ID: 1179483135

View in Genome Browser
Species Human (GRCh38)
Location 21:41691260-41691282
Sequence GCATCTGTTTAGCCCCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179483135_1179483138 9 Left 1179483135 21:41691260-41691282 CCTGGCTGGGGCTAAACAGATGC No data
Right 1179483138 21:41691292-41691314 AAGAGTTTTGCTCCAATCAAGGG No data
1179483135_1179483137 8 Left 1179483135 21:41691260-41691282 CCTGGCTGGGGCTAAACAGATGC No data
Right 1179483137 21:41691291-41691313 AAAGAGTTTTGCTCCAATCAAGG No data
1179483135_1179483139 14 Left 1179483135 21:41691260-41691282 CCTGGCTGGGGCTAAACAGATGC No data
Right 1179483139 21:41691297-41691319 TTTTGCTCCAATCAAGGGAAAGG No data
1179483135_1179483140 20 Left 1179483135 21:41691260-41691282 CCTGGCTGGGGCTAAACAGATGC No data
Right 1179483140 21:41691303-41691325 TCCAATCAAGGGAAAGGAGAAGG No data
1179483135_1179483142 23 Left 1179483135 21:41691260-41691282 CCTGGCTGGGGCTAAACAGATGC No data
Right 1179483142 21:41691306-41691328 AATCAAGGGAAAGGAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179483135 Original CRISPR GCATCTGTTTAGCCCCAGCC AGG (reversed) Intergenic
No off target data available for this crispr