ID: 1179483749

View in Genome Browser
Species Human (GRCh38)
Location 21:41695414-41695436
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179483748_1179483749 -3 Left 1179483748 21:41695394-41695416 CCAAACAGGTTGAACAATCTGTG No data
Right 1179483749 21:41695414-41695436 GTGCTCCAGCACCACAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179483749 Original CRISPR GTGCTCCAGCACCACAGTGT AGG Intergenic
No off target data available for this crispr