ID: 1179480303

View in Genome Browser
Species Human (GRCh38)
Location 21:41672544-41672566
Sequence ATGGAGAAACTGAGGCAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179480291_1179480303 6 Left 1179480291 21:41672515-41672537 CCAATGAGGCCCTCCTGACCCAA No data
Right 1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG No data
1179480295_1179480303 -3 Left 1179480295 21:41672524-41672546 CCCTCCTGACCCAAGGGGAAATG No data
Right 1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG No data
1179480289_1179480303 13 Left 1179480289 21:41672508-41672530 CCCAAAGCCAATGAGGCCCTCCT No data
Right 1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG No data
1179480288_1179480303 14 Left 1179480288 21:41672507-41672529 CCCCAAAGCCAATGAGGCCCTCC No data
Right 1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG No data
1179480286_1179480303 26 Left 1179480286 21:41672495-41672517 CCTGCGGATTCACCCCAAAGCCA No data
Right 1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG No data
1179480296_1179480303 -4 Left 1179480296 21:41672525-41672547 CCTCCTGACCCAAGGGGAAATGG No data
Right 1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG No data
1179480290_1179480303 12 Left 1179480290 21:41672509-41672531 CCAAAGCCAATGAGGCCCTCCTG No data
Right 1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG No data
1179480298_1179480303 -7 Left 1179480298 21:41672528-41672550 CCTGACCCAAGGGGAAATGGAGA No data
Right 1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179480303 Original CRISPR ATGGAGAAACTGAGGCAGGA CGG Intergenic
No off target data available for this crispr