ID: 1179481571

View in Genome Browser
Species Human (GRCh38)
Location 21:41681934-41681956
Sequence GCAGCCCTCGAGGTGTCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179481571_1179481573 -8 Left 1179481571 21:41681934-41681956 CCACAAGACACCTCGAGGGCTGC No data
Right 1179481573 21:41681949-41681971 AGGGCTGCTCGTGAATTAGTCGG No data
1179481571_1179481575 -6 Left 1179481571 21:41681934-41681956 CCACAAGACACCTCGAGGGCTGC No data
Right 1179481575 21:41681951-41681973 GGCTGCTCGTGAATTAGTCGGGG No data
1179481571_1179481574 -7 Left 1179481571 21:41681934-41681956 CCACAAGACACCTCGAGGGCTGC No data
Right 1179481574 21:41681950-41681972 GGGCTGCTCGTGAATTAGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179481571 Original CRISPR GCAGCCCTCGAGGTGTCTTG TGG (reversed) Intergenic
No off target data available for this crispr