ID: 1179486273

View in Genome Browser
Species Human (GRCh38)
Location 21:41712593-41712615
Sequence CTGGAGAGACAAAGGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 682
Summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 625}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179486273_1179486287 30 Left 1179486273 21:41712593-41712615 CCCACCTCCCTTTGTCTCTCCAG 0: 1
1: 0
2: 5
3: 51
4: 625
Right 1179486287 21:41712646-41712668 CAGAGCCACCTCTCCATCTAAGG 0: 1
1: 0
2: 0
3: 12
4: 177
1179486273_1179486281 -5 Left 1179486273 21:41712593-41712615 CCCACCTCCCTTTGTCTCTCCAG 0: 1
1: 0
2: 5
3: 51
4: 625
Right 1179486281 21:41712611-41712633 TCCAGCCAGAGGTGGGCCTGTGG 0: 1
1: 0
2: 1
3: 52
4: 321
1179486273_1179486283 -4 Left 1179486273 21:41712593-41712615 CCCACCTCCCTTTGTCTCTCCAG 0: 1
1: 0
2: 5
3: 51
4: 625
Right 1179486283 21:41712612-41712634 CCAGCCAGAGGTGGGCCTGTGGG 0: 1
1: 0
2: 4
3: 35
4: 309
1179486273_1179486284 -3 Left 1179486273 21:41712593-41712615 CCCACCTCCCTTTGTCTCTCCAG 0: 1
1: 0
2: 5
3: 51
4: 625
Right 1179486284 21:41712613-41712635 CAGCCAGAGGTGGGCCTGTGGGG 0: 1
1: 0
2: 6
3: 35
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179486273 Original CRISPR CTGGAGAGACAAAGGGAGGT GGG (reversed) Intergenic
900367525 1:2317360-2317382 CAGGAGGGGCACAGGGAGGTAGG + Intergenic
900369033 1:2323355-2323377 CTGGAGAGCCAAAGGCTGGAAGG - Intronic
900993282 1:6107561-6107583 ATGGAGAGATAAAGGGATGTAGG + Intronic
900993571 1:6108734-6108756 ATGGAGAGACAGAGGGATGGAGG + Intronic
901059422 1:6465294-6465316 CTGGAGAGAAAGAGGGAGGGAGG - Intronic
901229301 1:7633140-7633162 CTGCAGGGACAAAGAGAGGACGG - Intronic
901433079 1:9229868-9229890 CTGGAGAGGCTAAGGCAGGAGGG + Intergenic
901537177 1:9890127-9890149 CTGGAGAGACAACGAGATCTGGG - Intronic
902505753 1:16938366-16938388 TTAGGGAGACAAAGGGTGGTTGG - Intronic
902599671 1:17532382-17532404 CTGCTGAGCCAAGGGGAGGTTGG - Intergenic
902686089 1:18078467-18078489 CTGGGGAGACCAAGGCAGCTGGG + Intergenic
903477198 1:23627758-23627780 CTGGAGAGAGAAAAGGAAGGAGG - Intronic
904367929 1:30028526-30028548 CTGGGGAGTGAAAGAGAGGTTGG - Intergenic
904454616 1:30639977-30639999 ATGGAGAGAATAAGGGAGCTGGG - Intergenic
904463881 1:30696739-30696761 AGGGAGAGAGGAAGGGAGGTTGG + Intergenic
904464376 1:30699104-30699126 AGGGAGAGAGGAAGGGAGGTTGG + Intergenic
904891089 1:33780146-33780168 CTGGAGATACAAAGAGTGGAAGG - Intronic
905101134 1:35523056-35523078 CTGGAGCTAGAAAGGTAGGTAGG - Intronic
905257366 1:36693465-36693487 GAGGAGAGACAAAAGGAGGAAGG + Intergenic
905354679 1:37373120-37373142 CTGGGGAGGCAAAGGGAGAAAGG + Intergenic
906733361 1:48101956-48101978 ATGGAGAGAGAAAGTGAGATGGG + Intergenic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
908129448 1:61059982-61060004 CAGAAGAGACAAATGGAAGTAGG + Intronic
908152800 1:61321404-61321426 CGAGAGAGAGAAAGGGAGGGAGG + Intronic
908571690 1:65418138-65418160 CTGGAGACAGAATGGGTGGTTGG + Intergenic
911757037 1:101570787-101570809 GGGGAGAGACAAAGGTAGCTTGG - Intergenic
911857048 1:102891773-102891795 CTTGAGAGGCTAAGGGAGGAGGG + Intronic
913232958 1:116756962-116756984 TTGGAGAAACAAAGAGATGTGGG - Intronic
915021128 1:152779361-152779383 CTGGACAGACAAAGCCAGTTAGG - Intronic
915745504 1:158153860-158153882 GGGGAGAGTCAAAGGAAGGTTGG - Intergenic
916047190 1:161008924-161008946 CTGGTGGGAGAGAGGGAGGTGGG - Intronic
916780749 1:168025672-168025694 TAGGAGAGACAAATGGTGGTGGG - Intronic
917396385 1:174598986-174599008 AAGGAGAGAGAAAGGGAGGGAGG - Intronic
917726366 1:177831387-177831409 CTGGAGAGACAAAGATAGCTCGG + Intergenic
919026001 1:192171459-192171481 CTAGAGAGACAAGGGAAGGTTGG - Intronic
919624836 1:199901348-199901370 CTTGAGAGACAAGGGTTGGTGGG + Intergenic
919816662 1:201445129-201445151 CTGCAGGCAGAAAGGGAGGTAGG + Intergenic
919912832 1:202122625-202122647 CTAGGGTGACACAGGGAGGTGGG - Intergenic
920061826 1:203232220-203232242 CAGGACAGACAAACAGAGGTAGG + Intronic
921101752 1:211934542-211934564 CTGCAGAGACCATGGGAGGGAGG - Intergenic
921317389 1:213905325-213905347 CGGGAGGGACAAAGGGTAGTGGG - Intergenic
922637164 1:227185644-227185666 CTACAGAGACAGAGGGAGGGGGG - Intronic
923419768 1:233800909-233800931 CTTGAGGGAGAAGGGGAGGTGGG + Intergenic
923788196 1:237088324-237088346 CAGGAGAGATAAAGAGAGATAGG + Intronic
924445622 1:244127784-244127806 CTGGGGATACAGAGGAAGGTGGG - Intergenic
924640303 1:245827230-245827252 CTGTAGAGTCAGAGGGAGCTGGG - Intronic
1063168981 10:3489094-3489116 GTGGAGAGATAAGGAGAGGTTGG + Intergenic
1063261819 10:4397656-4397678 CTGGGGAGAGAAAGAGAGATGGG - Intergenic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1063900357 10:10726510-10726532 CGGGAGAGAGAAAGGCAGGTCGG - Intergenic
1064822572 10:19354502-19354524 ATGGGGAGATAAAGAGAGGTTGG - Intronic
1064924114 10:20551160-20551182 CTGGAAAGAATAAGGGAGGGTGG - Intergenic
1065113701 10:22464176-22464198 ATGGAGAGAGAAAGGGAGGAAGG + Intergenic
1065890775 10:30119289-30119311 CTGGAGACACTAACTGAGGTTGG - Intergenic
1065995412 10:31055532-31055554 CAGGAGAGACAGAGTGAGGGGGG + Intergenic
1066228871 10:33412387-33412409 CAGGAGAGTCACAGAGAGGTTGG + Intergenic
1066376483 10:34861901-34861923 CTGGAGAGAGAGAGGGCGGTAGG - Intergenic
1067572724 10:47383788-47383810 CGGGAGAGACAGTGGGAGGGAGG + Intronic
1068042065 10:51837660-51837682 CTGGAGAGACAAATGCATGTAGG - Intronic
1068611882 10:59069309-59069331 TTGGAGAGCCAAAGAGAAGTAGG - Intergenic
1069024940 10:63529358-63529380 CTGGAGATAGATAGGGAAGTAGG + Intronic
1069243127 10:66166942-66166964 TTGGAGATACAATGGGAGGTTGG + Intronic
1069307465 10:66988844-66988866 GTGGAGAGAAACAGGGAGGAGGG - Intronic
1069895968 10:71680241-71680263 CTGGACAGCCAAAGGGAGGCAGG - Intronic
1070195305 10:74151247-74151269 CTGTAGAGCCAAAGTGGGGTGGG + Exonic
1070259037 10:74835568-74835590 CTGGAGAGACAGAAAGAGTTTGG + Intronic
1072070406 10:91909590-91909612 CTGGAGAGACAGAGAGAGAGAGG - Intergenic
1072244313 10:93528254-93528276 CTGGAGTGTCAAAGGTAGATAGG - Exonic
1072719055 10:97769746-97769768 CTGAAGAGAGAAAGTGGGGTGGG + Intronic
1073148025 10:101293023-101293045 CTGGAGAGACACAGGGTGGGTGG - Intergenic
1073448467 10:103595025-103595047 TTGGACAGTCAAAGGGAAGTGGG + Exonic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074533195 10:114310918-114310940 CGGGAGAGCCAGAGGGTGGTTGG - Intronic
1074862707 10:117524426-117524448 GTGGAGAGAGAAGGAGAGGTTGG + Intergenic
1075093878 10:119458589-119458611 CTGCCGAGACAAATGGTGGTGGG + Intronic
1075210746 10:120489048-120489070 CTGGAGGGACAAAAGGAAGTAGG - Intronic
1075670834 10:124263112-124263134 CTGGAGAGACACAGGCAGGCAGG - Intergenic
1076329597 10:129654655-129654677 CTGGAGAGACAGGAGGAGGCAGG + Intronic
1076755309 10:132567623-132567645 ATGGAGCGGAAAAGGGAGGTGGG - Intronic
1076846356 10:133071371-133071393 AGGGAGAGAGAAAGGGAGGGAGG - Intronic
1076883623 10:133251614-133251636 CTGGGGAGCCACAGGGAGCTCGG - Intergenic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077853269 11:6096231-6096253 GTGGAGAGGCAAAGCCAGGTGGG - Intergenic
1077903984 11:6514524-6514546 AGGGAGAGAAAAAGGGAGGAAGG - Intronic
1078003364 11:7514418-7514440 CTGGAGATGCGCAGGGAGGTGGG + Intronic
1078388213 11:10911809-10911831 CTGGAGAGAGAAAGAGAGAGAGG + Intergenic
1079085304 11:17440746-17440768 CTAGCTGGACAAAGGGAGGTTGG + Intronic
1079974684 11:27076672-27076694 GTGGAGGGACAAAGCCAGGTAGG + Intronic
1080627418 11:34043075-34043097 CAGGAGAGACAGAGTGAGGGTGG + Intergenic
1080952110 11:37045990-37046012 TTGGAGAGAAACATGGAGGTTGG + Intergenic
1081550387 11:44106324-44106346 TAGGAGAGACAAAGGGAGGGAGG - Intronic
1082028518 11:47589113-47589135 AAGGAGAGACAAGCGGAGGTGGG + Exonic
1082872903 11:57960184-57960206 CTGAGGAAGCAAAGGGAGGTGGG - Intergenic
1082877536 11:58003271-58003293 TTGCAGAGACAATAGGAGGTTGG - Intergenic
1083049394 11:59763414-59763436 CTGGAGAAGCAAAAGCAGGTAGG + Intronic
1083443118 11:62689941-62689963 ATGGACAGAGAAAGGGAGGAAGG + Intergenic
1083540665 11:63509755-63509777 CTGGAGAGACAGACAGAGGCTGG - Intronic
1083725490 11:64625832-64625854 GAGGAGAGACTAAGGGAAGTGGG - Intronic
1083751883 11:64765534-64765556 GGGGAGAGGCAAAGGGAGTTGGG + Intronic
1084383468 11:68828204-68828226 CTTGGGAGACACAGGGAGATGGG - Intronic
1084596958 11:70122690-70122712 CGAGAGAGACAGAGAGAGGTAGG - Intronic
1085474377 11:76780711-76780733 CTGGAGAGTTAAGGTGAGGTGGG + Intergenic
1085609794 11:77936754-77936776 CTGGAGAAAGAAAGGAAGGAAGG + Intronic
1085695954 11:78704960-78704982 CTGCAGGGACAGAGGGAGCTGGG - Intronic
1085981344 11:81730199-81730221 TTTGGGAGACAAAGGCAGGTGGG - Intergenic
1085983685 11:81757408-81757430 AAGGAGAGACAAAGGCAGGGAGG + Intergenic
1086138815 11:83471528-83471550 CTGGAGAGACTACTGGAGGATGG + Intronic
1086791073 11:91038707-91038729 CAGGAGGGAGAAATGGAGGTAGG + Intergenic
1087150763 11:94857413-94857435 GTGGAGAGAGAAAGATAGGTTGG + Intronic
1087792719 11:102423812-102423834 TTGGGAAGACAAAGGGAGGGAGG + Intronic
1088031946 11:105262049-105262071 CTGGAGAGAGGGAGGGAGGGAGG + Intergenic
1088087583 11:105999955-105999977 ATGGAGGGCCAAAGGGAGGTTGG - Intronic
1088350029 11:108875819-108875841 CTGGAGATACTCAGTGAGGTTGG + Intronic
1088363484 11:109016009-109016031 CTGAAGAGACAAAGAGAAATGGG - Intergenic
1088740711 11:112764851-112764873 CTGGAGAGGCTAAGTGAGCTGGG - Intergenic
1088861344 11:113802553-113802575 CTGGGGAGGCAAGGGGATGTAGG + Intronic
1089168742 11:116498162-116498184 ATGGAGCCAGAAAGGGAGGTGGG + Intergenic
1089845552 11:121455292-121455314 ATGGAGAGATAAGGGGTGGTGGG + Intronic
1090147378 11:124339978-124340000 CTGGAAAGACAAAGGGATACGGG + Intergenic
1090430738 11:126644295-126644317 CTGGAGCCACCAAGGGAAGTGGG + Intronic
1090446649 11:126770191-126770213 CTGAAGAAGCAAGGGGAGGTGGG - Intronic
1090562572 11:127948211-127948233 CAGGAGAGAAAAAGGGAAGAAGG - Intergenic
1090959601 11:131544379-131544401 CTGGAGAAAGAAGAGGAGGTAGG - Intronic
1091478925 12:806692-806714 CTGGGAAGACAAAGGGAAATAGG + Intronic
1091654244 12:2333661-2333683 CTGCAGAGAGAGATGGAGGTTGG + Intronic
1091854111 12:3725075-3725097 CTGGAGGGAAAATGGGAGGCAGG - Intronic
1092051286 12:5472518-5472540 CTGGAGGGAGAAAGTGAGGGTGG - Intronic
1092198513 12:6564968-6564990 CTGTAGATACAAGGGGATGTAGG + Intronic
1092629267 12:10361072-10361094 TTGTAGAGACAGAGGGAGGAGGG + Intergenic
1092904272 12:13087873-13087895 CTGGAGTGAGAGAGGGTGGTTGG - Intronic
1093267447 12:17020312-17020334 AGGGAGAGACACAGGGAGGAAGG - Intergenic
1093282416 12:17210835-17210857 CTAAAGAGAGAAAGGGAGATAGG + Intergenic
1094236559 12:28174106-28174128 CTGGAGGGCCAAAGTGAGGGTGG + Intronic
1095572456 12:43699111-43699133 GTAGAGAGACAGAGGGAGGGGGG - Intergenic
1095608919 12:44104269-44104291 ATGGAGAGATGAAGGGAGGGAGG - Intronic
1096418477 12:51434690-51434712 CTAGAGAAACAGAGGGAGGGAGG - Intronic
1096713388 12:53475041-53475063 CTGGAGACACAAGGGGCGGTCGG - Intronic
1096755525 12:53796352-53796374 CTGGAGAGACTAACGAGGGTGGG - Intergenic
1097225478 12:57474770-57474792 GTGGAGAGAAAAAGGGCAGTAGG + Intronic
1097293921 12:57943060-57943082 TTGTAGAGACTCAGGGAGGTAGG + Intronic
1097926528 12:65134223-65134245 AGGGAGAGAGAAAGGGAGGAAGG + Intergenic
1098285540 12:68903789-68903811 AAGGAGAGACAGAGGGAGGGAGG - Intronic
1098971887 12:76865937-76865959 ATGGGGACACAAAGGGAGGCTGG + Intronic
1100650269 12:96579712-96579734 CTACAGAGAAAAAGGGAGCTAGG - Intronic
1100888496 12:99099070-99099092 CTCAACAGAGAAAGGGAGGTTGG - Intronic
1101745348 12:107537595-107537617 CTGGAGTGAGCAAGGGAGGGTGG - Intronic
1102409426 12:112704429-112704451 ATGGAGAGACAGAGGGAAGGTGG + Intronic
1103334960 12:120182475-120182497 CTGGAGAGTCCCAGGCAGGTAGG - Intronic
1103713917 12:122932172-122932194 CTGGTGAGTCACAGGGTGGTGGG - Exonic
1104144485 12:126019307-126019329 ATGGAAACACAAAGGGAGCTGGG + Intergenic
1104177613 12:126348201-126348223 CTGGAGACTCGAAGGGAGGAAGG - Intergenic
1105892723 13:24693355-24693377 ATGGAGAGGAAAAGGGAGGAAGG - Intronic
1106472643 13:30071297-30071319 GTAGAGAGACAGAGGGAGGGGGG + Intergenic
1106598786 13:31169817-31169839 ATGAAGAGAGAAAGGGAGGAAGG - Intergenic
1107363939 13:39650180-39650202 AAGGAGAGACTAAGGGAGGGAGG - Intergenic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1108176593 13:47798740-47798762 CTGGAGAGGCAAAAGGAGGCAGG + Intergenic
1108498044 13:51044375-51044397 CTGGAGAGACAAAAGGGCCTGGG + Intergenic
1109130771 13:58582592-58582614 AGGGAGAGAGAAAGGGAGGGAGG - Intergenic
1109154253 13:58885490-58885512 CTGGATGGACAAAGGCATGTGGG - Intergenic
1109242922 13:59913289-59913311 GGGGAGAGACAAAGGGAGGTTGG - Intronic
1109642190 13:65204696-65204718 CTGTAGAGACAAAGGTTGGCAGG + Intergenic
1109789505 13:67228908-67228930 CTGAAAAGACTGAGGGAGGTAGG - Intronic
1111286997 13:86107221-86107243 AGGGAGAGACAGAGGTAGGTAGG - Intergenic
1113049981 13:106200138-106200160 ATGGAGGGACAGAGGGAGGGAGG - Intergenic
1113050924 13:106211064-106211086 AAGGAGAGAGAAAGGGAGGGAGG + Intergenic
1113522103 13:110948474-110948496 GTGAAGAGACAGAGGGTGGTAGG - Intergenic
1113665261 13:112136723-112136745 AGGGAGAGAGAAAGGGAGGGAGG - Intergenic
1113695030 13:112339234-112339256 CTGAAGAGAAGGAGGGAGGTGGG - Intergenic
1113849275 13:113408854-113408876 CTGCAGAGAGGAAGGGAGGAGGG + Intergenic
1114613956 14:24058657-24058679 CTGCAGGGACAAGGTGAGGTAGG - Intronic
1115292917 14:31793241-31793263 CTGGAAAGTAAAAGGAAGGTGGG - Intronic
1116965941 14:51015412-51015434 ATGGAGAGGTAAATGGAGGTGGG - Intronic
1117313472 14:54551267-54551289 CTGGGGAAACAAAGTGAAGTTGG - Intergenic
1117861053 14:60092835-60092857 CTGGAGAGACAAGAGGTTGTGGG - Intronic
1118463102 14:66004399-66004421 CAGGAGAGAGAAAGGGAGTTGGG - Intronic
1118707373 14:68492772-68492794 CTGGAGAGACAATGGTAGAAGGG - Intronic
1119134916 14:72208581-72208603 CTGGAGATACAAAGGGAAATAGG - Intronic
1119544632 14:75462702-75462724 CTGGAGAGACAAGGCTAGATTGG + Intronic
1119563461 14:75608981-75609003 CTGGAAAGACATAGGGAAGCTGG - Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1120297034 14:82655105-82655127 CATGAGAGTTAAAGGGAGGTTGG - Intergenic
1120648479 14:87101950-87101972 CTGGAGAGTCTGAGTGAGGTGGG - Intergenic
1121054156 14:90839275-90839297 CTGGAGAGACCTAGGGATGAAGG + Intergenic
1121481229 14:94276544-94276566 CAGGAGAGAGAAAGTGGGGTTGG + Intronic
1121573017 14:94961810-94961832 TTGGGGTGACAAAGGGAGGGTGG - Intergenic
1121870106 14:97399600-97399622 CAGGAGAGAGAGAGAGAGGTGGG + Intergenic
1124791571 15:32731888-32731910 GTGGAGTGAGAAAGGGAGGGTGG + Exonic
1125070510 15:35547938-35547960 CTGTAGAGACACATGGAAGTGGG + Intergenic
1125599150 15:40906260-40906282 CTGGAGGGCCAGAGGGGGGTGGG + Intergenic
1125602267 15:40922162-40922184 CAGGAGAAACAAAGTGAGTTTGG + Intergenic
1125736876 15:41933144-41933166 TTAGAAAGACAGAGGGAGGTGGG - Intronic
1126258127 15:46652425-46652447 CTGCAGAGACAAAGGCAGTGAGG + Intergenic
1126868024 15:52957386-52957408 CTGGAGGGAACCAGGGAGGTGGG + Intergenic
1127009541 15:54607734-54607756 CAGGAGAGACAAAGGGAAGGGGG + Intronic
1128224040 15:65989365-65989387 CTGGAGAGGAGAAGGGAGGTGGG - Intronic
1128349543 15:66879891-66879913 CTGGGGAGCCAGAGGGAGATGGG - Intergenic
1128361047 15:66962018-66962040 CTGGAGAGACAAAGCCGGGCAGG - Intergenic
1128417935 15:67464160-67464182 CTGGAGAGTCAAAGGTAAATAGG - Intronic
1128776921 15:70327775-70327797 TAGGAGAGATAAAGGGAGGTGGG - Intergenic
1128796320 15:70469340-70469362 CTGGAGTGGGATAGGGAGGTAGG - Intergenic
1128809347 15:70559378-70559400 CTGGAGACAGAAGGGGAGGGAGG + Intergenic
1129444443 15:75606918-75606940 CTGGAGAGAGATAAGGGGGTGGG + Intronic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1129669056 15:77597079-77597101 CTGGAGGGAGGAAGGGAGGGAGG - Intergenic
1130287118 15:82565307-82565329 CAGCAAAGACAAAGGGAAGTGGG + Intronic
1130347164 15:83058319-83058341 ATGAAGAGAAAAAGAGAGGTTGG - Intronic
1130422376 15:83761022-83761044 ATGGAGAGAAAAAGGAATGTAGG - Intronic
1130535151 15:84779071-84779093 GTAGAGAGACAGAGGGAGGGGGG + Intronic
1130577397 15:85104795-85104817 CTGAAGAGAGAAAGTGAGGCAGG + Intronic
1130926662 15:88390703-88390725 CTGCAGGGACAAAGAGAAGTGGG - Intergenic
1131166536 15:90145736-90145758 CTGGAGAGGCACTGGGAGTTGGG + Intergenic
1131168940 15:90162867-90162889 CTGGGGAGATAAAGGGAGAAAGG - Intronic
1131460029 15:92611247-92611269 AGGAAGAGACAAAGGGAGGGAGG + Intergenic
1131510533 15:93047408-93047430 CTGAAGCCACGAAGGGAGGTGGG + Intronic
1132020421 15:98356565-98356587 ATGGAGAGAGGAAGGGAGGGAGG + Intergenic
1132121639 15:99180935-99180957 CTGGAGGGACACAGGGAAGGAGG + Intronic
1132437834 15:101824806-101824828 CTGGAGAGACAAATGGAAACTGG - Intergenic
1132882760 16:2169757-2169779 CTTGGGACCCAAAGGGAGGTGGG + Intronic
1133387941 16:5385887-5385909 CTGGAGAGACAAGTGGGGGCAGG + Intergenic
1133559854 16:6941062-6941084 GTGGAGGGAGAAATGGAGGTGGG + Intronic
1133983182 16:10648734-10648756 CTAGAGAGACAAAGATAGGCTGG - Intronic
1135007497 16:18839592-18839614 CTGGAGGGACAGAGGAAGGAAGG + Intronic
1135556389 16:23440403-23440425 AATGAGATACAAAGGGAGGTTGG + Intronic
1136108462 16:28048971-28048993 CTGGAGAAAAAAAGGGAGAAGGG + Intronic
1136251991 16:29011469-29011491 CTGGAAAGCCAATGGGACGTGGG + Intergenic
1136451659 16:30357275-30357297 CTGGTGAGACAAAAGCAGGGGGG + Exonic
1136553011 16:30991458-30991480 CTGGAGAGACAAAGCCAGATGGG + Exonic
1136580793 16:31149732-31149754 CTGGAAAGACAGAGGTAGGCAGG + Intronic
1137946231 16:52735500-52735522 CTGGTGGGATAAAGGGAGGATGG - Intergenic
1139189649 16:64847309-64847331 GTGGAGGGACAAAGAGAGGAAGG - Intergenic
1139247252 16:65457143-65457165 ATGGATAGATAAAGGGATGTAGG - Intergenic
1139261196 16:65595853-65595875 TTGGAAACACAATGGGAGGTGGG - Intergenic
1139261752 16:65600697-65600719 CTTGAGAGATGAAGGGAGGTAGG - Intergenic
1140735697 16:77895982-77896004 TTGGAGAGAAAGATGGAGGTTGG + Intronic
1141272755 16:82555976-82555998 CTGGAGAGAAAACGTGGGGTTGG - Intergenic
1141406994 16:83803311-83803333 TTGGAGAGGCCAAGGCAGGTAGG + Intergenic
1142596813 17:1033771-1033793 GTGGAGAGACGGACGGAGGTAGG + Intronic
1142693576 17:1621250-1621272 CCGGGGAGACAAAGGGAGGGGGG + Intronic
1143178422 17:4969524-4969546 GTGGAGAGAGAAGGGGAGTTAGG + Intronic
1143722583 17:8823087-8823109 CTGGAGAGAGGAAGGGAGGGTGG + Intronic
1144357799 17:14462435-14462457 CGGGAGAGAGAGAGAGAGGTGGG + Intergenic
1144409688 17:14988573-14988595 CTAGACAGACAAGGGGAGGGTGG + Intergenic
1144641421 17:16939479-16939501 GGGGAGAGAGAAAGAGAGGTGGG - Exonic
1144809961 17:17992742-17992764 CTGGGGAGAAAAAGGGAGAAAGG - Intronic
1146117684 17:30156314-30156336 GGGGAGAGATAAAGAGAGGTTGG - Intronic
1146494688 17:33311096-33311118 CTGGAAAGAGAAAGAGAGGGAGG + Intronic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1146820872 17:35982913-35982935 ATGGAGAGAAAGAGGGAGGGAGG - Intergenic
1146927797 17:36757163-36757185 CTGGAGTGAGGAAGGGAGGGTGG - Intergenic
1147169358 17:38609091-38609113 CTGGGCAGGCAAAGGGAGATGGG + Intergenic
1147228594 17:39000799-39000821 CAGGAGAGAGAAAGTGATGTAGG - Intergenic
1148793760 17:50187602-50187624 CTGGAGAGACAAGGGCAGTGTGG + Intronic
1149568637 17:57656702-57656724 GTGGAGACAGAAAGGGAGGTCGG + Intronic
1150612988 17:66748818-66748840 CCGGAGAGAGAGAGGGAGGGCGG + Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150914019 17:69417790-69417812 AGGGAGAGAAAGAGGGAGGTAGG + Intronic
1150970258 17:70019361-70019383 GTAGAGAGAAAATGGGAGGTGGG - Intergenic
1151210230 17:72538936-72538958 CTGGAGAGAAACTGGGAGGAGGG + Intergenic
1151566925 17:74903846-74903868 CTGGTGGGACATGGGGAGGTGGG - Intergenic
1152050730 17:77974032-77974054 CTGGAGAGAGGGAGGGAGGGAGG + Intergenic
1152062730 17:78090512-78090534 CTGGAAATACAAGGGGAGGGGGG + Intronic
1152110361 17:78354370-78354392 GTGGAAAGACAGAGGAAGGTTGG + Intergenic
1152251605 17:79215461-79215483 ATGGAGAAAGGAAGGGAGGTTGG - Intronic
1152807221 17:82361857-82361879 CTGGAAAGGCAAAGGAAGGGAGG - Intronic
1152819553 17:82429791-82429813 CTAGAGAGAGAGTGGGAGGTGGG - Intronic
1152914637 17:83027134-83027156 CTGGACAGACACACGGAGGGGGG + Intronic
1153336942 18:3934470-3934492 ATGGAGAGAGAGAGGGAGGCAGG + Intronic
1153583517 18:6598825-6598847 CTGGAGAGACAGCGGAAGGCAGG - Intergenic
1153942597 18:9990788-9990810 CTGGACAGACAATGGCTGGTGGG - Intergenic
1154063580 18:11085878-11085900 TGGGAGAAAAAAAGGGAGGTAGG + Intronic
1154498610 18:14981054-14981076 CAGGAGAAACCAAGGGAGGCAGG - Intergenic
1155545830 18:26913818-26913840 CAGGAGAGAAAAATGGAGTTTGG + Exonic
1155945150 18:31840364-31840386 ATAGAGAGACAGAGGGAGGGAGG + Intronic
1156012531 18:32511616-32511638 CTGGAGAGACAGCGGGACGGAGG + Intergenic
1156451000 18:37266479-37266501 GTGGAGAGATAAACGGAGTTGGG + Intronic
1156595592 18:38544343-38544365 GAGGAGAGAGAAAGGGAGGAAGG - Intergenic
1157239837 18:45998636-45998658 CTGAAGGGAAAAAGGGAGGAAGG - Intronic
1158865630 18:61635573-61635595 CTGGAAAGAGAAAGGGAAGAAGG - Intergenic
1159113309 18:64085386-64085408 CTGGAGATCCAAAGGGAAGTGGG - Intergenic
1159874990 18:73800913-73800935 AGGGAGAGAGACAGGGAGGTGGG - Intergenic
1159923523 18:74247107-74247129 ATGGGGAGACAATGGGAGGATGG - Intergenic
1160521146 18:79508895-79508917 CATGAGAGAGAAAGGGAGGGAGG - Intronic
1161801393 19:6418429-6418451 CTGGAGAGGCACGGGCAGGTGGG - Intronic
1162045212 19:7994844-7994866 CTCGGGAGACAAAGGCAGGGAGG + Intronic
1162547323 19:11338755-11338777 CTGGAAAGACCAAGGGTGGGCGG - Intronic
1163935688 19:20441117-20441139 CTGGAGAGAGAAAGAGAGCATGG - Intergenic
1164581656 19:29438780-29438802 AGGGAGAGACAGAGGGAGGGAGG + Intergenic
1165394958 19:35558915-35558937 CTGAAGAGGGATAGGGAGGTAGG - Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165476906 19:36035912-36035934 AAAGAGAGACACAGGGAGGTGGG + Intronic
1165639846 19:37375100-37375122 CTGGAAAGACAATGTGAAGTGGG + Intronic
1166136553 19:40780665-40780687 CTGGAGAGATAAAGAGATGGTGG + Intronic
1166258405 19:41621381-41621403 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1166302569 19:41920898-41920920 AGGGAGAGACAGAGGGAGGGGGG - Intronic
1166839135 19:45685766-45685788 TTGGGGAGATAAATGGAGGTGGG - Intergenic
1167117277 19:47495595-47495617 CTCTGGAGAGAAAGGGAGGTGGG + Exonic
1167383167 19:49150021-49150043 CTGGAGAGGAACAGGGAGGAGGG + Intronic
1167389963 19:49188618-49188640 CTGGAGAGACAAAGAGGGCACGG - Intronic
1167470981 19:49676422-49676444 CTGACCAGACAAAGAGAGGTGGG + Intronic
1168291952 19:55361435-55361457 CTGCAGAGATAGAGGGAGGCAGG + Intronic
1168421077 19:56204155-56204177 CTGGAGGGATAGAGGGAGGGAGG - Intronic
1168424367 19:56226765-56226787 CTGGAGGGATAGAGGGAGGGAGG + Intronic
1168426305 19:56241978-56242000 CTGGAGGGATAGAGGGAGGGAGG - Intronic
925215834 2:2095291-2095313 CTGGAGAGAGAAAGGAGAGTTGG - Intronic
925251429 2:2442178-2442200 GTGGGGAGACTCAGGGAGGTGGG + Intergenic
925433102 2:3814138-3814160 CTGGAGTACCAAAAGGAGGTGGG - Intronic
925880481 2:8348380-8348402 ATGGAGTGACAAAGTGAGCTGGG + Intergenic
926001405 2:9336290-9336312 CAGGGGAGAGAAAGGGAGGGAGG - Intronic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
926990767 2:18677301-18677323 CTGGAGGGGCAAAGCCAGGTGGG + Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927258496 2:21061890-21061912 CTGGAGAAACAATAGGAAGTGGG - Intergenic
927361655 2:22242423-22242445 TAGGAGAGAGAAAGGGAGGGAGG - Intergenic
928387834 2:30884804-30884826 CTGGAAAGACAATGGGAATTGGG + Intergenic
928856807 2:35812332-35812354 CTGTAGAGACCACGGAAGGTTGG - Intergenic
929767131 2:44854360-44854382 CTGGAGAGAAAGAGAGATGTGGG + Intergenic
929820809 2:45271985-45272007 CTCGAGTGACAACGGGAGGTTGG - Intergenic
929917878 2:46151326-46151348 CTGGACAGAGAAAGGGAGAAGGG - Intronic
930831205 2:55745187-55745209 CTGGAGAAAGAAAAGGAGCTTGG - Intergenic
931257265 2:60584543-60584565 CTGGAGTTACAGAGGGAGTTGGG - Intergenic
931556974 2:63516925-63516947 AGGGAGAGAAACAGGGAGGTAGG + Intronic
933472563 2:82744727-82744749 AGGGAGAGAGAAAGGGAGGAAGG - Intergenic
934058925 2:88275998-88276020 CTTGAGAGGCCAAGGCAGGTGGG + Intergenic
934138590 2:89022044-89022066 GAGGGGAGACAAAGGGAGGAAGG - Intergenic
934230655 2:90178519-90178541 GAGGGGAGACAAAGGGAGGAAGG + Intergenic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
934781290 2:96971291-96971313 AAGGAGAGAGAGAGGGAGGTGGG - Intronic
935245990 2:101219256-101219278 CCAGAGAAACAAAGGGAGGGAGG - Intronic
935267338 2:101406276-101406298 GTGGAGAGAAGGAGGGAGGTAGG + Intronic
935332339 2:101986245-101986267 CCAGAGAGGAAAAGGGAGGTGGG - Intergenic
935900210 2:107783666-107783688 ATGGAGAGACAATGGGAGACAGG + Intergenic
936062390 2:109303608-109303630 CTGGCGAGACAAAGTCAGGGAGG + Intronic
936079860 2:109424762-109424784 CTGGGGAGAGAAAGAGAGATGGG - Intronic
937097492 2:119245246-119245268 CAGGAGGGACAAAGGGTGGAGGG + Intronic
937253445 2:120538788-120538810 CTGGAGAGAGAAAGGGGAGGAGG + Intergenic
937256846 2:120561674-120561696 CAGGAAAGAGAAAGGGAGGGAGG - Intergenic
937476653 2:122221245-122221267 AAGGAGAGAGAAAGGGAGGAAGG - Intergenic
937537089 2:122903020-122903042 GAGGAGAGAGAAAGGGAGATTGG + Intergenic
938688163 2:133761382-133761404 CTCAAAAGACAAAGAGAGGTTGG + Intergenic
938801319 2:134765926-134765948 ATGGAAAGTCAAAGGGAGGTAGG + Intergenic
940372994 2:152923088-152923110 AGGGAGAGAGAAAGGGAGGGAGG - Intergenic
940931859 2:159442118-159442140 CTGGATAGACAATGTGTGGTGGG + Intronic
941391432 2:164920031-164920053 TTTGAGAGACTGAGGGAGGTGGG + Intronic
941434936 2:165458264-165458286 AGAGAGAGAGAAAGGGAGGTGGG + Intergenic
941492524 2:166159919-166159941 TTGGATAGAAAAATGGAGGTGGG + Intergenic
941823628 2:169868232-169868254 TTGGTGAGATAAAGGGAAGTAGG - Intronic
941849427 2:170164421-170164443 CTGGAGAGGCAAAGGGAAGAGGG - Intergenic
942013750 2:171790343-171790365 CTGAAAAGACAAAGGAAGGAAGG - Intronic
942318433 2:174715102-174715124 CTAGGGAGACAAAGGAAGGAGGG - Intergenic
942525262 2:176846339-176846361 AAGGAGAGACAAAGGGAAGGAGG - Intergenic
943159268 2:184226118-184226140 CATGAGAGACAAATGGTGGTAGG - Intergenic
943667460 2:190624815-190624837 AAGGAGAGACAAAGAAAGGTTGG + Intergenic
943997179 2:194784720-194784742 AAGGAGAGACAAAGGGAGGAAGG + Intergenic
944646284 2:201783899-201783921 CAGGAGAGAGATAGGTAGGTTGG + Intergenic
946022605 2:216651458-216651480 CGGGAGGGACAAAGGGAAGGAGG - Intronic
946181932 2:217954099-217954121 CTGGAGAGACAAGGAGAGCCTGG - Intronic
946475961 2:220006469-220006491 CTGGAGAGCCAGCGGGAAGTAGG - Intergenic
947103237 2:226643977-226643999 CTGGATGGAGAAAGGGAGTTGGG + Intergenic
947442812 2:230138009-230138031 CAGAAGACACAGAGGGAGGTAGG - Intergenic
948124223 2:235553130-235553152 CTTGAGAGACAAGGGTTGGTGGG + Intronic
948369954 2:237482557-237482579 TTGGACAGATGAAGGGAGGTTGG + Intergenic
948456425 2:238106589-238106611 CTGGAGGGGCAAAGGGAGGATGG - Intronic
948582789 2:238999304-238999326 CTGGAGAGACGCAGGAAGCTGGG + Intergenic
1168972038 20:1937715-1937737 CTGGAGAGCCAAGGAGGGGTGGG - Exonic
1169111312 20:3035965-3035987 CGGGAGAGAGAAAGCGAGGAGGG + Intronic
1169827179 20:9782059-9782081 TCAGAGAGAGAAAGGGAGGTGGG - Intronic
1170459617 20:16564962-16564984 ATGGAGAGAGGAAGGGAGGAAGG - Intronic
1170493729 20:16904162-16904184 CTGGAGAGAGAGGGTGAGGTGGG + Intergenic
1170519148 20:17165838-17165860 TTTGAGAGACAAAGGTTGGTGGG + Intergenic
1170540384 20:17381753-17381775 GTGGAGAAAAAAAGGGAGGGTGG - Intronic
1171355002 20:24537126-24537148 CTGGAGAGATAAAGTTAGGAGGG - Intronic
1171849129 20:30295668-30295690 TTGGAGAGACCAAGGAATGTTGG - Intergenic
1172898612 20:38317896-38317918 GTGGAGTGGCAAAGGCAGGTAGG + Intronic
1173197167 20:40925110-40925132 CTGGAGAGCAGGAGGGAGGTGGG + Intergenic
1173317886 20:41961395-41961417 CTGTGGAGACACAGGGAGGCAGG - Intergenic
1173320311 20:41981748-41981770 TGGGAGAGGGAAAGGGAGGTGGG + Intergenic
1173377663 20:42503085-42503107 CTGGAGAGAAAAAAGGAGTTTGG + Intronic
1173837544 20:46135867-46135889 GTGGAGAGAAAATGGGAGGTAGG - Intergenic
1174436533 20:50510804-50510826 CTGGAGAACAGAAGGGAGGTGGG - Intronic
1174744702 20:53049683-53049705 AAGGAGAGACGAAGGGAGGTGGG + Intronic
1175371470 20:58495829-58495851 CTGGGGAGACAAGGGCATGTGGG - Intronic
1175467937 20:59205230-59205252 GTGCAGAGACAAAGGGAGGAAGG - Intronic
1175501167 20:59452254-59452276 CTGGAGAGAGACAGGAAGGCTGG - Intergenic
1175554968 20:59844692-59844714 TTGGGGAGAGAAAGAGAGGTTGG + Intronic
1175717692 20:61266327-61266349 CTCCAGAGACAAAGAGAGCTAGG - Intronic
1175924964 20:62467038-62467060 ATGGGGAGACATAGGCAGGTGGG - Intronic
1176056528 20:63151834-63151856 CTGGAGAGCCAGAGGGAGCCGGG + Intergenic
1176087263 20:63303840-63303862 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087306 20:63304000-63304022 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087352 20:63304160-63304182 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087364 20:63304200-63304222 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087376 20:63304240-63304262 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087389 20:63304280-63304302 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087412 20:63304360-63304382 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087425 20:63304400-63304422 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087438 20:63304440-63304462 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087461 20:63304520-63304542 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087473 20:63304560-63304582 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087485 20:63304600-63304622 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087496 20:63304640-63304662 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176110278 20:63407754-63407776 CTGGAGAGGTACAGGGAGGGGGG + Intronic
1177775759 21:25564011-25564033 CTGGAGAGACAAAGGTGAGCAGG + Intergenic
1178870066 21:36366175-36366197 GGGGAGAGAGGAAGGGAGGTGGG - Intronic
1179302367 21:40124084-40124106 CTGGAAAGACCCAGGTAGGTGGG + Intronic
1179311366 21:40198742-40198764 CTGGAGAGGCAGTGGGAGGTGGG + Intronic
1179411446 21:41167022-41167044 CTGGGGATAGAAGGGGAGGTGGG + Intergenic
1179438073 21:41375593-41375615 CTGGAGACACACAGGGAGAAGGG - Intronic
1179486273 21:41712593-41712615 CTGGAGAGACAAAGGGAGGTGGG - Intergenic
1179639187 21:42736073-42736095 CTGGAGAGAGGAGGAGAGGTGGG - Intronic
1180743681 22:18072159-18072181 CTGAAGAGCACAAGGGAGGTGGG + Intergenic
1181614094 22:24040154-24040176 CTGGAGGGACAGAGGTAGCTGGG + Intronic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1181881899 22:25987945-25987967 ATGGAGAGAAATTGGGAGGTGGG - Intronic
1182287838 22:29258742-29258764 CTAGAGGGCCAAGGGGAGGTGGG + Intronic
1182470297 22:30544230-30544252 CTGGAGAGCCAAGGAGGGGTGGG - Intronic
1182640704 22:31764745-31764767 ATGGAGAGAAAAAGGGAGAAGGG - Intronic
1182855753 22:33516330-33516352 CTGGTGAGACATAGGGATGTGGG - Intronic
1182973033 22:34595352-34595374 AGGGAGGGACAAAGGGAGGGAGG + Intergenic
1183084453 22:35478038-35478060 GTGGGGAGAGAAAGAGAGGTGGG - Intergenic
1183106468 22:35618658-35618680 CTGGATAGACAAAGAGATGATGG - Intronic
1183197487 22:36363446-36363468 AGGGAGAGACAGAGGGAGGCAGG + Intronic
1183264601 22:36817478-36817500 GTGGAGAGAGAAAGGGAGCAGGG - Intronic
1183325361 22:37188398-37188420 CTGCGGAGATAAAGGGAGGCAGG + Intronic
1183469358 22:37997407-37997429 CTGGAGAGAGACAGGGAGCCAGG - Intronic
1183667446 22:39253873-39253895 CTGGAGAGAGGAAAGGAGGGCGG + Intergenic
1184144310 22:42599882-42599904 CTGGAGAAACAAAGGGACCAAGG + Intronic
951483540 3:23186892-23186914 TGGGTGAGACAGAGGGAGGTGGG - Intergenic
952283616 3:31947018-31947040 CAGAAGAGACAAAGGCAGGAGGG + Intronic
952501923 3:33971019-33971041 TTGGAGAGTCAGAGGTAGGTTGG + Intergenic
953475969 3:43206115-43206137 CAGGAGACAGAAAGGGAGGCAGG + Intergenic
954030204 3:47813815-47813837 CTGGAGATACACAAGGAGGCAGG - Intronic
954517377 3:51190785-51190807 GTGGAGGGACAAAGCCAGGTGGG + Intronic
954706632 3:52484490-52484512 CTGGAGAGACCAGGGCGGGTGGG - Intronic
954749591 3:52806080-52806102 CTGCAGATACAAAGGGAGAGAGG - Intronic
955040608 3:55314088-55314110 GTGGAGAGCCGAAGGGATGTGGG - Intergenic
955693266 3:61610774-61610796 ATGGAGAGAGAGAGGGAGGGAGG - Intronic
956283051 3:67578898-67578920 ACGGAGAGGCCAAGGGAGGTTGG + Intronic
956890081 3:73604732-73604754 CTGGAGAGAAAGAGGGAGATAGG + Intronic
959336397 3:105070581-105070603 ATGGAGGGACAGAGGGAAGTGGG + Intergenic
959371514 3:105532797-105532819 CTGGAGAGGCAAAGAAAAGTTGG + Intronic
961007351 3:123413845-123413867 CTGGGGAGACAAAGGGGTGGGGG + Intronic
962201510 3:133404289-133404311 GTAGGGAGACAGAGGGAGGTAGG - Intronic
962376739 3:134864516-134864538 GAGGAGAGAAAAAGGGAGGGAGG - Intronic
962458906 3:135591058-135591080 CTACAGAGACAGAGGGAGGGTGG - Intergenic
962735193 3:138319267-138319289 CAAGAGGGACACAGGGAGGTGGG + Intronic
963455694 3:145543827-145543849 CAGGAGAAAGAAAGAGAGGTGGG - Intergenic
964107602 3:153055908-153055930 AGGGAGAGAGAAAGGAAGGTAGG + Intergenic
965514716 3:169608548-169608570 CTGGAAACACAAATGGAGGGAGG - Intronic
965820114 3:172676609-172676631 GTACAGAGACAAAGGGAGGGGGG - Intronic
966763985 3:183442299-183442321 CAGGAGAGAAAAAGGGAGTAGGG - Intergenic
967830155 3:193911771-193911793 CTGAAGAGACAAAAGAAGGAGGG - Intergenic
967837392 3:193976205-193976227 TTGGAGAGAAAGAGGGAGTTAGG + Intergenic
968284498 3:197500150-197500172 AGGGAGAGAGAAAGGAAGGTGGG + Intergenic
968440891 4:623911-623933 CCGGAGAGGAAAAAGGAGGTGGG + Intergenic
968977227 4:3828235-3828257 CTGGGGTGAGAAATGGAGGTTGG + Intergenic
969320515 4:6409701-6409723 CTGGAGACACTAAGGTTGGTCGG + Intronic
969376694 4:6768025-6768047 CGTGGGAGGCAAAGGGAGGTCGG - Intergenic
969436500 4:7192301-7192323 CTGGAGAGAGGGAGGGAGGACGG + Intergenic
969559882 4:7939978-7940000 CTGAGGGAACAAAGGGAGGTTGG + Exonic
969608205 4:8212678-8212700 CTGGAGGGGCAGACGGAGGTTGG - Intronic
969714919 4:8863749-8863771 CTGGAGTGGCCAAGGGCGGTGGG + Intronic
971307505 4:25496472-25496494 CTGGAGAGATAAATGGTGGCAGG - Intergenic
971455061 4:26836415-26836437 TTGGAGGGGCAGAGGGAGGTGGG + Intergenic
971757225 4:30720294-30720316 GAGGAGAGAGAAAGGGAGGGAGG + Intergenic
972710582 4:41590600-41590622 CAGAAGAGAAAATGGGAGGTGGG - Intronic
973093099 4:46162963-46162985 CTGGGGAGACAAAGGCATGACGG + Intergenic
975143385 4:70940297-70940319 CTGGGTAGACAGAGGAAGGTGGG - Intronic
977148693 4:93480890-93480912 CTGTAGAGATTCAGGGAGGTGGG - Intronic
977990938 4:103441734-103441756 CTGGAAAGTCAAGGGAAGGTTGG + Intergenic
978203666 4:106053101-106053123 ATGGATAGACAAAGAGAGGGAGG - Intronic
980767952 4:137332536-137332558 CAAGAGAGACAGAGGGAAGTTGG + Intergenic
980977933 4:139628890-139628912 CTTGAGAGAGAAAGGGAGAAGGG - Intergenic
981867819 4:149446498-149446520 CTGGAGAGGCACAGGCATGTGGG + Intergenic
982296310 4:153833197-153833219 CTGGGGAGGCCAAGGCAGGTGGG + Intergenic
982323129 4:154101137-154101159 CTGGAGATACACAGTGAGGTGGG - Intergenic
982743959 4:159087006-159087028 CTTGAGAGACAGAGGCAGGAGGG + Intergenic
985151391 4:186950590-186950612 CAGGAGAGATGAAGGGAGGCTGG - Intergenic
985394841 4:189531238-189531260 GTGGAGAAGCAAAGGCAGGTGGG + Intergenic
986102380 5:4625862-4625884 CAAGAGAGACAAAGAGAGGAAGG - Intergenic
987810652 5:22831317-22831339 TAGGAGAGACAAAGGAAGGTAGG + Intronic
987824582 5:23012581-23012603 AAGGAGAGAGAAAGGGAGGAAGG - Intergenic
988011783 5:25497815-25497837 TTTGAGAGATAAAAGGAGGTAGG + Intergenic
988545927 5:32157277-32157299 CTGGTGGGAAAAAGGGAGGAAGG - Intronic
990010628 5:50993530-50993552 CTGCAGGGACAAAGGTAGGAGGG + Intergenic
990032507 5:51278694-51278716 CTGTAGAGACAGAGAGAGCTTGG + Intergenic
990081121 5:51915018-51915040 CCAGAAAGACAAAGGCAGGTGGG + Intergenic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
990642056 5:57797481-57797503 CTGTAGAGACCAAGGGAAATTGG - Intergenic
990716002 5:58637333-58637355 CAGGAGAGACAAAGGGAAAGAGG - Intronic
991682355 5:69151727-69151749 CTGGAGAGATAAAGAGAGAGAGG - Intergenic
992256724 5:74928754-74928776 ATGGAGGGAGAAAGGGAGGGAGG - Intergenic
993375054 5:87141070-87141092 AAGGAGAGAGAAAGGGAGGGAGG + Intergenic
993508255 5:88737952-88737974 AAGGAGAGACAAAAGGGGGTTGG + Intronic
995180998 5:109230127-109230149 CTGGAGAATGAATGGGAGGTAGG + Intergenic
995750869 5:115452060-115452082 CTGTACAGACACAGAGAGGTGGG - Intergenic
995896808 5:117022674-117022696 GTAGAGAGAGAAAGGGAGGGAGG - Intergenic
996310283 5:122096606-122096628 CTGCAGAGACAGAGGGATGGGGG - Intergenic
997076053 5:130678926-130678948 AGGGAGAGAAAAAGGGAGGGAGG + Intergenic
998226390 5:140329958-140329980 CTGGAGAAACAAAGTGTGCTTGG + Intergenic
998268069 5:140681366-140681388 ATGTAAAGACAAAGGGAGGCTGG + Intronic
999327893 5:150654698-150654720 ATGGAGATACAAAAGGAAGTCGG - Intronic
999652174 5:153778141-153778163 AGGGAGAGACAAAGGAAGGAGGG + Intronic
1000016335 5:157280572-157280594 CAGGAGAAAAAAAGGGAAGTTGG + Intronic
1000020247 5:157311873-157311895 CTGGAGAGTAGAAGGGAGGGAGG + Intronic
1000209803 5:159098599-159098621 ATGGAGAGAGGAAGGGAGGAAGG + Intronic
1000821715 5:165992787-165992809 CTGGAAAGAGATGGGGAGGTCGG + Intergenic
1001712108 5:173787202-173787224 CTGGAAGGACAAAGAGAGATTGG - Intergenic
1001759877 5:174198602-174198624 CTGGAGAGACCCAAGGGGGTAGG + Intronic
1002030968 5:176430199-176430221 CTGGAGAGAGAAACAGAGGGTGG - Intergenic
1002551353 5:179995197-179995219 CTGGAGAGAGAGAGAGAGGCAGG - Intronic
1002618965 5:180473160-180473182 CTGGATAGGTGAAGGGAGGTAGG - Intergenic
1003421410 6:5961526-5961548 CTGGAGAGACCATGGGAGCAAGG + Intergenic
1004602385 6:17162831-17162853 CGAGAGAGAGAAAGGGAGGAAGG + Intergenic
1005224018 6:23620247-23620269 AGGGAGAGACAGAGGGAGGGAGG + Intergenic
1005436369 6:25816332-25816354 GGGGAGTGACCAAGGGAGGTAGG - Intronic
1005619064 6:27603214-27603236 CTGGAGCAAGAAAGGGTGGTAGG + Intergenic
1006903412 6:37517235-37517257 CTGGAGAGACTGAGGGCAGTCGG + Intergenic
1007282105 6:40720388-40720410 CGGGAGGGACAGAGGGAGGGAGG + Intergenic
1007323899 6:41045916-41045938 CTGGAGATACAAAGGTGGGTGGG - Intronic
1007705866 6:43790916-43790938 GTGGAGAGACAGAGAGAGATAGG + Intergenic
1008326419 6:50187521-50187543 CAGGAGAGAGAAAAGGAGGGAGG - Intergenic
1008606025 6:53140413-53140435 TTGCAGAGACAAAGGAAGTTTGG + Intronic
1009344747 6:62599693-62599715 CTGAAGAGAAAATGAGAGGTGGG + Intergenic
1011011906 6:82712388-82712410 CTGGAGAAAAGAAGGAAGGTGGG + Intergenic
1011436065 6:87338361-87338383 CTGGAGAGCAAAAGAGAGGCTGG + Intronic
1012519986 6:100109876-100109898 AAGGAGAGAGAAAGGGAGGATGG - Intergenic
1012607757 6:101179205-101179227 CAGGAGAGAAAAAGAGAGGAAGG - Intergenic
1013847534 6:114471938-114471960 CTGGAGAGACAGAAGCTGGTAGG - Intergenic
1014011591 6:116482292-116482314 GTGGAGAGTGAAATGGAGGTGGG + Intergenic
1014249172 6:119098428-119098450 CTTGTAAGACACAGGGAGGTTGG - Intronic
1014942338 6:127457448-127457470 CTGGAGAGCCAAAGAGATATGGG - Intronic
1015102670 6:129499923-129499945 TTGGAGAGACAGAGGGGGGCAGG + Intronic
1015680979 6:135808138-135808160 CTGGAGAGACAGAGGGTGACTGG - Intergenic
1017025753 6:150179091-150179113 CTGGGGAGACCCAGGGAGGAAGG + Intronic
1017039323 6:150295117-150295139 CTGAAGAGACAAAGGGAGGAAGG + Intergenic
1018153770 6:160965750-160965772 CAGGAGAGACAAGGGAAGGCAGG + Intergenic
1018190871 6:161308143-161308165 GTTCAGAGACAGAGGGAGGTGGG + Intergenic
1018342057 6:162861635-162861657 GTGGTGAGGCAGAGGGAGGTGGG - Intronic
1018728286 6:166630111-166630133 CTGGACAGACAAGAGGAGGCGGG + Intronic
1018733188 6:166668675-166668697 CTGAAGAGGCACAGGGAGGCTGG + Intronic
1018849966 6:167579834-167579856 CTGGAGAGACAAAGAGGAGGGGG + Intergenic
1019173995 6:170150556-170150578 CTGGAGAGAGATGGGCAGGTGGG + Intergenic
1019315505 7:382473-382495 ATAGAGAGAGAAAGGGAGGGAGG + Intergenic
1019627343 7:2024349-2024371 CAGGAAAGAGAAAGGGAGCTGGG - Intronic
1019779223 7:2929808-2929830 CTGGAGGGAGAGAGGGTGGTGGG + Intronic
1020029152 7:4920717-4920739 CGGAAGAGAGAAAGGGAGGAAGG - Intronic
1020381182 7:7548353-7548375 CTGGAGAGAGAAAGGGGAATAGG + Intergenic
1020572272 7:9879235-9879257 AGGGAGAGAGAAAGGGAGGGAGG + Intergenic
1020997345 7:15280486-15280508 GTGGAGGGACAAAGCCAGGTGGG - Intronic
1021494004 7:21252450-21252472 ATGGAGTGATGAAGGGAGGTTGG + Intergenic
1022540328 7:31128957-31128979 CTGTGGAGAAAAAGGGAGGAGGG - Intergenic
1022756676 7:33300225-33300247 CTGGAGAGAGGGAGGAAGGTGGG - Intronic
1022797304 7:33742393-33742415 CTGGAGAGTAAGGGGGAGGTGGG + Intergenic
1023021667 7:36016966-36016988 GTGGAGAGACAAAGAGAGAGAGG - Intergenic
1023504714 7:40887709-40887731 CTAGAGAGACAAAGGTGGGAGGG + Intergenic
1023506198 7:40901962-40901984 ATGGAGAGGCAAAGAGAGCTTGG + Intergenic
1023992753 7:45139212-45139234 CTGGGGAGACAGAGAGAGGGCGG - Intergenic
1024962624 7:54993727-54993749 CTGGAGAGACAGAAGAATGTGGG - Intergenic
1025843308 7:65172227-65172249 CTGGAGAAAGAAAGGAAGGAAGG - Intergenic
1025879735 7:65523740-65523762 CTGGAGAAAGAAAGGAAGGAAGG + Intergenic
1025893702 7:65678850-65678872 CTGGAGAAAGAAAGGAAGGAAGG - Intergenic
1026432668 7:70362658-70362680 GAGGAGAGAGAAAGGGAGGGAGG - Intronic
1026766084 7:73160736-73160758 CTGGAGAGACAAGGTGAGGTGGG - Intergenic
1026931038 7:74223119-74223141 CTGGAGAGAGGGAGGGAGGCAGG - Intronic
1027042559 7:74970432-74970454 CTGGAGAGACAAGGTGAGGTGGG - Intronic
1027081084 7:75231925-75231947 CTGGAGAGACAAGGTGAGGTGGG + Intergenic
1027501353 7:78955680-78955702 AGGGAGAGAGAAAGGGAGGGAGG - Intronic
1028062346 7:86338670-86338692 CTAGAGGGACAATGGTAGGTAGG - Intergenic
1028320313 7:89451289-89451311 CTGGGGAGATGAAGGGAGGGAGG - Intergenic
1028437394 7:90820492-90820514 CAGGAGAGACAGAGCGAGGCAGG - Intronic
1028960225 7:96740327-96740349 CTGGGGTGACAGAGGGAGTTAGG + Intergenic
1029374317 7:100168665-100168687 CTGGCGGCACAAAGGGAGGAGGG - Exonic
1029412815 7:100426772-100426794 AGGGAGAGAGAAAGGGAGGAGGG - Intronic
1030808424 7:113945428-113945450 GTGGAGGGACAAAGCCAGGTTGG - Intronic
1031388448 7:121182517-121182539 AGGGAGAGAAAAAGGGAGGGAGG - Intronic
1032504213 7:132423763-132423785 CAGGAGAGAGAAGGGGAGGGAGG - Intronic
1032834322 7:135659414-135659436 CAGGAGAGAAAAAGGGAGGGGGG - Intergenic
1032934280 7:136711176-136711198 GGGGAGAGACAGAGGGAGGGAGG + Intergenic
1033805961 7:144954492-144954514 CAGGAGTGACAAAGTGGGGTAGG + Intergenic
1033943264 7:146681566-146681588 GTGGAGAGTGAAAGGGTGGTGGG + Intronic
1034111811 7:148544481-148544503 CTGGAGAAATAAGGGGAGGAAGG + Intergenic
1034704912 7:153132778-153132800 CCAGAGAGAGAAAGGGAGGGAGG + Intergenic
1035750372 8:1991947-1991969 CGGTAGACACACAGGGAGGTAGG + Intronic
1037201292 8:16255850-16255872 CTGCAGAGTAAAATGGAGGTGGG - Intronic
1037272754 8:17147385-17147407 CTGGAAGGACAAAGGGAAGGTGG - Intergenic
1037848198 8:22303501-22303523 CTCCAGAGACTGAGGGAGGTGGG - Intronic
1038228737 8:25681236-25681258 CTGGAGAGTCAGTGGAAGGTAGG + Intergenic
1038791091 8:30668862-30668884 GTGGAGAGATAAAGGAAGCTTGG + Intergenic
1039220084 8:35320718-35320740 CTGGACATCCAAAGGGAGGAGGG + Intronic
1039725884 8:40216078-40216100 AAGGAGAGTAAAAGGGAGGTAGG + Intergenic
1039766828 8:40637494-40637516 CTGGGGAGACAAGGAGTGGTAGG - Intronic
1039862228 8:41468866-41468888 CTGGAGAGACAGGGTGAGGCTGG - Intergenic
1040089984 8:43387774-43387796 CTGGAGAGACCTAGTGAGGGAGG - Intergenic
1041193572 8:55377585-55377607 GGGGAGAGAGAAAGGGAGGAAGG + Intronic
1041543085 8:59009090-59009112 ATGGAGAAAGAAAGGGAGGGAGG - Intronic
1041552179 8:59115665-59115687 CTGGACAGACACATGGAGGCTGG - Intronic
1041702449 8:60806398-60806420 CTAGAGAGAAAAAGGTAGGGTGG + Intronic
1043099012 8:76016198-76016220 CTGAAGAGAGAAAGAGAGATGGG - Intergenic
1043335462 8:79170996-79171018 AGGGAGAGATAAAGAGAGGTTGG - Intergenic
1044335481 8:90979277-90979299 CTGCAGAGATGAAGGGGGGTGGG + Intronic
1044489317 8:92793311-92793333 CTGAAGAGTCAGAGGGAAGTAGG + Intergenic
1044514975 8:93127196-93127218 GTGGAGAGTGAATGGGAGGTAGG + Intergenic
1044728464 8:95211971-95211993 CTGGAGAGAGAAGGCGAGGAAGG + Intergenic
1044810010 8:96050539-96050561 GTGGGGAGATAAAGAGAGGTTGG + Intergenic
1044900310 8:96937015-96937037 CTGGAAAGAAAAAGGGAGGAAGG - Intronic
1045248111 8:100460718-100460740 CTGGAGACAGAAAGGTAAGTAGG + Intergenic
1045502437 8:102753880-102753902 CTGGAGAGTCACTGGGAGCTGGG + Intergenic
1045855690 8:106762950-106762972 CTGGGGAGAAAAAGGGAGGGTGG - Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1046986226 8:120391414-120391436 GTGGAGGGACAAAGCCAGGTGGG + Intronic
1047006891 8:120630121-120630143 CTGAAGGGGCAAAGGGAGGCTGG - Intronic
1047177505 8:122555465-122555487 CTGTAAATACAAAGGGAGATTGG - Intergenic
1047350284 8:124067073-124067095 CTGGAGAGACAGTGGGGAGTAGG + Intronic
1049196346 8:141317878-141317900 ATAGAAAGAAAAAGGGAGGTGGG + Intergenic
1049308448 8:141920487-141920509 CTGGTGGGACCATGGGAGGTTGG - Intergenic
1049335025 8:142079755-142079777 CTGCAGAGAGGAGGGGAGGTCGG - Intergenic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049834782 8:144728203-144728225 TAGGAGAGAGAGAGGGAGGTAGG + Intronic
1050120336 9:2301204-2301226 CAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1050263328 9:3863888-3863910 GTGGAAAGAAAAAGGGAGGAGGG + Intronic
1050690415 9:8221295-8221317 CTGGCTGGACAAAGGGATGTGGG + Intergenic
1051373192 9:16376148-16376170 GGGGAGAGTGAAAGGGAGGTAGG + Intergenic
1052914919 9:33917514-33917536 CTGTAGAGACGAAGTGAGGCGGG - Exonic
1053203649 9:36169094-36169116 TAGGAGAGATAAGGGGAGGTGGG - Intergenic
1054453999 9:65420313-65420335 CAGGAGAGAAGAAGGGAGGGAGG + Intergenic
1055108142 9:72533585-72533607 CTGGAGAGACAAACTCAGGCTGG + Intronic
1056455166 9:86752715-86752737 CTTGAGAGACATGGGGTGGTGGG - Intergenic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1056797818 9:89670654-89670676 CTGGAGAGACAGAGGCACCTAGG + Intergenic
1056993159 9:91429518-91429540 CTGGAGTGACAAAAGTTGGTGGG - Intergenic
1057123710 9:92599952-92599974 CAGGAAAGACCAGGGGAGGTGGG - Intronic
1057344052 9:94231987-94232009 CTGAAGAAACAAAGTGAGGTGGG + Intergenic
1058309393 9:103483160-103483182 CAGGAGAGAGAGAGAGAGGTTGG - Intergenic
1058525742 9:105856297-105856319 CCGGACAGACAAAGGGAGAGTGG - Intergenic
1058662028 9:107275364-107275386 GGAGAGAGACAAGGGGAGGTGGG - Intergenic
1059589040 9:115637659-115637681 AGGGAGAGAAAAAGGGAGGGAGG + Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059761711 9:117344087-117344109 GTAGAGAGACATGGGGAGGTGGG + Intronic
1059929874 9:119249999-119250021 AGGGAGAGAGAAAGGGAGGGAGG + Intronic
1060102825 9:120855882-120855904 CTGGAGAGGGAAAAGGAGGGAGG - Exonic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1060774941 9:126366142-126366164 CTGGTGAGATGAAGGGAGGGTGG - Intronic
1060809656 9:126604202-126604224 ATGGAGAGCCAAGGGGAGGGAGG + Intergenic
1061295311 9:129673861-129673883 CTGTTTAGACAGAGGGAGGTTGG + Intronic
1061407919 9:130402946-130402968 GTGGAGAGCCAGAGGCAGGTGGG + Intronic
1061486334 9:130922329-130922351 CTGGAGAGAGACTGGGAGGCCGG - Intronic
1061679915 9:132237906-132237928 CTGGAGGGACAAAGTGAAGGGGG + Intronic
1185889562 X:3812407-3812429 CTGCAGAGAGAGAGGGAGGGAGG - Intergenic
1186189185 X:7052563-7052585 ATGGAAAGAAAAAGGGAGGGAGG - Intronic
1187715483 X:22098187-22098209 CAGGACAGAGAAAGGGAGGGAGG + Intronic
1188444675 X:30243849-30243871 ATGGAGAGCCAAAGGGGAGTTGG + Exonic
1190055037 X:47176342-47176364 ATGGAGGGAAGAAGGGAGGTAGG - Intronic
1190072072 X:47287804-47287826 CAGGTGAGGCAAAGGGAAGTGGG + Intergenic
1190216071 X:48480262-48480284 CAGCAGAGACTAAAGGAGGTGGG + Intronic
1191826570 X:65372465-65372487 CAGGAGAGAGGAAGGGAGGAAGG + Intronic
1192574018 X:72228500-72228522 CGGGTGAGGCAAAGGGAAGTGGG - Intronic
1192611757 X:72573702-72573724 CTGCAGAAACAAGAGGAGGTAGG - Intergenic
1193841053 X:86409012-86409034 CTGGAGAGATATAAGAAGGTAGG - Intronic
1194048419 X:89037027-89037049 GTGGAGGGACAAAGCCAGGTGGG + Intergenic
1194053111 X:89096896-89096918 CTGGAGAGAAATAAGCAGGTTGG + Intergenic
1195293436 X:103451382-103451404 CTGGAGGGAGACAGGTAGGTGGG - Intergenic
1195719714 X:107855037-107855059 CTGGAGTGTCATAGGGAAGTTGG + Intronic
1197634791 X:128902763-128902785 CGGGAGGGAGATAGGGAGGTGGG + Intergenic
1197777310 X:130126958-130126980 TTGGATAGATAAAGGGAGGAGGG + Intergenic
1197980709 X:132216508-132216530 CTTGAGAGAGAAGGGGAGGGCGG + Intronic
1198078174 X:133214021-133214043 GGGGAGAGGCAAATGGAGGTGGG - Intergenic
1198178047 X:134174368-134174390 TTGGAGAGACAGAAGAAGGTTGG + Intergenic
1198557911 X:137815612-137815634 CTGGAGATAGGAAGGGATGTGGG + Intergenic
1198644070 X:138787472-138787494 GTGAAGAGACAAAGGGAAGTTGG - Intronic
1198669295 X:139061559-139061581 CTGGAAAGTCCAAGGTAGGTGGG - Intronic
1199296480 X:146164641-146164663 AGGGAGAGACAGAGGGAGGGAGG + Intergenic
1199922982 X:152429286-152429308 CTGGAGAAAGAGAGGGAGGGAGG - Intronic
1200012689 X:153131406-153131428 CTAGAGAGAGAGAGAGAGGTAGG + Intergenic
1200026911 X:153268511-153268533 CTAGAGAGAGAGAGAGAGGTAGG - Intergenic
1200213909 X:154359042-154359064 CTGGAAGGACTGAGGGAGGTTGG + Exonic
1200645749 Y:5781350-5781372 AAGGAGAGAGAAAGGGAGGGAGG - Intergenic
1201458904 Y:14201222-14201244 GGGGAGAGAGAAAGGGAGGAAGG + Intergenic
1202275123 Y:23109957-23109979 CTGAACAGAGAATGGGAGGTGGG + Intergenic
1202290905 Y:23310732-23310754 CTGAACAGAGAATGGGAGGTGGG - Intergenic
1202428114 Y:24743679-24743701 CTGAACAGAGAATGGGAGGTGGG + Intergenic
1202442677 Y:24926412-24926434 CTGAACAGAGAATGGGAGGTGGG - Intergenic