ID: 1179462472

View in Genome Browser
Species Human (GRCh38)
Location 21:41547026-41547048
Sequence ACCCCCTGCCTCACAAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179462472_1179462477 3 Left 1179462472 21:41547026-41547048 CCCAGCTTTGTGAGGCAGGGGGT No data
Right 1179462477 21:41547052-41547074 GAGAGTGGGGAATACCAAACTGG No data
1179462472_1179462476 -10 Left 1179462472 21:41547026-41547048 CCCAGCTTTGTGAGGCAGGGGGT No data
Right 1179462476 21:41547039-41547061 GGCAGGGGGTTTTGAGAGTGGGG No data
1179462472_1179462479 16 Left 1179462472 21:41547026-41547048 CCCAGCTTTGTGAGGCAGGGGGT No data
Right 1179462479 21:41547065-41547087 ACCAAACTGGCCTGAGGCAGAGG No data
1179462472_1179462478 10 Left 1179462472 21:41547026-41547048 CCCAGCTTTGTGAGGCAGGGGGT No data
Right 1179462478 21:41547059-41547081 GGGAATACCAAACTGGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179462472 Original CRISPR ACCCCCTGCCTCACAAAGCT GGG (reversed) Intergenic