTAGAAAATTTATTGAGG - Intergenic
988160891 5:27517309-27517331 AATCCCTAGAAATTTTACTGAGG + Intergenic
988188722 5:27900798-27900820 GATCCCTAGAAATTTTGCTGAGG - Intergenic
988218951 5:28316639-28316661 GACCCCTAAAGATTCCACTAAGG + Intergenic
988228709 5:28447704-28447726 GACCGCTAGAAATTTTACTGAGG - Intergenic
988233355 5:28507525-28507547 GACCCCTAGAAATTTTACTGAGG + Intergenic
988562065 5:32290419-32290441 AACCCCTAAAAATTTTACTGAGG - Intronic
988766348 5:34381859-34381881 GACCCCTAGAAATTCTACTGAGG - Intergenic
989045277 5:37268043-37268065 TACCCCTAGAAATTTTACTGAGG + Intergenic
989097761 5:37796884-37796906 GACCCCTAGAAATTTTACTGAGG - Intergenic
989307555 5:39974995-39975017 GACTCCTAGAAATTTTACTTAGG + Intergenic
989457713 5:41662206-41662228 GACTCCTAGAAATTTTACTGAGG + Intergenic
989486447 5:41996806-41996828 GACCCCTAGATATTTTACTGAGG + Intergenic
989677057 5:43984426-43984448 GATCCCTAGAAATTTTACTGAGG + Intergenic
991033478 5:62105486-62105508 GACCCCTAGAAATTTTACTGAGG - Intergenic
991234118 5:64374723-64374745 GACCCCTAGAAGTTTCACTAAGG - Intergenic
991330801 5:65490119-65490141 GACCACTAGAAATTTTACTGAGG + Intergenic
991597136 5:68317199-68317221 GACCCCTATTAACTTCATTAGGG - Intergenic
992015860 5:72574563-72574585 AACCTCTAGGAATTTCACTCTGG - Intergenic
992242871 5:74789314-74789336 GACCCCTAGAAACTTTACTGAGG - Intronic
992600485 5:78393976-78393998 GGCCCCAAGAAATGTCTCTAAGG - Intronic
993201813 5:84826680-84826702 GACCCCTGTAAATTTCTCTTTGG + Intergenic
993231968 5:85247975-85247997 GACCCCTAGAAATTTTACTGAGG + Intergenic
993319767 5:86458140-86458162 GACCCCTAGTAATTTAACCGAGG - Intergenic
993367537 5:87051394-87051416 GACCCCTAGACATTTTACTGAGG + Intergenic
993412640 5:87592249-87592271 GACCTCTAGAAATTTTACTGAGG + Intergenic
994855494 5:105114018-105114040 GACTCCTAGAAATTTTAATGAGG + Intergenic
994958404 5:106564002-106564024 GACCCCTAGAAATTTTACTGAGG - Intergenic
994984484 5:106916171-106916193 GACCCCTAGAAATTTTACTGAGG + Intergenic
995269630 5:110205903-110205925 GACCCCTATAAATTTTACTGAGG + Intergenic
995427800 5:112044163-112044185 GACCCCTAGAAATTTTACTGAGG + Intergenic
995776349 5:115728116-115728138 GACCCCTAGAAATTTTACTTAGG + Intergenic
996018491 5:118567418-118567440 GACCCCTAGAAATTTTGCTGAGG - Intergenic
996165023 5:120212945-120212967 GATCCCTAGAAATTTTACTGAGG + Intergenic
996290112 5:121842865-121842887 GGTCCCTTTAAATTTCACTATGG - Intergenic
996392260 5:122974191-122974213 GACCCCTAGGAATTTCACTGAGG + Intronic
996644197 5:125794843-125794865 AACCCCTAAAAATTTCAGTCTGG + Intergenic
996825494 5:127677397-127677419 GAACCCTAGAAATTTTACTGAGG - Intergenic
996908771 5:128632538-128632560 GACTCCTAGAAATTTCACTGAGG + Intronic
997890654 5:137673393-137673415 GACCCCTATTAACTTCAATAGGG - Intronic
997927926 5:138047839-138047861 GACCCCTAGATATTCCTCTAGGG + Intronic
998290396 5:140908981-140909003 GACCCCTAGAAATTTTACTGAGG + Intronic
998683002 5:144491256-144491278 GAGCACTAGAAATATCACCATGG + Intergenic
1000500854 5:162047775-162047797 GACCCCAAGAAATTTTGCTGAGG + Intergenic
1001173519 5:169444205-169444227 GACCACTAGAAATTTGACTGAGG - Intergenic
1001896154 5:175383259-175383281 GAACCCAAGAAACATCACTATGG + Intergenic
1002831618 6:826980-827002 TACTCCTAGAAACTTCACTAAGG - Intergenic
1002997896 6:2304312-2304334 GACTCCTAGAAATTTTACTGAGG - Intergenic
1003469983 6:6420512-6420534 GGCCCCTAAAAATTTCACTAAGG + Intergenic
1003758547 6:9149642-9149664 GATCCCTAGAAATTTTACTGAGG - Intergenic
1004298531 6:14436250-14436272 GATGCCTAAAACTTTCACTAAGG - Intergenic
1005185102 6:23156635-23156657 GACCACTAGAAATTTTACTGAGG - Intergenic
1005578071 6:27208562-27208584 GACACCTAGAAATTTCACTGAGG - Intergenic
1006001497 6:30968641-30968663 GACCCCTAGAAATTTTACTGAGG - Intergenic
1006005210 6:30996471-30996493 AACCCCTAAAAACTTCACTGTGG - Intergenic
1006900196 6:37495096-37495118 GGCCCCTACAAATTTCTATAAGG + Intronic
1007498588 6:42279057-42279079 GACCCCAAGGAATGTCACAAGGG + Intronic
1008400223 6:51055034-51055056 GACCTTTAGAAATTTTACTGAGG - Intergenic
1008820337 6:55624715-55624737 GACCCCTAGAAATTTGACTGAGG - Intergenic
1009390179 6:63135515-63135537 GACCCCTAGAAATTTTACTAAGG + Intergenic
1009687288 6:66978678-66978700 GGCCCTTCGAAATTTCACTGAGG - Intergenic
1009851722 6:69207511-69207533 GATCCCTAGAAATTTTACTGAGG + Intronic
1009851989 6:69209395-69209417 GGCCCCTAGAAATTTTACTGAGG + Intronic
1010108065 6:72191347-72191369 GACCCCTAGAAATTTTACTGAGG + Intronic
1010208397 6:73343244-73343266 GACCCCTATTAACTTCAGTAAGG - Intergenic
1010323516 6:74540057-74540079 GGCCCTTAGAAATTTTACTAAGG - Intergenic
1010325391 6:74557029-74557051 GACCCCTAGAAATTTTACTGAGG + Intergenic
1010818566 6:80387966-80387988 ACCCCCTAGAAATTTTACTGAGG - Intergenic
1010854149 6:80815899-80815921 GATCCCTAGAAATTTCACTGAGG + Intergenic
1010938308 6:81886851-81886873 GACCCCTAGAAATTGTACTGAGG + Intergenic
1011039417 6:83013716-83013738 GACCCCTGGAAATTTTACTGAGG + Intronic
1011069032 6:83361229-83361251 GACCACTAGAAATTTTACTGAGG - Intronic
1011136647 6:84107374-84107396 GACCCCTAGAAATTTCAGTGAGG + Intergenic
1011573302 6:88763728-88763750 GACCCCTAGAAATCTTACTTAGG - Intronic
1011948780 6:92938178-92938200 GACCCCTATTAACTTCAGTAGGG + Intergenic
1012108637 6:95198173-95198195 GACCCCTAGGAATTTTACTGAGG + Intergenic
1012226049 6:96704378-96704400 GACCCCTAAAAATTTCCCTGAGG - Intergenic
1012344520 6:98169883-98169905 GACCCCTAGACATTTTACTGAGG - Intergenic
1012820737 6:104082481-104082503 GACCCCTAGAAATTTTACTGAGG - Intergenic
1012920862 6:105219982-105220004 GACCCCTAGAAATTTTACTGAGG + Intergenic
1014265629 6:119274038-119274060 GACCTCCTGAGATTTCACTATGG + Intronic
1014363465 6:120508789-120508811 GACCCCTAGAGATTTTACTTAGG + Intergenic
1014416926 6:121194954-121194976 GACCCCTAGACATTTTACTGAGG - Intronic
1014534263 6:122597067-122597089 GACCCCTAGAAATTTTACTGAGG + Intronic
1014895614 6:126896136-126896158 GGGCCCTAGAAATTTCACCGAGG - Intergenic
1015084889 6:129278572-129278594 GACCCAAAGACAGTTCACTATGG - Intronic
1015466914 6:133558155-133558177 GACCCCTAGAAGTTTTACTAAGG + Intergenic
1015475685 6:133657054-133657076 GACCCCTGGAAATTTTACTGAGG - Intergenic
1016132878 6:140498391-140498413 GACCCCTAGAAATTTCACTGAGG + Intergenic
1016144227 6:140648966-140648988 GACCCCTAGAAATTTTACTGAGG - Intergenic
1016174971 6:141069519-141069541 GGCCCTTAGAAATTTCACTGAGG + Intergenic
1016368584 6:143345434-143345456 CAGCCCTAGAAACTTCACAAAGG - Intergenic
1016419678 6:143871117-143871139 GACCCCTAGAAATTTTATTGTGG + Intronic
1016576321 6:145573023-145573045 GACTTCTAGAAATTTTACTGAGG + Intronic
1017227874 6:152041525-152041547 GACCCCTAGAAGTTTTACTGAGG + Intronic
1017977183 6:159368493-159368515 GACCCCTAGAAATTTTACTGAGG + Intergenic
1018107403 6:160502235-160502257 AACCGCTAGAAATTTTACTGAGG + Intergenic
1018122993 6:160655659-160655681 GAACCCTAGAAATTTTACCGAGG + Intronic
1018535085 6:164810925-164810947 GACCCTTAGAAATTTCACTGAGG + Intergenic
1018599817 6:165527089-165527111 GACCCCTAGAAATTTTACTGAGG - Intronic
1019003074 6:168771652-168771674 GATCCCTAGAAATTTCACTGAGG - Intergenic
1020396649 7:7725078-7725100 GACGCCTAGAAATTTTACTGAGG - Intronic
1020710278 7:11597189-11597211 GACCCCTAGAAATTTTACTGAGG - Intronic
1022078827 7:26999896-26999918 GACCCCTAGAAATTTTACTGAGG - Intergenic
1022346145 7:29516404-29516426 GACCCCTATTAACTTCAGTAGGG - Intergenic
1023883705 7:44335743-44335765 GCCCCCTAGCAATTTCTCTCTGG - Intergenic
1024040471 7:45549706-45549728 GACCCCTAGAAATTTTACTGAGG - Intergenic
1024491889 7:49995049-49995071 AACCCCTAGAAATTTCACTGAGG + Intronic
1024744135 7:52388000-52388022 GACCCCTAGAAATTTCACTGAGG - Intergenic
1024866032 7:53905904-53905926 GACCCCTAGACATTTTACTGAGG - Intergenic
1024884403 7:54125079-54125101 AACCCCTAGAAATTTTACTGAGG + Intergenic
1024958318 7:54949517-54949539 GACCCCTAGAAATTTTACTGAGG + Intergenic
1028043798 7:86091030-86091052 GACCCCTAGAAATTTTACTGAGG - Intergenic
1028141673 7:87281547-87281569 GATCCCTAGAAATTTTACTGAGG - Intergenic
1028237761 7:88382395-88382417 GACCCCTAGAAATTTTACTGAGG - Intergenic
1028502656 7:91536005-91536027 GACCCCTATTAACTTCAATAGGG - Intergenic
1029335541 7:99896602-99896624 GACCCCTATTGATTTCAGTACGG - Intronic
1029961187 7:104690611-104690633 GACCCCTAGAAATTTCAATGAGG - Intronic
1030277388 7:107735675-107735697 GACCCCTAGAAATTTTGCTGAGG - Intergenic
1030368693 7:108673590-108673612 GACCCCTAGAAATTTTACTGAGG - Intergenic
1030457528 7:109793490-109793512 GACCCCTAGAAACTTTACTGAGG + Intergenic
1031120231 7:117713757-117713779 GACCCCAAGAGATTTCACTTTGG - Intronic
1031474510 7:122205786-122205808 AAACCCTAGAAATTTTACTGAGG + Intergenic
1031537977 7:122958674-122958696 AACTCCTAGAAATTTCATTAAGG + Intergenic
1031628699 7:124020520-124020542 GAACCCTAGAATTTTCAAGAGGG - Intergenic
1031676497 7:124617911-124617933 AACCCCTAGGAATTTTACTAAGG - Intergenic
1031767767 7:125803281-125803303 GACCTGTAGGAATTTTACTAAGG - Intergenic
1031779196 7:125940823-125940845 GACCCCTAGAAATTTTACTGAGG - Intergenic
1032923485 7:136576236-136576258 GACCCCTAGAAATTTTACTGAGG + Intergenic
1033729860 7:144167293-144167315 GGACCTCAGAAATTTCACTAGGG - Intergenic
1036527401 8:9547951-9547973 GACCCCTAGAAACTTCACTGGGG + Intergenic
1037364654 8:18108693-18108715 GACCCCCAGAAATTTTACTGAGG + Intergenic
1038454539 8:27664073-27664095 GACCTCTGGAAATTTCACTGAGG + Intronic
1038723320 8:30057602-30057624 GACTCCTAGAAATTTCCCTGAGG + Intergenic
1038857509 8:31349571-31349593 GACCCCTACAAGCTTCACTGGGG - Intergenic
1039130456 8:34258160-34258182 GAACCCTAGAAATTTCCCTGTGG - Intergenic
1039626593 8:39060588-39060610 GACATGTAGAAATTTCACTGAGG + Intronic
1040911902 8:52528112-52528134 GACCCCTAAACATTTTACTGAGG - Intergenic
1041499897 8:58529373-58529395 AACCCCTAGTAATTTTAATAGGG + Intergenic
1041934491 8:63320891-63320913 GACCCCTAGAAATTTTATTTAGG - Intergenic
1041986120 8:63924034-63924056 GACCCCTAGAAATTTTACTGAGG - Intergenic
1042001125 8:64124436-64124458 GACCACTAGAAATTTTACTGAGG + Intergenic
1042342371 8:67693915-67693937 GATCCCTAGAAATTTCACTGAGG - Intronic
1042575053 8:70208642-70208664 GAGCCCTAGAATTTTCAGAATGG - Intronic
1043257938 8:78158929-78158951 TACCCCTAGAAATTTTACTGAGG - Intergenic
1043566246 8:81551791-81551813 GACCCCTAGTGACTTCAATAGGG + Intergenic
1043946554 8:86260572-86260594 GACCCCTATTAACTTCAGTAGGG + Intronic
1044133697 8:88558556-88558578 GACCCCCAGATATTTCACTGAGG - Intergenic
1044202330 8:89452049-89452071 GACCCCCAGAAATTTTACTGAGG - Intergenic
1044286024 8:90412885-90412907 TACCCCTAGAAGTTTTACTGAGG + Intergenic
1044369380 8:91390674-91390696 GAACTCTAGAAATTTCCATAAGG - Intronic
1044487214 8:92767562-92767584 GACCCCTAGAAATTTTACTAAGG + Intergenic
1044633217 8:94298830-94298852 GATCCCTAGAAATTTTACTGAGG + Intergenic
1044793351 8:95870781-95870803 GGACCCTAGAAATTTTACTGAGG + Intergenic
1046012182 8:108562581-108562603 GAACCACAGAAATGTCACTAGGG + Intergenic
1046197495 8:110883784-110883806 GACCCCTAGAAATTTTACTGAGG - Intergenic
1046384769 8:113495068-113495090 GAATCCTAGAAATTTCACTGAGG - Intergenic
1046417707 8:113938252-113938274 GACCCCTAGAAATTTTACTGAGG + Intergenic
1046510273 8:115193629-115193651 TACCCAAAGTAATTTCACTATGG + Intergenic
1046585837 8:116148072-116148094 GACCCCTAGAAATTTTACTGAGG + Intergenic
1047453570 8:124988904-124988926 GACCCCTAGAAATTTCACTGAGG - Intergenic
1047995256 8:130328985-130329007 GACCATTAGAAATTTGATTAAGG - Intronic
1048083910 8:131157281-131157303 GACCCCTAGGAATTTTACTGAGG + Intergenic
1048910140 8:139127256-139127278 AACCTCTAGAAATTCCACTGAGG + Intergenic
1050067470 9:1775495-1775517 GACTCCTAGAAACCTCACTGAGG + Intergenic
1050482608 9:6102169-6102191 GACCCCTAGAAATTTTGCCGAGG - Intergenic
1050487199 9:6146905-6146927 GACCCCTAGAAATTTCCTCAAGG + Intergenic
1050888907 9:10798171-10798193 GGATCCTAGAAATTTCACTTAGG + Intergenic
1051103151 9:13546049-13546071 GACACCTAAAAATTAGACTATGG - Intergenic
1051882081 9:21850223-21850245 ACCCCCTAGAAATTTTACTGAGG - Intronic
1052042879 9:23759840-23759862 GTCCCCAAGAAATTCCACAATGG - Intronic
1052227531 9:26107936-26107958 GCCCCTTAGAAATTTTACTGAGG - Intronic
1052368581 9:27640397-27640419 GACCCCTAGAAATTTTACTGAGG - Intergenic
1052659130 9:31405522-31405544 GAGCCCCAGAAATTTCAGTCTGG - Intergenic
1053339965 9:37317130-37317152 GACATTCAGAAATTTCACTATGG - Intronic
1053350941 9:37412859-37412881 GAGCCCTAGAAATCTGACCACGG + Intergenic
1054843928 9:69772432-69772454 GACTCCTAGAAACTTCACTAAGG + Intergenic
1056156594 9:83844769-83844791 GACCCCTAGAAATTTTACTGAGG - Intronic
1056314302 9:85373383-85373405 GACCCCTAGAAATTTTACTGAGG + Intergenic
1056353942 9:85778757-85778779 GACCCCTAGAAATTTTACTGAGG + Intergenic
1058259328 9:102810143-102810165 GGCCCCTAGAAATTTTACTGAGG + Intergenic
1058544234 9:106043187-106043209 GATCCCCAGAAATTTTACTAAGG + Intergenic
1058982190 9:110180484-110180506 GACACTTAGAATTGTCACTAGGG - Intergenic
1059017577 9:110536574-110536596 CACCCCTTCAAATTTTACTAGGG + Intronic
1059961182 9:119566126-119566148 TACCCCTTTAAATTTCACTGTGG + Intergenic
1060805205 9:126571121-126571143 GACCCCTAGAAATTGCACTGAGG + Intergenic
1186279429 X:7976680-7976702 GACCTCTAAAAATTTTACTGAGG - Intergenic
1186384163 X:9092200-9092222 GACCCCTAGAAATTCCGCTGAGG + Intronic
1186469833 X:9812534-9812556 GACCCCTAGAAATTTTACTGAGG + Intronic
1188759975 X:34015012-34015034 GACCCCTAGACATTTCACTGAGG + Intergenic
1189032502 X:37464748-37464770 GACCCCTAGAAATTTCACTGAGG + Intronic
1189466661 X:41282724-41282746 GTCCCATAGAAATTACCCTAGGG + Intergenic
1189826023 X:44918584-44918606 TTCTCCTAGAATTTTCACTATGG - Intronic
1190145828 X:47890873-47890895 GACCCCTAGAAATTTCCCTGAGG + Intronic
1190255126 X:48756758-48756780 GACTCCTAGAAATTTCACTGAGG - Intergenic
1190721795 X:53154866-53154888 ATGCCCTAGAAATTTCACTGAGG + Intergenic
1191095769 X:56671614-56671636 GACTCCTAGAAACTTTACTGAGG + Intergenic
1191226675 X:58051244-58051266 GATGCCTATAAATTTCACTGAGG - Intergenic
1191630100 X:63313027-63313049 GACCCCTAGAAATTTCACTGAGG + Intergenic
1191631249 X:63324451-63324473 GACCCTTAGAAGTTTCACTAAGG - Intergenic
1191658866 X:63630246-63630268 GAACCCTAGAAATTTTACTGAGG + Intergenic
1191719308 X:64216149-64216171 GACCCCTAGAAATTTTACTGAGG + Intergenic
1191742600 X:64451745-64451767 GGCCCCTAGAAATTTTACTGAGG + Intergenic
1191759304 X:64629484-64629506 GACCCCTAGAAATTTTACTGAGG - Intergenic
1191769562 X:64740537-64740559 GAACCCTAGAAATTTTACTGAGG + Intergenic
1191832783 X:65432762-65432784 GACCCCAAGAAATTTGACTTGGG + Intronic
1191941320 X:66484305-66484327 GACCCCTAGAAATTTTACTGAGG + Intergenic
1191946295 X:66538570-66538592 GACCCATAGATATTTAACTGAGG - Intergenic
1191988255 X:67005086-67005108 GGCCTCTAGAAATTTTACTGAGG + Intergenic
1192297768 X:69868456-69868478 GACCCCTAGAAATTTTACTGAGG + Intronic
1192555857 X:72088615-72088637 GACCCCAGAAAATGTCACTAAGG - Intergenic
1192657963 X:73012179-73012201 GACCTCTAGAAATTTCACTAAGG + Intergenic
1192661628 X:73048202-73048224 GACCTCATGAAATTTCACTGAGG + Intergenic
1192673320 X:73168856-73168878 GACCCCTGGGAATTTTACTGAGG + Intergenic
1192996140 X:76515139-76515161 AACCCCTAGAAATTATACTGAGG - Intergenic
1193187326 X:78528787-78528809 GACCCCTGGAAATTTCACTGAGG - Intergenic
1193297717 X:79852252-79852274 GGCCCTTAGAAATTTTACTGAGG - Intergenic
1193447092 X:81618338-81618360 GACCCCGAGAAATTTTACTGAGG - Intergenic
1193832887 X:86309661-86309683 AACCCCTAGAAATTTTACTGAGG - Intronic
1193841471 X:86413071-86413093 TACCCCTAGAAATTTTACTGAGG + Intronic
1193877215 X:86874870-86874892 GACCTCTAGAAATTTTACTGAGG - Intergenic
1193904421 X:87225390-87225412 TACTCCTAGAAATTTTACTGAGG - Intergenic
1193914867 X:87352374-87352396 GACCCCTAGAAATTTTGCTGAGG + Intergenic
1193957061 X:87876565-87876587 GGCCCCTAGACATTTTACTGAGG - Intergenic
1194072329 X:89341037-89341059 GTTCCCTAGAAATTTCACTGAGG + Intergenic
1194189772 X:90820710-90820732 AACCCCCAGAAATTTTACTGAGG - Intergenic
1194210211 X:91061915-91061937 GATCCCTAGAAATTTTACTGAGG - Intergenic
1194443484 X:93960664-93960686 GACCCCTAGGAATTTTACTGAGG - Intergenic
1194464728 X:94219459-94219481 GACCCCTATTAACTTCAGTAGGG + Intergenic
1194513481 X:94822681-94822703 GACTCCTAGAAATTTTACTGAGG + Intergenic
1194604453 X:95962418-95962440 GACCCCTAGAAATTTTACTGAGG + Intergenic
1194833888 X:98658363-98658385 GACCCCCATAAATTTTACTGAGG - Intergenic
1194849315 X:98852620-98852642 GGCCCCTAGAAATTTTGCTGAGG + Intergenic
1195782426 X:108480306-108480328 GACCCCTAGAAATTTTACTGAGG + Intronic
1196114526 X:111984533-111984555 GACTCCAAGAAATTTTACTGAGG + Intronic
1197084266 X:122453940-122453962 GACCCCTAAGAATTTCATTGAGG + Intergenic
1197097408 X:122612398-122612420 GGCCACTAGAAATTTCCCTAAGG - Intergenic
1197111205 X:122777295-122777317 GAGTTCTAGAAATTTCTCTAAGG - Intergenic
1197245111 X:124159435-124159457 GACTCCTAGAAATTTTATTGAGG + Intronic
1197330844 X:125152529-125152551 TCCCCTTAGAAATTTCCCTATGG - Intergenic
1197372116 X:125638296-125638318 CACCCCTAGAAATTTCACTGAGG + Intergenic
1197380067 X:125728345-125728367 GATCCCTAGAAATGTTACTGAGG + Intergenic
1197386879 X:125813133-125813155 GACCCCTAGGAATTTTACTGAGG + Intergenic
1197405027 X:126038757-126038779 GATCCCTAGAAATTTTACTGAGG - Intergenic
1197409387 X:126096856-126096878 GACCCCTAGAAATTTTACTGAGG + Intergenic
1197425804 X:126296054-126296076 GACTCCTACAAATTTTACTGAGG + Intergenic
1197477428 X:126941770-126941792 TACCCCTAGAAATTTTACTGAGG + Intergenic
1197534679 X:127673030-127673052 GACCCCTAGAAATTTTCCTGAGG - Intergenic
1197554318 X:127935976-127935998 GGGCCCTAGAAATTTTACTGAGG + Intergenic
1197591804 X:128418952-128418974 GACTCCTAGAAATTTTACCGAGG - Intergenic
1198169949 X:134095814-134095836 GATCCCTAGAAATTTCACTGAGG - Intergenic
1198607063 X:138352560-138352582 GAGCCCTAGAATTTTCAGAACGG - Intergenic
1198701224 X:139399856-139399878 GACTCCTAGAAATTTTACTGAGG - Intergenic
1198783109 X:140258232-140258254 GACTCCTAGAAATTTTACTGAGG + Intergenic
1198933975 X:141887445-141887467 CACCCCTAGAAATTTGACTGAGG - Intronic
1199024312 X:142919278-142919300 GGCCCCTAGAAATTTTACTGAGG - Intergenic
1199144504 X:144349405-144349427 AACCCCTAGAAATCTTACTGAGG + Intergenic
1199310490 X:146314853-146314875 GACTCCTAGAAATTTTACTAAGG + Intergenic
1199371667 X:147056892-147056914 GCCTCCTAGAAATTTCACTTGGG + Intergenic
1199627091 X:149750709-149750731 GACCCCTAGAAATTTTACTGAGG + Intergenic
1200536354 Y:4402594-4402616 AACCCCCAGAAATTTTACTGAGG - Intergenic
1200726571 Y:6676787-6676809 GTTCCCTAGAAATTTCACTGAGG + Intergenic
1200727723 Y:6692563-6692585 GTTCCCTAGAAATTTCACTGAGG + Intergenic
1200973179 Y:9178149-9178171 GACCCCTAGGAATATTACTGAGG + Intergenic
1202137900 Y:21686364-21686386 GACCCCTAGGAATATTACTGAGG - Intergenic
1202359696 Y:24094953-24094975 GACCCCTAGAAATTTTACTGAGG - Intergenic
1202511082 Y:25575161-25575183 GACCCCTAGAAATTTTACTGAGG + Intergenic