ID: 1179472700 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:41622140-41622162 |
Sequence | TGCCCTGCCTGGTTGATTCA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1179472693_1179472700 | 28 | Left | 1179472693 | 21:41622089-41622111 | CCTAACTCAGTTACTTAGCCAGT | No data | ||
Right | 1179472700 | 21:41622140-41622162 | TGCCCTGCCTGGTTGATTCATGG | No data | ||||
1179472696_1179472700 | 10 | Left | 1179472696 | 21:41622107-41622129 | CCAGTTGCAACAAGGTAAGAGGG | No data | ||
Right | 1179472700 | 21:41622140-41622162 | TGCCCTGCCTGGTTGATTCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1179472700 | Original CRISPR | TGCCCTGCCTGGTTGATTCA TGG | Intergenic | ||