ID: 1179458439

View in Genome Browser
Species Human (GRCh38)
Location 21:41515886-41515908
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 2, 1: 5, 2: 14, 3: 76, 4: 405}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179458439_1179458447 12 Left 1179458439 21:41515886-41515908 CCATGCCCACCTTGCCTTTGGCA 0: 2
1: 5
2: 14
3: 76
4: 405
Right 1179458447 21:41515921-41515943 CACTTGGCCCCTGCTACCTTGGG 0: 1
1: 45
2: 142
3: 179
4: 287
1179458439_1179458444 -4 Left 1179458439 21:41515886-41515908 CCATGCCCACCTTGCCTTTGGCA 0: 2
1: 5
2: 14
3: 76
4: 405
Right 1179458444 21:41515905-41515927 GGCAGTTGAGTGCTTCCACTTGG 0: 1
1: 2
2: 39
3: 93
4: 255
1179458439_1179458446 11 Left 1179458439 21:41515886-41515908 CCATGCCCACCTTGCCTTTGGCA 0: 2
1: 5
2: 14
3: 76
4: 405
Right 1179458446 21:41515920-41515942 CCACTTGGCCCCTGCTACCTTGG 0: 7
1: 72
2: 93
3: 107
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179458439 Original CRISPR TGCCAAAGGCAAGGTGGGCA TGG (reversed) Intronic
900416540 1:2537750-2537772 GGCCCGAGGAAAGGTGGGCAGGG + Intergenic
900605027 1:3520032-3520054 TCCCAAAGGCCTGATGGGCATGG + Intronic
900926914 1:5711703-5711725 TGCCACCGGCAAGGTCTGCATGG + Intergenic
902192256 1:14772126-14772148 TGCCAAATGCAAGATGAGAAGGG - Intronic
902947212 1:19850403-19850425 TGCCTGAGGCAGGGTGGGGAAGG + Intergenic
903014634 1:20353975-20353997 GGCCAAGGGCAAGCTGGGCCTGG + Exonic
903215685 1:21842202-21842224 TGCCATGGGCAAGGGGGGAAGGG - Intronic
903286364 1:22279433-22279455 TGAGAAAGGGGAGGTGGGCAGGG + Intergenic
903315504 1:22501422-22501444 TGCCAAATGCAAGGAGCGGATGG + Intronic
904582206 1:31552722-31552744 GCCCAAGGGCAAGGTGGGAAGGG + Intergenic
904593933 1:31631177-31631199 TGCCCCAGGCAAGGTGGTCCTGG - Intronic
904741203 1:32677411-32677433 TGCATACGGCAAGGTGGGGAGGG - Intronic
905017593 1:34788182-34788204 GGCCAAAGGCAGGCTGTGCAGGG - Intronic
905279377 1:36839180-36839202 TTGCAGAGGCAAGCTGGGCAGGG - Intronic
905662127 1:39735738-39735760 TGCACAGGGCAAGGTGGGAATGG + Intronic
906037220 1:42758785-42758807 AGCTAAAGGCAAGGTGGGCAGGG - Intronic
906465262 1:46073224-46073246 TGACAAAGGCAAGGTGGACATGG - Intronic
907046080 1:51300932-51300954 TGTGACAGGCAAGGTGGCCACGG - Intronic
908407070 1:63825508-63825530 TGCCTCAGGCAAGGTGGGAATGG + Intronic
909804535 1:79858303-79858325 TCCCAAGGGTAAGGAGGGCACGG - Intergenic
911025171 1:93427886-93427908 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
912393326 1:109320006-109320028 TACCAATGCCAAGGTTGGCAGGG - Intronic
912853324 1:113145760-113145782 TGCCCAAGGCCACATGGGCAAGG + Intergenic
915535103 1:156530722-156530744 TCCCAAAGAAAAGGTGGGGATGG - Intronic
916055847 1:161068620-161068642 TGCCAAAAACAAGCTGGGCTGGG + Intronic
916253801 1:162766028-162766050 TGCCATAGGAGAGGTGGGCAGGG - Exonic
916380734 1:164207902-164207924 CACTAAAGGCAAGGTGGGCATGG + Intergenic
916425092 1:164672806-164672828 AGCCAAAGGCAATGTGAGGAAGG - Intronic
917283001 1:173397012-173397034 TGCCAAAGACAAGGTGGGCATGG + Intergenic
917297782 1:173539926-173539948 TGCCAATTGCAAAGTGGGCATGG - Intronic
917577459 1:176339016-176339038 TGCCCAAGGCAAGGGAGGCAAGG + Intergenic
918589486 1:186224214-186224236 TGCCTGAGGCAGGGTGGGGAAGG - Intergenic
919921303 1:202168100-202168122 TGGCAGAGGTAAGGTGGGCATGG + Intergenic
920351866 1:205343214-205343236 GGCCAAAGGCAAGTGGGGCCAGG - Exonic
921632923 1:217456222-217456244 TCCCAAAGCCCAAGTGGGCATGG - Intronic
921924175 1:220697994-220698016 TTCAAAGGGTAAGGTGGGCATGG + Exonic
922137041 1:222839348-222839370 TTCCACAGACAACGTGGGCAGGG - Intergenic
922141554 1:222893458-222893480 TGCCAAAGGCAAGCCAGGCATGG + Intronic
922801028 1:228364879-228364901 TGCCACAGGCAGGGTGGGTGGGG - Intronic
923548522 1:234942673-234942695 TGCAAAAAGTTAGGTGGGCATGG - Intergenic
924182677 1:241454990-241455012 CACCAAAGGCAAAGTGGGCATGG - Intergenic
924522487 1:244817031-244817053 TGCCTGAGGCAGGGTGGGGAAGG - Intergenic
1063039973 10:2327668-2327690 TGCCAAACGCAAGGTGAGGTAGG + Intergenic
1063301752 10:4855139-4855161 TGGGAAAGGCAAGGTGCTCAGGG - Intergenic
1063301756 10:4855153-4855175 TGCCTGAGGCAGGGTGGGAAAGG - Intergenic
1064234531 10:13562054-13562076 TGCCAAAGGCAGGTTTGGCTTGG - Intergenic
1065558512 10:26939719-26939741 TGACAAAGGCATGGCTGGCACGG + Intergenic
1065558733 10:26941549-26941571 TGGCAAAGGCATGGCTGGCACGG + Intergenic
1065606766 10:27426270-27426292 TGCCAAAGACAAGGTGGGTGTGG + Intergenic
1065762380 10:28994299-28994321 GGCCAAGGGCAAAGTGAGCAAGG + Intergenic
1065830485 10:29609828-29609850 TGCCAAGGGCAAGCCAGGCATGG - Intronic
1066229557 10:33419102-33419124 TGCTAATAGCAAGGTGGGTATGG + Intergenic
1066508345 10:36067538-36067560 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
1067038576 10:42936195-42936217 TGCAAAGTGCAAGGTGTGCAAGG - Intergenic
1067125825 10:43514637-43514659 CATCAAAGGCAAGGTGGGCGTGG - Intergenic
1067518793 10:46978784-46978806 AGCCAAAGGCAAGGTGAGCATGG + Intronic
1067643455 10:48073050-48073072 AGCCAAAGGCAAGGTGAGCATGG - Intergenic
1067761881 10:49054542-49054564 TGCCAAAATGAAGGTGGGCATGG + Intronic
1067820469 10:49524365-49524387 TGCCAAAGGCAAGGAGACCTTGG - Exonic
1068323822 10:55457117-55457139 TTCAAAAGGAAAGGTGGGAAGGG + Intronic
1068764282 10:60745911-60745933 TGCCACAGGCATGGTGGCCTAGG - Intergenic
1069130633 10:64697674-64697696 TGCCAAAGCCTAGGTGGAGAAGG - Intergenic
1069624723 10:69860697-69860719 GGCCACAGGCAAGGAGGGCATGG - Intronic
1069684649 10:70309830-70309852 TGCCACAGGCTTGCTGGGCATGG + Intronic
1070324591 10:75379880-75379902 ATCCAAATGCAAGGTGGGCAGGG + Intergenic
1070483826 10:76910965-76910987 TTCCAAAGCCAAGATGGGAATGG - Intronic
1070790568 10:79186935-79186957 TGCCAAGGGCCAAGGGGGCATGG - Intronic
1071569055 10:86686499-86686521 TGGGAAAGCCAAGATGGGCAAGG + Intronic
1074077424 10:110141867-110141889 TGCCAAAGCCAAGCTGAGCATGG + Intergenic
1074459573 10:113624963-113624985 TGGCAAGGGCGAGGTGGGCAGGG + Intronic
1074632680 10:115275543-115275565 TAACAAAGGCAAGGTGGGTGAGG - Intronic
1074752438 10:116599667-116599689 GGCCGAAGACAAGATGGGCATGG + Intronic
1075809171 10:125211904-125211926 TGACAAAGGCAAGGGTGGCTGGG + Intergenic
1076721396 10:132394971-132394993 GGGCAGAGGGAAGGTGGGCAGGG + Intergenic
1077195435 11:1277443-1277465 AGCCACGGGGAAGGTGGGCAGGG + Intronic
1077400919 11:2356786-2356808 CACCAAAGGCAAAGTTGGCATGG + Intergenic
1077477610 11:2797787-2797809 TGCCGAAGGCCATGTGGTCAGGG - Intronic
1077499110 11:2901314-2901336 GGCCAAAGTCCTGGTGGGCAGGG - Intronic
1078350612 11:10590078-10590100 ACCCAAAGGGAAGGTTGGCAGGG + Intronic
1079090019 11:17474391-17474413 GCCCAAACGGAAGGTGGGCATGG + Intronic
1079139550 11:17798965-17798987 TGCCAAAAGAAAGGTGGCCCTGG + Intronic
1079378095 11:19912168-19912190 TGCCAAAGACAAGATGAGCTAGG + Intronic
1079443727 11:20540409-20540431 TGCACCAGGCAAGGTGGGGAGGG + Intergenic
1081268724 11:41058425-41058447 TGCCAAGGGCAAGTCAGGCATGG - Intronic
1081795765 11:45818286-45818308 CACCAAAGGCAAGGGTGGCAAGG + Intergenic
1082001430 11:47395425-47395447 TCCCCAAGGCAAGGTGGGGCAGG - Intergenic
1082749987 11:57005206-57005228 TGCCAAGGGCAAGTCAGGCATGG + Intergenic
1083981076 11:66170645-66170667 TGGTAAAGGCTGGGTGGGCATGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1085404069 11:76251344-76251366 TGCCAAAGTCAAGTCAGGCATGG - Intergenic
1085684310 11:78607924-78607946 CACCAAAGGCAAGGTGGGAGTGG + Intergenic
1088264922 11:107979783-107979805 CATCAAAGGCAAAGTGGGCATGG + Intergenic
1088342880 11:108788930-108788952 TAACAAAGGAAATGTGGGCATGG - Intronic
1089131586 11:116216376-116216398 TGCCAAAGGCATTGTGGAGAAGG - Intergenic
1089338924 11:117744669-117744691 GGCCAAAGGCAAGGTTGGTGTGG - Intronic
1090209897 11:124911531-124911553 CATCAAAGGTAAGGTGGGCATGG - Intergenic
1090221842 11:125033349-125033371 CATCAAAGGCAAGATGGGCACGG - Intronic
1091019925 11:132090291-132090313 TGCCATAGGGAAGGTGTGAAGGG - Intronic
1091704714 12:2685982-2686004 TTCCAAAGGCAGGGTGTGCAGGG + Intronic
1091711287 12:2742321-2742343 TTCCAAAGGCAGGGTGTGCAGGG + Intergenic
1093284822 12:17245830-17245852 TGCCCATGGCAAGGAGGGCCAGG + Intergenic
1093424352 12:19011271-19011293 TCCCAAAGTCAAGGTCGGAAGGG - Intergenic
1094462654 12:30714103-30714125 TGCTAAATGCAAGGTGGGGTTGG + Intronic
1095362758 12:41363766-41363788 TAGCAAAGGCAAATTGGGCAGGG + Intronic
1095909469 12:47411438-47411460 AGCCAAAGTCAGTGTGGGCAGGG - Intergenic
1096053308 12:48629889-48629911 CTCCAAAGGCAAGGTGTACATGG + Intergenic
1096362097 12:50996807-50996829 TGCCTTAGTCAAGGTGAGCAAGG - Exonic
1097881183 12:64688003-64688025 TTCCAGAGGCAAGGTCTGCAGGG - Intronic
1098219618 12:68255004-68255026 TGCCAGGGGCTGGGTGGGCAAGG + Intergenic
1098452690 12:70637658-70637680 TGCCAAAGGAAAGGTAGGTGAGG - Intergenic
1099268129 12:80473958-80473980 CACCAAAGGCAGGGTTGGCATGG + Intronic
1099365706 12:81763685-81763707 CATCAAAGGCAAGGTGGGCCTGG + Intergenic
1099729721 12:86484772-86484794 TGCCAAAGGAAATGTGGACATGG + Intronic
1099995257 12:89771307-89771329 TACCAAAGGCAAAGTGGGTGTGG - Intergenic
1101188356 12:102305572-102305594 TGCCTATGGCAGGGTGGGGAAGG - Intergenic
1101222416 12:102655221-102655243 TACCAAAGGCAAGGTGGACGTGG + Intergenic
1102924344 12:116815486-116815508 GACCAGAGGCAAGGAGGGCAGGG - Intronic
1103133235 12:118486494-118486516 CCCCAAAGGCAAGTTGGGCATGG + Intergenic
1103242085 12:119422102-119422124 TGCTGTAGGAAAGGTGGGCAGGG + Intronic
1104623955 12:130338007-130338029 CGCCGAAGGCGAGGTGGGCGCGG + Exonic
1106418098 13:29562820-29562842 TGCTAAAGGAAATGTGGTCAAGG + Intronic
1107542669 13:41406732-41406754 TGGGAAAGGCCAGGTGGGCAAGG + Intergenic
1108841213 13:54617817-54617839 TGCCAAATGCAAGGTGATGAAGG + Intergenic
1109516045 13:63443535-63443557 TATCTAAGGCAAGGTGGGCATGG + Intergenic
1109851935 13:68076265-68076287 TGCCAAAGGCAAGCCAGGCATGG - Intergenic
1110076413 13:71250012-71250034 AGCCACAGGGAAGGTGGGCATGG - Intergenic
1110310567 13:74044554-74044576 TACCAATGGCAAGCTGGGCATGG + Intronic
1110810796 13:79808723-79808745 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
1111835629 13:93385295-93385317 TGCCATAGGCGAGGTTGGCAGGG + Intronic
1112327769 13:98454719-98454741 TGCCAAAACCACGGTGGCCATGG - Intronic
1113402473 13:110006621-110006643 GGCCAAGGGCAAGGTGGCCCTGG - Intergenic
1115130202 14:30045639-30045661 TGCCTGAGGCAGGGTGGGGAAGG - Intronic
1117342932 14:54807300-54807322 TGCAAAAGGGCAGGTGGACAAGG - Intergenic
1117772000 14:59142955-59142977 TCCCAAAGGCAGGCTGGGCACGG + Intergenic
1118163636 14:63315208-63315230 TGTCAAAGGCAAGGCTGGCCGGG - Intronic
1118767401 14:68919078-68919100 TACCAAAGGGGAGGAGGGCAGGG - Intronic
1119257031 14:73207784-73207806 TGCCAAAGGCAAGCCAGGCATGG + Intronic
1120492112 14:85191096-85191118 GGCCAAAGGAAATGTTGGCAGGG + Intergenic
1120562830 14:86017984-86018006 TGCCAAAGGCAAGATGGACATGG - Intergenic
1121201306 14:92120864-92120886 TTTAAAAGGCAAGGTGGGCCAGG + Intronic
1121549685 14:94789412-94789434 TGCCATAGTCATGATGGGCAAGG - Intergenic
1121780416 14:96618605-96618627 TGCCAAAGCCCAGGGGGACAAGG - Intergenic
1122226771 14:100285201-100285223 GGCCAAAGGCCAGGCGGGCAGGG - Intergenic
1122634504 14:103123703-103123725 TGCCAGAGGCAGGGAGGGCGGGG + Exonic
1122884359 14:104704000-104704022 AGCCAAAGGGCAGGTGGGCCTGG - Intronic
1124140461 15:27072753-27072775 TGCCAGAGGCACTGTGGGCCAGG + Intronic
1124403759 15:29375774-29375796 TGCCAAAGGCATGGTGGATGTGG + Intronic
1126078123 15:44932761-44932783 TGTCAAAGACAAGGTGGGTGTGG + Intergenic
1126215340 15:46147188-46147210 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
1126329042 15:47512243-47512265 TGCCATATGCAATGTGGGAAAGG - Intronic
1127834186 15:62776898-62776920 AGCCATGAGCAAGGTGGGCATGG + Exonic
1128111505 15:65079118-65079140 TGGCAAAAACAGGGTGGGCAAGG - Intergenic
1128587866 15:68866842-68866864 TGGCAAATGCATGGTGGTCAGGG + Intronic
1129330374 15:74824058-74824080 AGCCAAAGACAGGGTGAGCAGGG - Intronic
1129889946 15:79065400-79065422 TGCCAGTGGGCAGGTGGGCAGGG + Intronic
1130199684 15:81813436-81813458 TTCCACAGGGAAGGTGGGAATGG - Intergenic
1130251229 15:82301442-82301464 TGCCATAGGCTTGGTGGGGAGGG - Intergenic
1130411260 15:83650568-83650590 TGCCAAAGGCATGGTGTGGTGGG - Intergenic
1131516042 15:93077429-93077451 TGCCAGCAGCAAGGAGGGCATGG - Intronic
1131758016 15:95586975-95586997 TTGCAAAGGCCAGGTTGGCAAGG + Intergenic
1132414879 15:101612876-101612898 TGCCCAAGGCCATGTGGGGAGGG - Intergenic
1133312975 16:4862906-4862928 TCCCATAGTCAAGGTGGGCCTGG + Intronic
1133337713 16:5016819-5016841 AGCCAACAGGAAGGTGGGCAAGG - Exonic
1133781442 16:8942113-8942135 TGGGAAGGGGAAGGTGGGCAGGG + Intronic
1136155899 16:28381910-28381932 TGCAAAAGGCAAGGTTGGTCTGG + Intronic
1136207186 16:28733379-28733401 TGCAAAAGGCAAGGTTGGTCTGG - Intronic
1136564840 16:31063696-31063718 AGCCAATGGGAAGGTGGGCATGG - Intronic
1137750578 16:50858487-50858509 TGCTGAAGGCCAGCTGGGCATGG + Intergenic
1138099266 16:54239106-54239128 TGCTCAAGGCCAGGAGGGCAAGG + Intergenic
1138246609 16:55471267-55471289 TGACAAAACCAAGGAGGGCAGGG + Intronic
1138320090 16:56104414-56104436 TACCAAGGGCAAAGTGGGCTTGG - Intergenic
1138382791 16:56615173-56615195 TGCCAAAGGCAGCATGGGCCTGG - Intergenic
1138482231 16:57311054-57311076 AGCCAGAGACACGGTGGGCAGGG + Intergenic
1138548737 16:57735710-57735732 TGCGGGAGGCAAGGTGGGCGGGG + Exonic
1139463504 16:67141554-67141576 TGCCAAGGGCAAGCCAGGCATGG + Intronic
1139955786 16:70692370-70692392 TGCCACAGACAGGGTGGGGAGGG + Intronic
1140968293 16:79988432-79988454 TTTCAAAGGCAAGTAGGGCAGGG + Intergenic
1141417000 16:83883372-83883394 TCCAATAGGCAAGGTGTGCATGG + Intergenic
1141535593 16:84677674-84677696 TGCAAAAGGCATGATGGCCAGGG + Intergenic
1142080073 16:88144197-88144219 GGCCAAAGGCGTGGTGGGGAGGG + Intergenic
1142102994 16:88285478-88285500 TGCCACAGCCAGCGTGGGCAGGG + Intergenic
1142175673 16:88643883-88643905 TGCCAAGGGCAGGGAAGGCAGGG + Intronic
1203123952 16_KI270728v1_random:1560153-1560175 TGCCAAAGCCAAGGCTGGCCAGG - Intergenic
1142669446 17:1480955-1480977 TGCCAAAGCCCAGGAGTGCAGGG - Intronic
1142712260 17:1730073-1730095 GGCCAGAGGGAAGGTGGCCAGGG + Intronic
1143609871 17:8012091-8012113 TGCCCAGGGCAATGTGGGGAAGG - Intronic
1143949918 17:10624262-10624284 TGGCAAAGGCCCGGTGGGGAGGG - Intergenic
1143953012 17:10648336-10648358 TGCTTTAGGCAGGGTGGGCAGGG - Intronic
1144149659 17:12431019-12431041 TGCAAAAGGCCAGATGGGCTTGG - Intergenic
1144185046 17:12789401-12789423 GGACAGAGGAAAGGTGGGCACGG + Intergenic
1144783233 17:17818124-17818146 AGCCAAGGGTGAGGTGGGCAGGG + Intronic
1148809084 17:50279012-50279034 GGCCAGAGGCAAGGTGGGGATGG - Intronic
1149553265 17:57555538-57555560 TATCAAAGGAAAGGTGGGTAGGG - Intronic
1150711371 17:67533306-67533328 TGCAGAATGCAAGGTGGGGAGGG - Intronic
1151664931 17:75540396-75540418 GGACCAAGGCAGGGTGGGCATGG - Intronic
1151761260 17:76104400-76104422 GGCCAGAGGCAGGGTGGGCAGGG - Intronic
1152137692 17:78514647-78514669 TGGTAAAGCCAATGTGGGCAGGG - Intronic
1153993510 18:10420400-10420422 AGCCAAAGGGAAGCTGGGGAGGG + Intergenic
1154273532 18:12940247-12940269 TGCCAAAAGCAAGGAGAGCATGG - Intergenic
1155822619 18:30397567-30397589 TACCAATGGCAAGGTGGGCATGG - Intergenic
1156002007 18:32395571-32395593 TGCAAAAGGCAATGAGGGAATGG + Intronic
1157439114 18:47696827-47696849 TGCCAAGGAGAGGGTGGGCAGGG - Intergenic
1157845950 18:51004200-51004222 CATCAAAGGCAAGGTGGGCATGG + Intronic
1158227136 18:55213184-55213206 TGCCAAAGGCAAGGTGGGCAAGG - Intergenic
1158404610 18:57150201-57150223 TGCCAAACTCATGGTGGGAACGG - Exonic
1160364152 18:78309672-78309694 AGACAAAGGCAGGGTGGGCGCGG + Intergenic
1161425633 19:4201273-4201295 GGTCACAGGCATGGTGGGCAGGG + Intronic
1161780348 19:6287514-6287536 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
1162444343 19:10713050-10713072 TGCCCGGGGCAAGGTGGGCGGGG + Intronic
1162450214 19:10749870-10749892 TGCCCATGGCCAGGTAGGCAGGG + Intronic
1162632173 19:11937149-11937171 TGCCAAATCCAAGGTTGTCATGG + Intronic
1163527973 19:17832775-17832797 TGGGCAAGGTAAGGTGGGCAGGG - Exonic
1164305268 19:24000643-24000665 TGGCAATAGCAAGGTGGGCAGGG + Intergenic
1165337850 19:35185036-35185058 TGCCAAAGATAAGGTAAGCATGG + Intergenic
1166756560 19:45195883-45195905 TGAAAAAGGCAGGCTGGGCACGG - Intronic
1167850229 19:52195616-52195638 ACCCAAAGGCAGGGTGGTCATGG - Intronic
1168168274 19:54569953-54569975 CACCAAAGGCAAGGTGGGTTTGG + Intergenic
925293651 2:2764179-2764201 GGCCAGAGGCTAGGTGGGCCTGG - Intergenic
925868263 2:8247550-8247572 TGCCCAGGGCAGGGTGGGCTGGG - Intergenic
926070381 2:9884030-9884052 TGCCAAGGGCAAGTCAGGCATGG + Intronic
926747142 2:16168092-16168114 TGCAAAAGGCAGGGTCAGCAAGG + Intergenic
926904245 2:17791145-17791167 TGCCAAGGGCCAGGGGAGCAAGG - Intronic
927189663 2:20508957-20508979 TCCCAAAGTCAAGGTTAGCATGG + Intergenic
927557365 2:24045295-24045317 TTTCAAAGGCAAGGAAGGCAGGG + Intronic
929407389 2:41658405-41658427 GGTCTAAGGGAAGGTGGGCATGG - Intergenic
929819191 2:45259738-45259760 CCCCAAAGGGAAGGTGGGCAGGG + Intergenic
930151090 2:48060904-48060926 TGCCTGAGGCAGGGTGGGGAAGG + Intergenic
931017884 2:58006668-58006690 TCTCCAAGGCAAGGTGGGTATGG + Intronic
931628095 2:64275044-64275066 TGCCAAGAGAAAGGTGGTCATGG - Intergenic
932055065 2:68435000-68435022 TGGCAAAAGCACAGTGGGCATGG + Intergenic
932454660 2:71841548-71841570 TGCCAAAGCCAAGGTGGATAGGG - Intergenic
932837806 2:75053595-75053617 TGCCAAGCGCAAGGTGAGCAGGG - Exonic
932918578 2:75883584-75883606 TGCCAAGGGCAAAGGGGTCAAGG + Intergenic
933443754 2:82350174-82350196 TCCCAAAGCCGAAGTGGGCATGG - Intergenic
933801017 2:85960588-85960610 TGCCAAGGGCAAGTCAGGCATGG + Intergenic
934700033 2:96431529-96431551 TGCCAAGGGCAAGTCAGGCATGG - Intergenic
934706740 2:96486454-96486476 TGGCAAAGGCAAGGTGTGCTGGG - Intergenic
935701597 2:105817018-105817040 TGTCAAAGGATAGCTGGGCATGG + Intronic
935811309 2:106800234-106800256 TGTAAAAGGCCAGGTAGGCATGG + Intergenic
936450002 2:112626782-112626804 TGCCCACTGCAGGGTGGGCATGG + Intergenic
937257050 2:120563162-120563184 GGCCCAAGGAAAGGTGGGAAAGG + Intergenic
937345914 2:121125168-121125190 TGCAAAAAACTAGGTGGGCATGG + Intergenic
937966346 2:127514528-127514550 TGCCAAGGGCTTGGTGAGCAGGG - Intronic
938096313 2:128466502-128466524 TGCCAAGGGCAAGCCAGGCATGG + Intergenic
938215452 2:129509059-129509081 AACCAAAGGCAAGGTGGGTGTGG + Intergenic
938721974 2:134075443-134075465 TGCCAAGGGCAAGCCAGGCATGG + Intergenic
939213591 2:139210144-139210166 TGTAAACAGCAAGGTGGGCATGG + Intergenic
939755058 2:146099999-146100021 TGCCAAAGACAAGGTGGGCATGG + Intergenic
939887919 2:147701343-147701365 TCCCAAATGCAAGGAGGGCAAGG + Intergenic
940276774 2:151948042-151948064 TGCATAAGGCAATGTGGGTATGG + Intronic
941232645 2:162930640-162930662 TGGTAAAGGCAAAGCGGGCAGGG - Intergenic
941993738 2:171581864-171581886 TGCCAAAAGTTAGCTGGGCATGG - Intergenic
941999005 2:171627643-171627665 TGCCAAAGGCAAGCCAGGCAGGG - Intergenic
942007846 2:171724797-171724819 AGCAAAAGAAAAGGTGGGCAGGG + Intronic
942839274 2:180340138-180340160 AGCCACAGCCAAGGTGAGCATGG + Intergenic
943466600 2:188236173-188236195 TGCCTGAGGCAGGGTGGGGAAGG - Intergenic
943656441 2:190513605-190513627 TGCAGCAAGCAAGGTGGGCATGG - Intronic
943994776 2:194748187-194748209 TGCCAAAGAAGAGGTGAGCATGG - Intergenic
944583825 2:201156314-201156336 TGGGAAATGCAAGGTGGACAAGG - Intronic
944626000 2:201569463-201569485 TACCAAAGGCAAGGTGGGCATGG - Intronic
945308240 2:208280913-208280935 CGCCAAAGACAAGGTGGGCATGG - Intronic
945641930 2:212442052-212442074 CATCAAAGGCAAGGTGGGCATGG + Intronic
945904398 2:215574907-215574929 TGCTACAGGCAAGGTGAGTAGGG - Intergenic
1169880632 20:10342407-10342429 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
1170458507 20:16554973-16554995 TGCCAAGGGCAAGCCAGGCATGG - Intronic
1170611185 20:17915013-17915035 GCCCAAGGGCAATGTGGGCAGGG - Intergenic
1171093029 20:22304085-22304107 CGCAAAAGGGAAGGTAGGCATGG + Intergenic
1172102860 20:32496035-32496057 TGCCAGAGGGAAGCAGGGCAGGG - Intronic
1172347154 20:34210537-34210559 TGCCAAAGGCAAGCCAGGCATGG - Intronic
1172447950 20:35002903-35002925 TTCTGAAGGAAAGGTGGGCATGG + Exonic
1172469229 20:35178939-35178961 TGCCAAGCGCAAGCTGGGCACGG + Intergenic
1173569422 20:44066934-44066956 GGCCAAGGGCAACGTGGACAGGG + Intronic
1173812096 20:45962236-45962258 GGCCACAGGCATGGTGGGGACGG - Intronic
1173821304 20:46022085-46022107 GGCCAAACGCGAGGTGGGCGTGG + Intronic
1173869087 20:46330553-46330575 TGCCAAAGGCAGGGCAGGGATGG - Intergenic
1173884422 20:46445140-46445162 TGCCAAAGGCAAGTCAGGCATGG + Intergenic
1174102730 20:48139556-48139578 TGCCAAATCCAAGATGGGGATGG - Intergenic
1174130533 20:48340822-48340844 TGCGGGAGGCAAGCTGGGCAGGG - Intergenic
1174774588 20:53332066-53332088 TGCAGAAGGCAGGGTGGGGAAGG + Intronic
1176106732 20:63393166-63393188 TGACACAGGCAAGGTGAACATGG + Intergenic
1176407719 21:6430483-6430505 TGCCAAACTCAGGGTGGGCGGGG + Intergenic
1178169088 21:30018452-30018474 TGCCAAGGCCAAGATGGACATGG - Intergenic
1178182728 21:30182190-30182212 TGCCAATTGCAAGGTGGAAAAGG - Intergenic
1178367421 21:31999133-31999155 TGTCAAAGGCAAGGTTCACAGGG - Exonic
1179223109 21:39427099-39427121 TGCAAGATGCAAGGTGGACATGG + Intronic
1179426309 21:41281367-41281389 TGTCAAAGGCTAGGTTGCCAAGG - Intronic
1179458439 21:41515886-41515908 TGCCAAAGGCAAGGTGGGCATGG - Intronic
1179641021 21:42747302-42747324 TGCAAAAGGCAGGGTGGGGGTGG + Intronic
1180840548 22:18956999-18957021 TGCTGGAGGCAAGGTGGGCGTGG + Intergenic
1181060945 22:20281775-20281797 TGCTGGAGGCAAGGTGGGCGTGG - Intronic
1182686211 22:32122983-32123005 TGCCAGAGGCAGGGAGTGCATGG + Intergenic
1183839390 22:40485511-40485533 GGCAAAAGGAAAGGGGGGCAGGG + Intronic
1184445880 22:44546587-44546609 TGAAAAAGACAAGCTGGGCACGG - Intergenic
1184461245 22:44639457-44639479 TGCCACATGGAAGGAGGGCAAGG + Intergenic
1184782071 22:46654532-46654554 TGCCACATGCAAGGTTGGCAAGG + Intronic
951136100 3:19106348-19106370 TGCCAAGGGCAAGTCAGGCATGG + Intergenic
951147785 3:19249949-19249971 TGGCAAAGGCAAGCTGGGTATGG + Intronic
951571284 3:24065866-24065888 TGCCAAAGGCAAGATGGGTATGG - Intergenic
952347184 3:32499127-32499149 TGCCTAAGGCAAGGGAGGCCTGG - Intronic
952667747 3:35927607-35927629 TGCAAACTGCAAGGTGGGAAAGG - Intergenic
952793474 3:37218429-37218451 TGCCAATGGCAAGCCAGGCATGG - Intergenic
952976976 3:38704901-38704923 GGCCAAAAGCAAGCTGGGCCTGG + Intronic
953409255 3:42680483-42680505 CACCAAAGGCAAAATGGGCATGG - Intergenic
954450747 3:50570128-50570150 TGTCCCAGGCAAGCTGGGCACGG - Intronic
954498155 3:50984098-50984120 TGCCAAGGGCAAGTAAGGCATGG - Intronic
955111758 3:55957633-55957655 TGCCAAGGGCAAGCCAGGCATGG + Intronic
955303925 3:57810295-57810317 TGCCAACGGCAAGCCAGGCATGG - Intronic
955407281 3:58633457-58633479 TGGCAAAGGGAAGGAGGGGAAGG - Intergenic
955779034 3:62463807-62463829 TGGCAAAGGTGAGGTGGGAAGGG - Intronic
957307893 3:78481273-78481295 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
957925381 3:86803826-86803848 TGCCAAAGGCTAGGAGAGGAGGG - Intergenic
958667853 3:97162950-97162972 CACCAAAGGCAAAGTGGGAAGGG - Intronic
958677960 3:97291963-97291985 TGCCAAGGGCAAGCCAGGCACGG + Intronic
959018133 3:101159121-101159143 TGTCAAAGGCAAGGTTGACCTGG - Intergenic
959861879 3:111225727-111225749 GGCCAAAGTGAAGGTGGGCATGG + Intronic
959863546 3:111242083-111242105 TGCCAAGGGCAAGTCAGGCATGG + Intronic
960293504 3:115914969-115914991 TGAAAGAGGCAAGGTGGGGAGGG + Intronic
960623556 3:119659331-119659353 TGGAAATGGAAAGGTGGGCAAGG + Intronic
961365614 3:126397697-126397719 TGGCATGGGCAAGGTGGGCAGGG + Intronic
961610713 3:128135240-128135262 TGCTAAAGGAAGGCTGGGCATGG + Intronic
961622771 3:128237912-128237934 TCCCAAAGAGCAGGTGGGCAAGG - Intronic
961942849 3:130655890-130655912 TGCCAAGGGCAAGCCAGGCATGG + Intronic
962091268 3:132246435-132246457 TGGCATAGGCAAGGGGGGCCTGG - Intronic
962404114 3:135085714-135085736 AGACAGAGGCAAGGAGGGCAAGG - Intronic
962431449 3:135324217-135324239 TCCCAAATGCCAGTTGGGCAAGG + Intergenic
963381040 3:144530690-144530712 TGCCATAATCAAGATGGGCAAGG + Intergenic
963674241 3:148288307-148288329 TGGCACAGGCAGGGAGGGCATGG - Intergenic
963905976 3:150773991-150774013 TGCCAAGGGCAAGCTGGACACGG + Intergenic
964493439 3:157262080-157262102 TGCAACAGGAGAGGTGGGCAAGG - Intronic
964707270 3:159632557-159632579 TGACAAAGGGAAGGAGAGCAAGG - Intronic
964710010 3:159661829-159661851 TGCCAAAGTCCTGGAGGGCAAGG - Intronic
966896781 3:184450978-184451000 TGCCACAGGCGAGGTGAACATGG - Intronic
967092999 3:186151415-186151437 TGTCCAAAACAAGGTGGGCATGG + Intronic
967402603 3:189080609-189080631 TTCCTAAAGAAAGGTGGGCATGG + Intronic
968618481 4:1592942-1592964 TGCCATAGGCTAGCCGGGCAGGG - Intergenic
968970049 4:3789009-3789031 AGCCAAGGGCATGGGGGGCAGGG + Intergenic
971013735 4:22466171-22466193 TGGTGAAGGAAAGGTGGGCAAGG - Intronic
971092541 4:23361665-23361687 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
971229132 4:24784316-24784338 TGACAATGGCAATGTGGGCAAGG - Intergenic
971474517 4:27059615-27059637 ACTCAAAGGCAAGGAGGGCAGGG + Intergenic
973814259 4:54604286-54604308 TGCCTGTGGCAAGGTGGGGAAGG + Intergenic
974683371 4:65194129-65194151 TGCCAAGGGCAAGCCAGGCAAGG + Intergenic
975498438 4:75058725-75058747 TGCCAAGGGCGAGCTGGGCATGG - Intergenic
976361956 4:84190186-84190208 TGCAAAGGCCAAGATGGGCAAGG + Intergenic
976436406 4:85023489-85023511 TGCCGAAGGCAGGCTGGGCGGGG + Intergenic
977036405 4:91958884-91958906 TGCCAAAAGCAAGGTGGGCGTGG + Intergenic
977978572 4:103296111-103296133 GGACATAGGCATGGTGGGCAAGG + Intergenic
979282740 4:118885721-118885743 TGGGGAAGACAAGGTGGGCAAGG - Intronic
979600251 4:122579613-122579635 TGCCAAAGGGGAGGAGGGCCTGG - Intergenic
980283484 4:130752978-130753000 TGCCAAAGGCAGAGTGGACCTGG + Intergenic
980601936 4:135037699-135037721 CATCAAAGACAAGGTGGGCATGG + Intergenic
981160746 4:141495779-141495801 CACTAAAGACAAGGTGGGCATGG + Intergenic
981311159 4:143299278-143299300 TGGCAGAGCCAAGGTGGGCAGGG - Intergenic
982918781 4:161249050-161249072 TGCCAAAGGCGAGCCAGGCAAGG + Intergenic
985834986 5:2263933-2263955 TTCCAGATGCAACGTGGGCACGG + Intergenic
985906468 5:2841468-2841490 TGGCAAGGGCAATGTGGGGAGGG - Intergenic
986030205 5:3886333-3886355 TGCCTTAGGCGAGGTGGGCTTGG + Intergenic
986089278 5:4488152-4488174 AGCCAAAATCAAGGTGGGCTGGG - Intergenic
987172127 5:15269995-15270017 TCCCACAGGCAAGGAGAGCATGG + Intergenic
987537818 5:19209797-19209819 TGCCAAGGGCAAGGCAGGTATGG - Intergenic
987999710 5:25331908-25331930 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
988093104 5:26568433-26568455 TGCCAAGGGCAAGTCAGGCATGG + Intergenic
989987372 5:50717000-50717022 TGAACAAGGCAAGGTAGGCAGGG + Intronic
991234485 5:64378036-64378058 TGCCAAAGATAAGATAGGCAGGG - Intergenic
991401225 5:66253806-66253828 TGCCAGAGGCCAGGAAGGCAAGG - Intergenic
992110204 5:73485662-73485684 CACCAATGGCAAGGTGGCCATGG - Intergenic
993705606 5:91166454-91166476 TGCCAAAGTCAGGGTGTCCAAGG - Intergenic
994539338 5:101075133-101075155 AACCAAAGGCAAGATGGGCATGG + Intergenic
995805678 5:116049630-116049652 TCACAAGGGCAAGGAGGGCAAGG - Intronic
996057921 5:119000952-119000974 TGCCTGAGGCAGGGTGGGGAAGG + Intergenic
996488831 5:124068333-124068355 CTCAAAAGGCAAGTTGGGCACGG - Intergenic
996500523 5:124211204-124211226 GGCCAAAGGCAAGGAGAGAAAGG - Intergenic
997125859 5:131226108-131226130 TGCCAAAGACAGGATGGGTATGG + Intergenic
997434072 5:133861584-133861606 TGCCAAAGCCATGGTGGGGGTGG - Intergenic
997460759 5:134050820-134050842 TGGCAGAGTCAAGGTGGGGATGG + Intergenic
999845731 5:155477646-155477668 TGCAGAAGTCAAGGTAGGCAAGG - Intergenic
1000061085 5:157655714-157655736 TGCCTGAGGCAAGGTGGGGAAGG - Intronic
1000066367 5:157696002-157696024 TGCTTGAGGCAAGGTGGGGAAGG - Intergenic
1001715909 5:173815872-173815894 TGCCACGGGCCAGGTGGGCCAGG + Intergenic
1001814886 5:174660263-174660285 TGCTAAAGGCATCGTGGTCATGG + Intergenic
1002297644 5:178240321-178240343 CACCAAAGGGAAGGTGGGGAGGG + Intronic
1002454178 5:179336879-179336901 TGCACAAGGCAGGGTGGGGATGG + Intronic
1003447298 6:6196341-6196363 TCCTAAATGCATGGTGGGCATGG - Intronic
1005341512 6:24847863-24847885 AGCAATAGGTAAGGTGGGCAAGG + Intronic
1006022990 6:31128508-31128530 TGCAAAAGGAAAGGTGGGGATGG + Intronic
1006609658 6:35286551-35286573 TGCACCAGGGAAGGTGGGCAAGG - Intronic
1007353225 6:41290918-41290940 TGCCTAAGGCAGGGTGAGGAAGG + Intergenic
1007756133 6:44100994-44101016 TGCCAGAGGGAAGGTGAGGATGG - Intergenic
1008079588 6:47180134-47180156 TGTCAAAGGCAGGGTGGGCATGG - Intergenic
1008683920 6:53903351-53903373 TGGCAAAGGGTGGGTGGGCAGGG + Intronic
1009870735 6:69450028-69450050 TGCCAAGGGCAAGCCAGGCATGG + Intergenic
1011744567 6:90397039-90397061 TGGCCCAGGCATGGTGGGCAGGG + Intergenic
1012033203 6:94099270-94099292 CACCAAAGGCAAGGTGGGCGTGG + Intergenic
1012095229 6:94949048-94949070 TGGCAAAGGCCACGTGGGTAAGG + Intergenic
1012225898 6:96703080-96703102 CACCAAAGGCAAGATGGACATGG + Intergenic
1013304698 6:108837628-108837650 TGCCACAGGCAAAGTTGTCAGGG - Intergenic
1014227041 6:118861033-118861055 TGCCAATGGCAAGCCAGGCATGG + Intronic
1014916639 6:127158514-127158536 TGCCAAAGGCAAGATCTCCAGGG + Intronic
1017044348 6:150333547-150333569 CACCAAAGGCAAGGTGGGCGTGG - Intergenic
1018659848 6:166076111-166076133 TGCCAAGGGCAAGCCAGGCATGG + Intergenic
1018907271 6:168082873-168082895 GGCCTGGGGCAAGGTGGGCAGGG + Intergenic
1019085473 6:169471652-169471674 TGGAAAAGCCAAGGTGGTCAGGG - Intronic
1019304614 7:327346-327368 TGCAAAGGGCAAGGTGGGTGCGG - Intergenic
1019377199 7:699125-699147 GCCCACAGGCAAGGTGGGAAGGG + Intronic
1020282425 7:6656279-6656301 GGCCAAGGGCAAGGTGGGCTTGG + Exonic
1022203692 7:28142556-28142578 GGACAAAGGAAAGGTGCGCACGG - Intronic
1023939502 7:44760624-44760646 TGACAAGGCCAGGGTGGGCATGG + Intronic
1024701493 7:51908443-51908465 TGCCAAAGTCATGGTGGGGCTGG + Intergenic
1024783001 7:52874254-52874276 TGCAAAAGGCAAGGTGGCACTGG - Intergenic
1025264642 7:57446547-57446569 TGCCTATGGCAGGGTGGGAAAGG + Intergenic
1025740841 7:64194127-64194149 TGCCTATGGCAGGGTGGGAAAGG - Intronic
1026888123 7:73966590-73966612 TGCCAAAGGGAAGGACGCCAGGG - Intergenic
1027124565 7:75547112-75547134 AGCCAAAGGCAAGCTTGGAATGG + Intronic
1027222957 7:76225583-76225605 TGCCAGAGACAAGGGGAGCAGGG + Intronic
1029312191 7:99677728-99677750 TGCCAAAGCCAGGGTGGCCTTGG + Intronic
1029811177 7:103050636-103050658 TGCCTGTGGCAAGGTGGGGAAGG + Intronic
1031572171 7:123372962-123372984 TGCTGGAGGCAAGGTGGGCTGGG - Intergenic
1031836907 7:126690265-126690287 TGCCAAGGGCAAGGCAGGCACGG + Intronic
1032825878 7:135567339-135567361 TGGGAAGGCCAAGGTGGGCAGGG + Intronic
1033161709 7:139002501-139002523 TGCCTGAGGCAAGGTGGGAAAGG - Intergenic
1033216759 7:139499186-139499208 TGCAGAAGGCCAGGTGGGCCTGG - Intergenic
1033578071 7:142705015-142705037 TGCCTGAGGCAGGGTGGGGAAGG - Intergenic
1033763745 7:144464957-144464979 TGCCTGAGGCAGGGTGGGGAAGG - Intronic
1033864697 7:145674247-145674269 TGCCAAAGGAAAAATGGGCAAGG - Intergenic
1034255534 7:149722757-149722779 TGGCACATGCAAGGTGGGCCTGG - Intronic
1034313591 7:150110781-150110803 TGGCAGAGGCAAGGCCGGCAGGG + Intergenic
1034793305 7:153990015-153990037 TGGCAGAGGCAAGGCCGGCAGGG - Intronic
1035345195 7:158192853-158192875 AGCCAGAGGCCGGGTGGGCATGG + Intronic
1035445428 7:158938465-158938487 TGCTAAAGGGAGGCTGGGCATGG + Intronic
1035626463 8:1074912-1074934 TGCCAACTGCAAGGTGACCAAGG - Intergenic
1036572725 8:9995965-9995987 TGAGTAAGGCAAGGTGGGGAAGG + Intergenic
1036687007 8:10918460-10918482 TGCCATGGCCAAGCTGGGCATGG - Intronic
1036752834 8:11454199-11454221 TGCCAAAGCCAGGGTGGGCTTGG + Intronic
1036786036 8:11687857-11687879 TGCCAAATGAAACGGGGGCAGGG - Intronic
1038369349 8:26972577-26972599 GGCCGTAGGCAAGGTGGGCATGG + Intergenic
1040536476 8:48315413-48315435 TGCCAGATGTCAGGTGGGCAGGG + Intergenic
1041956069 8:63559081-63559103 TGCCAAGGGCAAGCCAGGCATGG + Intergenic
1044030776 8:87233758-87233780 TGCCACAGCCAAACTGGGCATGG - Intronic
1044233750 8:89807403-89807425 GGCGAAAGTCAAGGTCGGCAGGG - Intergenic
1045374727 8:101559844-101559866 CGCCAAATGCAAGGTGAGCAGGG - Intronic
1045428209 8:102087872-102087894 TGCTTAAGGCAGGGTGGGGAAGG - Intronic
1045436148 8:102166682-102166704 TGCTAAAAGCAAGGTAGACATGG + Intergenic
1045440935 8:102209985-102210007 TGCCTAAGGCAAGGTGGGTAAGG + Intronic
1045600715 8:103712408-103712430 TGGCAAAGGCAAGGTATGCTTGG + Intronic
1045826391 8:106403333-106403355 TGTCACAGGCAAGGTGGGCAGGG - Intronic
1046216979 8:111161514-111161536 TGCCAAAGACAAGGTGGACCTGG + Intergenic
1048189089 8:132272238-132272260 TGCCAATGGCAGGGTAGGGAAGG - Intronic
1048241622 8:132748135-132748157 CATCACAGGCAAGGTGGGCATGG + Intronic
1048305003 8:133278074-133278096 AGCCACAGGGAAGGTTGGCAAGG + Intronic
1048999411 8:139815232-139815254 TGCCACAGGGAAGGCGGGCAGGG - Intronic
1049033769 8:140058587-140058609 AGACAAAGACAAGCTGGGCAGGG + Intronic
1049038393 8:140094471-140094493 TGCCAAAGGAAAGGTCAGAAAGG + Intronic
1049712175 8:144070015-144070037 TGCCCAAAGCAAGGTGGCCGGGG + Intergenic
1050088509 9:1991870-1991892 TTCCAAAAGCAAGGTGCTCATGG - Intergenic
1050153526 9:2641542-2641564 TCCTAAAGGAAGGGTGGGCAGGG + Intronic
1051721462 9:20041702-20041724 AGCCAAAGGAAAGATGGGCAGGG + Intergenic
1052364260 9:27594312-27594334 TGCCAAAGCCAACGTGGAGAAGG - Intergenic
1052891552 9:33704827-33704849 TGCCTGAGGCAGGGTGGGGAAGG - Intergenic
1054792624 9:69270033-69270055 TGCCAAAGACATGGTGAGCACGG - Intergenic
1054888706 9:70228652-70228674 TGCCAAAGGCAACTTGGAAAGGG - Intergenic
1055821704 9:80272731-80272753 TGACACAGGCAAGGTGCTCATGG + Intergenic
1056539655 9:87560284-87560306 TTCCAAGGGCAGGCTGGGCATGG - Intronic
1056996028 9:91460246-91460268 TGCCATGGGCAAGGAGGGCTTGG + Intergenic
1057149290 9:92782056-92782078 TGCCAAAGGCAAGGTGGGTGGGG + Intergenic
1057747201 9:97761876-97761898 TCCCAAAGGCGAGGAGGGCCAGG + Intergenic
1060238082 9:121880253-121880275 TGCCCAAGGCACGGTGAACAAGG + Intronic
1060294226 9:122332367-122332389 TGCCAAAGGAAAGCAGGGGAAGG + Intergenic
1060585334 9:124782081-124782103 TGCCAAGGGCAGGGTGGGCTGGG + Intronic
1060805367 9:126572456-126572478 TGCCAAAGGCAAGGTGGGCGTGG - Intergenic
1061545263 9:131300800-131300822 GGCCAAAGGCAAGGAGGGCTGGG - Intronic
1061550006 9:131328955-131328977 CGCCACAGGCGTGGTGGGCATGG - Intergenic
1062173370 9:135147701-135147723 GGACAGAGGCCAGGTGGGCAGGG - Intergenic
1186578289 X:10789980-10790002 TGGCTAAGGCAAGGTGAACAAGG - Intronic
1187047507 X:15661930-15661952 TGCAAAAAGCAAGGTGAGCTGGG - Intronic
1187625639 X:21109937-21109959 ATCCAAAGGGAATGTGGGCATGG + Intergenic
1187947214 X:24438035-24438057 TGCCAAATGCAAAGTCGGGAGGG + Intergenic
1188133907 X:26470997-26471019 TGCCTGAGGCAGGGTGGGGAAGG + Intergenic
1188442523 X:30227242-30227264 TACCAGAGGCAGGGTGGGGAGGG - Intergenic
1189599558 X:42608384-42608406 TGCGAAAGGGGAGGTGGGAAAGG - Intergenic
1189974952 X:46451359-46451381 TGCAAAAGGCAAGATGGGTATGG - Intronic
1190003621 X:46713207-46713229 TGCACAAGGCAGGCTGGGCATGG + Intronic
1190145994 X:47892215-47892237 CGCCAAATGCAAGGTGAACATGG - Intronic
1190360443 X:49644189-49644211 TGCCAAGGGCAAGCCAGGCATGG + Intergenic
1190538154 X:51449430-51449452 CACCAAAGGCAAGGTGGACATGG + Intergenic
1191831206 X:65418537-65418559 TTCCAAAGGCAAAGTGGGTGTGG + Intronic
1192220731 X:69195788-69195810 TCTCAGAGGCCAGGTGGGCAGGG + Intergenic
1192297944 X:69869766-69869788 CATGAAAGGCAAGGTGGGCATGG - Intronic
1192730669 X:73800057-73800079 TGCCTGAGGCAGGGTGGGGAAGG + Intergenic
1193187197 X:78527470-78527492 TATCAAAGACAAGGTGGCCATGG + Intergenic
1193231646 X:79053813-79053835 TGCCAATGACAAGATGGGCATGG - Intergenic
1193966813 X:87997766-87997788 TACTAAAGGCAAGGTTGGCATGG + Intergenic
1194849484 X:98853948-98853970 CATCAAAGGCAAGGTGGCCATGG - Intergenic
1196114658 X:111985839-111985861 TGCCAAAGACAAGGTGGGCATGG - Intronic
1197103209 X:122680916-122680938 AGACAAAGGCAAGCTGGGAATGG - Intergenic
1197387037 X:125814451-125814473 AGTCAAAGGCAAAGTGGGCATGG - Intergenic
1197504854 X:127289100-127289122 TGCCAAAGTCAAGGTAGGTATGG - Intergenic
1197534559 X:127671723-127671745 TACCAAAGGTAAGATGGGGATGG + Intergenic
1198498192 X:137215045-137215067 TGCCCATGGCAGGGTGGGGAAGG - Intergenic
1199008263 X:142728683-142728705 CACCAAAGGCAAGGTGGGCATGG + Intergenic
1200289275 X:154856401-154856423 TGCCAAAGGCAAGGTAAGTGTGG + Intronic
1201303277 Y:12528704-12528726 TGCCAAAGCCAAGGATGGGATGG - Intergenic