ID: 1179482373

View in Genome Browser
Species Human (GRCh38)
Location 21:41686311-41686333
Sequence TTGCACATCATGTCATCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179482366_1179482373 10 Left 1179482366 21:41686278-41686300 CCAAATGGATCACGAATCCCTGG No data
Right 1179482373 21:41686311-41686333 TTGCACATCATGTCATCTCAAGG No data
1179482371_1179482373 -8 Left 1179482371 21:41686296-41686318 CCTGGGTCCTGGTGTTTGCACAT No data
Right 1179482373 21:41686311-41686333 TTGCACATCATGTCATCTCAAGG No data
1179482370_1179482373 -7 Left 1179482370 21:41686295-41686317 CCCTGGGTCCTGGTGTTTGCACA No data
Right 1179482373 21:41686311-41686333 TTGCACATCATGTCATCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179482373 Original CRISPR TTGCACATCATGTCATCTCA AGG Intergenic
No off target data available for this crispr