ID: 1179472700

View in Genome Browser
Species Human (GRCh38)
Location 21:41622140-41622162
Sequence TGCCCTGCCTGGTTGATTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179472693_1179472700 28 Left 1179472693 21:41622089-41622111 CCTAACTCAGTTACTTAGCCAGT No data
Right 1179472700 21:41622140-41622162 TGCCCTGCCTGGTTGATTCATGG No data
1179472696_1179472700 10 Left 1179472696 21:41622107-41622129 CCAGTTGCAACAAGGTAAGAGGG No data
Right 1179472700 21:41622140-41622162 TGCCCTGCCTGGTTGATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179472700 Original CRISPR TGCCCTGCCTGGTTGATTCA TGG Intergenic