ID: 1179464633

View in Genome Browser
Species Human (GRCh38)
Location 21:41563338-41563360
Sequence GCTCATGGTCCTGGAGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179464621_1179464633 21 Left 1179464621 21:41563294-41563316 CCCCTGGGTCTGGACAGCTGGGC No data
Right 1179464633 21:41563338-41563360 GCTCATGGTCCTGGAGTCCTGGG No data
1179464623_1179464633 19 Left 1179464623 21:41563296-41563318 CCTGGGTCTGGACAGCTGGGCCT No data
Right 1179464633 21:41563338-41563360 GCTCATGGTCCTGGAGTCCTGGG No data
1179464622_1179464633 20 Left 1179464622 21:41563295-41563317 CCCTGGGTCTGGACAGCTGGGCC No data
Right 1179464633 21:41563338-41563360 GCTCATGGTCCTGGAGTCCTGGG No data
1179464626_1179464633 -1 Left 1179464626 21:41563316-41563338 CCTCTGGCTGCCCCAGCAGGAAG No data
Right 1179464633 21:41563338-41563360 GCTCATGGTCCTGGAGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179464633 Original CRISPR GCTCATGGTCCTGGAGTCCT GGG Intergenic