ID: 1179476612

View in Genome Browser
Species Human (GRCh38)
Location 21:41650642-41650664
Sequence CTGGAAGTGAAGATGGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179476612_1179476619 27 Left 1179476612 21:41650642-41650664 CCTGGTTCCATCTTCACTTCCAG No data
Right 1179476619 21:41650692-41650714 ACGCATCTGTGCCTCCTCCAAGG No data
1179476612_1179476616 -5 Left 1179476612 21:41650642-41650664 CCTGGTTCCATCTTCACTTCCAG No data
Right 1179476616 21:41650660-41650682 TCCAGAGAGGTGGTGTCTGCTGG No data
1179476612_1179476620 28 Left 1179476612 21:41650642-41650664 CCTGGTTCCATCTTCACTTCCAG No data
Right 1179476620 21:41650693-41650715 CGCATCTGTGCCTCCTCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179476612 Original CRISPR CTGGAAGTGAAGATGGAACC AGG (reversed) Intergenic
No off target data available for this crispr