ID: 1179464348

View in Genome Browser
Species Human (GRCh38)
Location 21:41561856-41561878
Sequence GCTCATTCTGGCCCCCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179464348_1179464356 6 Left 1179464348 21:41561856-41561878 CCACCATGGGGGCCAGAATGAGC No data
Right 1179464356 21:41561885-41561907 CACCCGGGTTTGCAAGGTGTGGG No data
1179464348_1179464355 5 Left 1179464348 21:41561856-41561878 CCACCATGGGGGCCAGAATGAGC No data
Right 1179464355 21:41561884-41561906 TCACCCGGGTTTGCAAGGTGTGG No data
1179464348_1179464352 -9 Left 1179464348 21:41561856-41561878 CCACCATGGGGGCCAGAATGAGC No data
Right 1179464352 21:41561870-41561892 AGAATGAGCCTTCATCACCCGGG No data
1179464348_1179464359 13 Left 1179464348 21:41561856-41561878 CCACCATGGGGGCCAGAATGAGC No data
Right 1179464359 21:41561892-41561914 GTTTGCAAGGTGTGGGCCAGAGG No data
1179464348_1179464360 25 Left 1179464348 21:41561856-41561878 CCACCATGGGGGCCAGAATGAGC No data
Right 1179464360 21:41561904-41561926 TGGGCCAGAGGAGCACTAGCAGG No data
1179464348_1179464351 -10 Left 1179464348 21:41561856-41561878 CCACCATGGGGGCCAGAATGAGC No data
Right 1179464351 21:41561869-41561891 CAGAATGAGCCTTCATCACCCGG No data
1179464348_1179464354 0 Left 1179464348 21:41561856-41561878 CCACCATGGGGGCCAGAATGAGC No data
Right 1179464354 21:41561879-41561901 CTTCATCACCCGGGTTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179464348 Original CRISPR GCTCATTCTGGCCCCCATGG TGG (reversed) Intergenic