ID: 1179460919

View in Genome Browser
Species Human (GRCh38)
Location 21:41534532-41534554
Sequence TTGATGTAAAACCAAGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179460914_1179460919 -10 Left 1179460914 21:41534519-41534541 CCGTGATGATAGCTTGATGTAAA No data
Right 1179460919 21:41534532-41534554 TTGATGTAAAACCAAGGGGTGGG No data
1179460913_1179460919 -9 Left 1179460913 21:41534518-41534540 CCCGTGATGATAGCTTGATGTAA No data
Right 1179460919 21:41534532-41534554 TTGATGTAAAACCAAGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179460919 Original CRISPR TTGATGTAAAACCAAGGGGT GGG Intergenic
No off target data available for this crispr