ID: 1179486564

View in Genome Browser
Species Human (GRCh38)
Location 21:41714225-41714247
Sequence CCCACTCACAGGAGAGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 243}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179486551_1179486564 25 Left 1179486551 21:41714177-41714199 CCGCCCTTCTACAGCACCGGTGG No data
Right 1179486564 21:41714225-41714247 CCCACTCACAGGAGAGCTGCTGG 0: 1
1: 0
2: 2
3: 24
4: 243
1179486553_1179486564 22 Left 1179486553 21:41714180-41714202 CCCTTCTACAGCACCGGTGGCAC No data
Right 1179486564 21:41714225-41714247 CCCACTCACAGGAGAGCTGCTGG 0: 1
1: 0
2: 2
3: 24
4: 243
1179486549_1179486564 27 Left 1179486549 21:41714175-41714197 CCCCGCCCTTCTACAGCACCGGT No data
Right 1179486564 21:41714225-41714247 CCCACTCACAGGAGAGCTGCTGG 0: 1
1: 0
2: 2
3: 24
4: 243
1179486550_1179486564 26 Left 1179486550 21:41714176-41714198 CCCGCCCTTCTACAGCACCGGTG No data
Right 1179486564 21:41714225-41714247 CCCACTCACAGGAGAGCTGCTGG 0: 1
1: 0
2: 2
3: 24
4: 243
1179486558_1179486564 9 Left 1179486558 21:41714193-41714215 CCGGTGGCACAAATGCTGGGGAC No data
Right 1179486564 21:41714225-41714247 CCCACTCACAGGAGAGCTGCTGG 0: 1
1: 0
2: 2
3: 24
4: 243
1179486554_1179486564 21 Left 1179486554 21:41714181-41714203 CCTTCTACAGCACCGGTGGCACA No data
Right 1179486564 21:41714225-41714247 CCCACTCACAGGAGAGCTGCTGG 0: 1
1: 0
2: 2
3: 24
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179486564 Original CRISPR CCCACTCACAGGAGAGCTGC TGG Intergenic
900297897 1:1961332-1961354 CAGACGCACAGCAGAGCTGCGGG + Intronic
900405629 1:2491784-2491806 CCCACCCACAGCAGGACTGCGGG - Intronic
900596851 1:3483829-3483851 CCCGGTCACAGGACAGCAGCAGG - Intergenic
900603213 1:3511997-3512019 CCCACTCACGGTAGCACTGCCGG + Exonic
900823008 1:4904185-4904207 CCCACTGACAGGAGAGCATTAGG - Intergenic
901023674 1:6267906-6267928 CCACCTCACAGCAGAGTTGCGGG + Intronic
901125775 1:6927783-6927805 CTAACTCACAGGAGACCTGCAGG - Intronic
901650695 1:10741363-10741385 CCCACCCCCAGGACAACTGCTGG - Intronic
901738050 1:11324762-11324784 CCCCCACACAGGAGAACTGTTGG + Intergenic
902618738 1:17638339-17638361 CCCTCTCAGAGGAGGGCTCCAGG + Intronic
902809497 1:18880165-18880187 CCCACCCCCAGCAAAGCTGCGGG + Intronic
902825998 1:18974713-18974735 CCCACTCACAGGAGAGAGGCTGG - Intergenic
903363267 1:22790420-22790442 GCCACTCCCAGCAGACCTGCTGG - Intronic
904707123 1:32399944-32399966 CCCACCCAGATGATAGCTGCAGG + Intergenic
907666444 1:56437283-56437305 CCCCCACACAGCAGAGCTCCAGG + Intergenic
908994407 1:70134233-70134255 CCCACTGAAAGGAGAGAGGCTGG - Intronic
909497192 1:76291343-76291365 CCCTCTGACAGAGGAGCTGCAGG - Intronic
910617737 1:89218006-89218028 GCCAGACACAGGAGAGCTGAAGG - Intergenic
915835816 1:159173557-159173579 CCCACTCACTGAGGAGCTGAAGG + Intronic
919796662 1:201325201-201325223 CCTACTCCATGGAGAGCTGCGGG - Intronic
919982781 1:202652664-202652686 CCCCCTCCCAGGATAGCTGAGGG - Intronic
920106431 1:203556556-203556578 GGCACTCCCAGGAGAGCAGCTGG + Intergenic
920243121 1:204568285-204568307 CGATCTCAGAGGAGAGCTGCTGG + Intergenic
920678493 1:208055240-208055262 CACACTAACGGGAGAGCTGGAGG + Intronic
922197648 1:223373562-223373584 CCCAAACACAGGAGAGCACCAGG + Intergenic
922872128 1:228911396-228911418 CAGACCCACAGGAGAGCAGCTGG - Intergenic
1063532021 10:6842442-6842464 TCCACTCACAGGATAAATGCAGG - Intergenic
1064874282 10:19975642-19975664 CCAACTCAAAAGAGAGATGCAGG - Intronic
1064984294 10:21194618-21194640 TCCACTCCCAGGACAGCTGCTGG - Intergenic
1067036626 10:42925699-42925721 CCCACTCAGAGGTGGGCTGGTGG - Intergenic
1067346600 10:45442752-45442774 CCCAGCCACAGGAGGGCAGCAGG - Intronic
1067450726 10:46380456-46380478 CCCACTCACGGTAGTGCTGAGGG - Intronic
1067586517 10:47479295-47479317 CCCACTCACGGTAGTGCTGAGGG + Intronic
1067793852 10:49306880-49306902 CCCACTGCCAGGCCAGCTGCTGG - Intronic
1069570320 10:69490937-69490959 CCCACTTACAGCAGAGCGGTCGG + Intronic
1069829771 10:71275759-71275781 CACACTCACAGGGAAGCTGTGGG + Intronic
1071289351 10:84177232-84177254 CCCAAGCTCAGGAGGGCTGCGGG + Intronic
1071506231 10:86233519-86233541 CCCTCACCCAGGGGAGCTGCCGG + Intronic
1073321625 10:102619509-102619531 CCGGCTCACAGGAGAGCTCCTGG + Intronic
1075180242 10:120204613-120204635 CACAATCTCAGGAGAGCAGCAGG + Intergenic
1076539946 10:131207501-131207523 CTGACTCAAGGGAGAGCTGCAGG - Intronic
1077615729 11:3672158-3672180 CGCACTGCAAGGAGAGCTGCAGG - Intronic
1078576242 11:12504983-12505005 CCCACTCACAGAAGCACAGCTGG + Intronic
1084153296 11:67301203-67301225 CGCAGTCCCTGGAGAGCTGCAGG + Intronic
1084669237 11:70595565-70595587 CCCTGTCACAGGAGAGGTGAGGG + Intronic
1084803460 11:71562801-71562823 CCCACTCACACCACAGCTGAGGG + Intronic
1088794965 11:113260139-113260161 TCCACTCGGAGGAGAGCTTCTGG - Exonic
1089659622 11:119977594-119977616 CCCACTCCCAGGAGATATGTTGG + Intergenic
1090391593 11:126392279-126392301 TGCAGTCCCAGGAGAGCTGCAGG - Intronic
1090758566 11:129815996-129816018 CCGACTCGCAGGGGACCTGCGGG + Intronic
1091793105 12:3282760-3282782 CCTACTCAGAGGGGCGCTGCAGG - Intronic
1092205656 12:6613148-6613170 CCCCCTCCCTGCAGAGCTGCTGG + Intergenic
1093312110 12:17601808-17601830 CCCACTCACAGGACAGATTCTGG - Intergenic
1095543904 12:43343143-43343165 CCCCCTCACTGCAGAGATGCTGG - Intergenic
1096485137 12:51975258-51975280 CACGCACACAGCAGAGCTGCAGG - Exonic
1097272182 12:57782894-57782916 CAGGCGCACAGGAGAGCTGCAGG - Intronic
1097967034 12:65592306-65592328 CCCACTAACGGGAGAGCTGTAGG + Intergenic
1100449532 12:94692382-94692404 GCCATTCAGAGGAAAGCTGCTGG - Intergenic
1101755872 12:107620242-107620264 CCCACTCAAAGGGGAACAGCAGG - Intronic
1103042443 12:117706581-117706603 CCCACTTCCAGCAGAGCTCCAGG - Intronic
1103932457 12:124457879-124457901 TCCACTCACAGGAGGCCTGGAGG + Intronic
1104409057 12:128542958-128542980 CCCACTCACAGGAGAGCAAAGGG - Intronic
1104742999 12:131192752-131192774 CCCACTCCCCAGGGAGCTGCGGG - Intergenic
1105012776 12:132766662-132766684 CCCACACACAGGCGAGCAGAGGG + Intergenic
1106962262 13:35012536-35012558 CTATCTCACAGGATAGCTGCAGG - Intronic
1107011426 13:35674515-35674537 CAAACTCACAGAAGAGTTGCAGG - Intergenic
1109319658 13:60794652-60794674 CTCACTCAGAGGACACCTGCTGG + Intergenic
1110292066 13:73818932-73818954 CCGGCTTCCAGGAGAGCTGCTGG + Intronic
1113248688 13:108427587-108427609 CCCATGCACAGGAGAGAGGCGGG + Intergenic
1113953001 13:114082174-114082196 CCCACTCACCGGGGAGCTGCGGG + Intronic
1114704645 14:24713055-24713077 CACACTCACAGGCATGCTGCAGG - Intergenic
1118323553 14:64767108-64767130 CCCAGTCACAGGCGGGCTGAAGG - Intronic
1119261294 14:73239713-73239735 CCCGCGCCCAGGACAGCTGCGGG + Intronic
1119679153 14:76578823-76578845 CACTGTCACAGGGGAGCTGCAGG + Intergenic
1122801028 14:104229550-104229572 CCCCCTCACAGGGGAGATGATGG + Intergenic
1122930213 14:104929683-104929705 TCCACCCACAGGTCAGCTGCTGG - Intronic
1123708001 15:22964541-22964563 CCGACTCCCCGGGGAGCTGCCGG - Intronic
1124336511 15:28861313-28861335 GCCACTCCCACGAGGGCTGCAGG + Intergenic
1124555269 15:30719448-30719470 CCCACTCCCAGGAGGCTTGCAGG + Intronic
1124587817 15:31025665-31025687 CCCACTCTCAGGGGAGCCCCAGG + Intronic
1124625261 15:31304129-31304151 CCCACTCACACTAGTGCTACAGG - Intergenic
1124636305 15:31367049-31367071 CCCACATACAGGAAAGCTCCTGG + Intronic
1124675986 15:31686233-31686255 CCCACTCCCAGGAGGCTTGCAGG - Intronic
1125893875 15:43286141-43286163 TCCACTCACAGCACAGCTCCTGG + Intronic
1128359168 15:66948668-66948690 CACATTCCCAGGAGGGCTGCAGG + Intergenic
1130512538 15:84601219-84601241 CCCTCCCCCAGCAGAGCTGCCGG - Intronic
1131187899 15:90291673-90291695 CCCACTCAGAGGGGAGGGGCCGG - Intronic
1136293987 16:29291450-29291472 CCCCCTCCCAGGACAGCAGCAGG - Intergenic
1136994614 16:35181328-35181350 CCCACTCTCCGAAGAGCTCCAGG + Intergenic
1138598208 16:58040685-58040707 CCCACGCACCGTAGAGCTGCTGG - Exonic
1139021285 16:62753078-62753100 ACCTCTCACAGGAGAGGCGCTGG - Intergenic
1139361323 16:66401942-66401964 GCCACTCTCAGGAGGGCTACAGG - Intronic
1139449220 16:67016755-67016777 CCCACTCACAGGATGGCCCCTGG + Intergenic
1140261396 16:73383487-73383509 CGCACACAGACGAGAGCTGCCGG + Intergenic
1141794228 16:86259161-86259183 CCCACTCACAGGAGGCCTCAGGG - Intergenic
1142005908 16:87689511-87689533 CCCACTCACCGAAAGGCTGCAGG - Intronic
1142099891 16:88265496-88265518 CCCCCTCCCAGGACAGCAGCAGG - Intergenic
1143450719 17:7035430-7035452 CCCACTAACAGGAAACCTACAGG - Intergenic
1143561908 17:7701501-7701523 CGCATTCACTGGAGAGCTCCGGG + Exonic
1147454327 17:40526868-40526890 CCCACTCGCGGCAGAGCAGCTGG - Intergenic
1148200377 17:45746332-45746354 CCCACTCCCAGCAGAGCCTCCGG - Intergenic
1149066579 17:52487950-52487972 CCTACTCAATGGAGAGCTACAGG + Intergenic
1151459316 17:74245381-74245403 GCCACGCACAGGGAAGCTGCAGG + Intronic
1151491450 17:74434068-74434090 CTGACTCACAGGAGAGCTGGGGG + Intronic
1152275349 17:79353354-79353376 CCCACTCACAGGAGAGTCCACGG - Intronic
1152749956 17:82058080-82058102 CCCACCCCCAGGACTGCTGCTGG - Exonic
1152836602 17:82537139-82537161 CCCACTCACTGGTCAGCTGGAGG - Intronic
1155276793 18:24196268-24196290 TTCATTCACATGAGAGCTGCAGG + Intronic
1157284728 18:46369908-46369930 ACCACTCTTGGGAGAGCTGCTGG + Intronic
1160063761 18:75555524-75555546 CCCACTCACTGGGAAGCAGCTGG + Intergenic
1161003580 19:1923493-1923515 CTCACTGACAGGACAGCTCCAGG - Intronic
1161043641 19:2123111-2123133 CCCAGTCCCAGGGGAGATGCAGG - Intronic
1161739242 19:6010284-6010306 CCCACCCGCAGCAGGGCTGCTGG - Intronic
1162156216 19:8679594-8679616 CCCAGTCACAGGGGAGCTCTTGG - Intergenic
1162219550 19:9164530-9164552 GCCAATCATAGGAGAACTGCAGG - Intergenic
1163419609 19:17206665-17206687 CCCACTGCCTGCAGAGCTGCCGG + Exonic
1163537211 19:17883754-17883776 CCCACTCACCGGTGTGTTGCAGG - Exonic
1163634816 19:18433030-18433052 CCCACTCACATTAGCCCTGCCGG - Exonic
1165789246 19:38481610-38481632 CCAACCAGCAGGAGAGCTGCAGG + Intronic
1166979533 19:46624351-46624373 CGCACACACAGGAGAACTGGGGG - Intronic
1167136789 19:47621145-47621167 TCCACTCCCAGGTGAACTGCAGG - Intronic
1167500218 19:49842159-49842181 CCTGGACACAGGAGAGCTGCTGG + Intergenic
925082637 2:1082041-1082063 CCCACGCACAGGAGAGTTTCAGG - Intronic
925140297 2:1545598-1545620 GCCACTCACAGGAGAATTTCAGG + Intergenic
926056156 2:9775353-9775375 CTCACTCACAGGCGGCCTGCAGG - Intergenic
926314387 2:11698519-11698541 CCCACTCACGTGTGAGCTGGTGG + Intronic
929258588 2:39839766-39839788 CACACACACACGAGAGCTACCGG - Intergenic
930012367 2:46947138-46947160 CCCATGCACAGCGGAGCTGCTGG - Intronic
935291861 2:101617855-101617877 TCCACTCACAGGAGAGGTTAAGG - Intergenic
935653787 2:105404384-105404406 CCCACTGCCAGGAGGGGTGCTGG - Intronic
938678049 2:133658499-133658521 CCCACTCCCAGGACAGCAGGGGG - Intergenic
941062587 2:160864795-160864817 CCCACTCACAGGAACCCTTCTGG - Intergenic
942201837 2:173578833-173578855 CCCACTCTGGGGAGTGCTGCAGG + Intergenic
942227055 2:173826291-173826313 CCCACTCTCAGGAGAATTGTAGG - Intergenic
943734541 2:191339936-191339958 CTGTCTCACAGGAGACCTGCAGG - Intronic
944839603 2:203612383-203612405 TCCTCACAGAGGAGAGCTGCTGG - Intergenic
946312437 2:218890219-218890241 CCCACTCCCAGGAGTCCTGCAGG - Exonic
946333273 2:219022162-219022184 CCCACTCACAGAGAGGCTGCTGG + Exonic
946361711 2:219222944-219222966 CCCACTAACAGGAAAGGTGCAGG - Intronic
946601124 2:221361492-221361514 CCTGCTCTCAGGTGAGCTGCTGG - Intergenic
948264828 2:236628768-236628790 CCCACACACAGGAGAAAAGCAGG - Intergenic
948866598 2:240778173-240778195 CCCACCCACGGGATGGCTGCCGG + Intronic
1169205624 20:3738820-3738842 CTCACTCACAGAAGAGCTGTTGG - Intronic
1169612997 20:7404253-7404275 ACCAATTTCAGGAGAGCTGCTGG - Intergenic
1171388603 20:24786732-24786754 CCCACTCACAGGACAGCCCTGGG + Intergenic
1171846818 20:30282447-30282469 CCCACCCAAAGCAGATCTGCGGG - Intergenic
1178618766 21:34156355-34156377 CCCAGTCCTAGGAGAGCTGGTGG + Intergenic
1178633559 21:34282930-34282952 CTCACTCTCAGGCGAGCTCCAGG - Intergenic
1178976969 21:37228286-37228308 GCCACTAACGGGAGAGCTGGTGG - Exonic
1179162150 21:38907405-38907427 CCCAGTGACAGGAGGGGTGCTGG - Intergenic
1179486564 21:41714225-41714247 CCCACTCACAGGAGAGCTGCTGG + Intergenic
1180701830 22:17785392-17785414 CCCACCCACAAGAGGGCGGCAGG - Intergenic
1181102506 22:20550847-20550869 CCCACTCTCAGGTGAGGTGAAGG - Intronic
1181175617 22:21033129-21033151 CTCCCCCACAGGAGGGCTGCAGG - Intergenic
1182071265 22:27465470-27465492 CCCATTTACATGAGAGCAGCAGG - Intergenic
1183221085 22:36513690-36513712 CAAACTCACAGGAGTGCTGCAGG - Intronic
1183420570 22:37709316-37709338 CCGGCTCTCAGGTGAGCTGCTGG + Intronic
1183456540 22:37926056-37926078 CCGACTGTCAGGAGAGCTCCAGG - Intronic
1183477340 22:38042816-38042838 CCCACTCCCAGGCGGGCAGCAGG + Intergenic
1183770645 22:39922708-39922730 CCCACACAAAGGAGGGCTGATGG + Intronic
1184386409 22:44178216-44178238 CAAACTCACAGAAAAGCTGCAGG - Intronic
1184409123 22:44316465-44316487 CCCACTCAAGGAAGAGCTGCTGG + Intergenic
1184893477 22:47393505-47393527 TCCACTCACAGACGAGGTGCAGG + Intergenic
1185073590 22:48670486-48670508 CTCAGACTCAGGAGAGCTGCCGG + Intronic
950224830 3:11225043-11225065 GCCACTCACAGGAGGAGTGCTGG + Intronic
950682314 3:14593806-14593828 CACAATCACAGCAGGGCTGCTGG - Intergenic
952164066 3:30726862-30726884 CCCACTCTCAGGAGAAATGGAGG + Exonic
952906092 3:38139949-38139971 CCCACGGACAGCAGAGCTGGCGG + Exonic
954376264 3:50195602-50195624 CCCAGGGGCAGGAGAGCTGCGGG - Exonic
956602332 3:71035156-71035178 CCAGGTCACAGCAGAGCTGCTGG + Intronic
957797213 3:85025876-85025898 CCCACTAAAAGAAGAGCTACCGG - Intronic
959863616 3:111242558-111242580 ACAGCTCACAGGAGACCTGCAGG + Intronic
961427571 3:126860072-126860094 CTCACTCACAGAAGTACTGCTGG - Intronic
963307795 3:143673284-143673306 CCCACCCATAGGAGCCCTGCAGG + Intronic
966313798 3:178623920-178623942 CCTTCTCTCAGGAGAGCTCCTGG - Intronic
967871924 3:194236844-194236866 CCCACCCACAGGAGAGGAGAGGG + Intergenic
969599851 4:8169883-8169905 CCCCATCTCAGGACAGCTGCCGG + Intergenic
969689930 4:8698774-8698796 CCCCCTGGCAGGGGAGCTGCTGG - Intergenic
970296702 4:14638612-14638634 CCCACTCCAAAAAGAGCTGCAGG + Intergenic
972409883 4:38782932-38782954 CACTCTCTCAGCAGAGCTGCAGG + Exonic
978398318 4:108306012-108306034 CCTGGTCACAGGAGAGCTGGAGG - Intergenic
980937788 4:139242643-139242665 CTCCCTGCCAGGAGAGCTGCTGG - Intergenic
983280115 4:165670033-165670055 CAAACTCACAGGAGGGCTGTGGG + Intergenic
985524871 5:396727-396749 CCCACTCTCAGGCCAGCTGCAGG - Intronic
985623461 5:969166-969188 ACAAGTCACAGGAGAACTGCTGG + Intergenic
985629286 5:1006371-1006393 CCCACTCAGAGGAGCCCTGGGGG + Intergenic
986408136 5:7447610-7447632 CCCACTCACTGCCCAGCTGCAGG - Intronic
988567553 5:32331406-32331428 CCTACTCACTGAAGAGCTGAAGG + Intergenic
992007759 5:72495211-72495233 CCCACTCCCAGGAAAGCTCCTGG + Intronic
992270270 5:75055752-75055774 CCCACTTTCAGAAGACCTGCAGG - Intergenic
993033304 5:82729128-82729150 CCATCCCAGAGGAGAGCTGCAGG + Intergenic
994698719 5:103105605-103105627 CTCACTCAAATGAAAGCTGCAGG - Intronic
997531574 5:134584689-134584711 CCCATTCACAGCTGAGCTGCTGG - Intergenic
997605189 5:135170202-135170224 CCCCCTCGAAGGAGAACTGCAGG - Intronic
997998248 5:138603727-138603749 CCCAACCACATGACAGCTGCTGG + Intergenic
998975138 5:147636888-147636910 CCCATGCACAGGTGAGCTACAGG + Intronic
999718566 5:154381420-154381442 ACAGCTCACAGGACAGCTGCAGG - Intronic
1002072369 5:176687899-176687921 ACAACTCACAGGAGACCTACAGG + Intergenic
1002306364 5:178286226-178286248 CCCAGTGACTGGGGAGCTGCTGG + Intronic
1005668971 6:28085690-28085712 GCCACTGACAGCAGAGCTCCCGG - Exonic
1006010330 6:31037693-31037715 CCCACTCACGGCAGCCCTGCAGG - Intergenic
1006591603 6:35162105-35162127 TCCACTCACAGTGGAGCAGCTGG - Intergenic
1007762493 6:44141186-44141208 CCCACCCACGGCAGAGCTCCAGG - Intronic
1008453129 6:51675846-51675868 CCCACTTAGAGAAGAGCTTCTGG - Intronic
1008862677 6:56168892-56168914 CCCACACATAGGAGAGGTACAGG - Intronic
1011546392 6:88486244-88486266 CCCAATCACAGCAAAGCTTCCGG + Intergenic
1011784522 6:90829096-90829118 CTCACTCCCAGGACTGCTGCAGG - Intergenic
1014318382 6:119895006-119895028 CTCAGTCACAGGAAAGCTACTGG - Intergenic
1015604169 6:134938266-134938288 ACTTCTCACAGGAGGGCTGCTGG + Intronic
1015880996 6:137869635-137869657 CCCACTCAAAGGAGAGAGGTTGG - Intronic
1018951589 6:168381832-168381854 CCCACTGCCAGCAGGGCTGCTGG + Intergenic
1019777781 7:2922793-2922815 CCCACAGGCAGCAGAGCTGCGGG + Intronic
1019952202 7:4382758-4382780 CCCACAGACAGGGGAGCTTCAGG + Intergenic
1021274933 7:18638716-18638738 CACTCTCACATGAGAGCTGCTGG - Intronic
1022056384 7:26739611-26739633 GCCTCTCAAAGGAAAGCTGCAGG - Intronic
1023940186 7:44764439-44764461 CCCGCTCACAGTTGAGCTGCAGG - Exonic
1026595012 7:71727128-71727150 TCCACTCAAAGGAGAACAGCTGG + Intergenic
1029193156 7:98785986-98786008 CCCACACACAGGGACGCTGCAGG + Intergenic
1029203013 7:98851608-98851630 CACAGTCAGAGGAGGGCTGCAGG + Exonic
1029223518 7:99008597-99008619 GCCCCACACAGGAGGGCTGCAGG - Intronic
1029291667 7:99506257-99506279 GCCACTCACAGCAGAGCACCCGG - Exonic
1029356667 7:100057204-100057226 GCCACTCACAGCAGAGCACCCGG - Exonic
1029567055 7:101345931-101345953 CCCAGAGAAAGGAGAGCTGCAGG - Intergenic
1030066795 7:105665803-105665825 CTCAGTCCCAGGACAGCTGCTGG - Intronic
1031447715 7:121874208-121874230 CAAAGTCAGAGGAGAGCTGCAGG + Intronic
1031514792 7:122688589-122688611 CCCACACACAGCTGTGCTGCTGG + Intronic
1032439212 7:131929002-131929024 GCTACTCACAGGACAGCGGCAGG - Intergenic
1034221975 7:149453881-149453903 CCCACTCTCAGAGAAGCTGCTGG - Intronic
1034267424 7:149787958-149787980 CACACTCACAGCAGAGCTCCTGG - Intergenic
1034821534 7:154220885-154220907 CCCACTCACAGAAGGGCCCCTGG - Intronic
1035337309 7:158138250-158138272 CCCACACCCAGGGGTGCTGCGGG - Intronic
1035682784 8:1500565-1500587 CCCACTGGGAGGAGAGCTACGGG + Intergenic
1035759897 8:2061593-2061615 CCCACACACAGAGGAGCTGGTGG - Intronic
1038014240 8:23499764-23499786 GCCACCCCCAGGAGAACTGCTGG + Intergenic
1039473463 8:37827395-37827417 CCCACCCACAGGCGACCTGCTGG - Intronic
1041470470 8:58203117-58203139 CCCTCGCACATGAGAGCTCCAGG + Intronic
1041492868 8:58453781-58453803 CCTACTCAAAGGAAAGCTACAGG + Intergenic
1047646741 8:126877951-126877973 CCCAGCCACAGGAGAGGTTCCGG - Intergenic
1048408142 8:134143549-134143571 CCCACTCATAGGTGGGCTGGGGG - Intergenic
1049162676 8:141107440-141107462 CACACACACAGAAGAGCTGCAGG - Intergenic
1049162691 8:141107578-141107600 CACACACCCAGAAGAGCTGCAGG - Intergenic
1049162715 8:141107794-141107816 CTCACACCCAGAAGAGCTGCAGG - Intergenic
1049208890 8:141376287-141376309 CTTTCTCACAGTAGAGCTGCTGG + Intergenic
1049273305 8:141707522-141707544 CCCATACACAGCAGAGCAGCGGG - Intergenic
1049344065 8:142129131-142129153 TCCACTCACAGCGCAGCTGCAGG + Intergenic
1049997900 9:1048559-1048581 CCCTGTTACAGGAGGGCTGCTGG + Intergenic
1053015000 9:34656895-34656917 CCAACTCACAGCCCAGCTGCAGG - Exonic
1055640433 9:78315170-78315192 CCCACTCGCAGGGGAGCTAGTGG + Intronic
1057548254 9:96034025-96034047 CCCAGTGACCGGAGAGCAGCGGG - Intergenic
1057604475 9:96489287-96489309 CACACTCCCTGGAGTGCTGCAGG - Intronic
1060166851 9:121424476-121424498 CCCACTCTCTGGAATGCTGCTGG - Intergenic
1060725417 9:126002858-126002880 CCCTTTCACAGGCGAGGTGCAGG + Intergenic
1061315874 9:129795510-129795532 CCCACTGCCACGAGAGCTTCAGG - Intergenic
1061385864 9:130289101-130289123 CCCAGGCACGGGGGAGCTGCAGG - Intronic
1061536308 9:131252355-131252377 CCCCCTCACAGGCGAGGGGCTGG + Intergenic
1061887879 9:133601931-133601953 CCAGCACACAGGAGTGCTGCAGG + Intergenic
1062513527 9:136920992-136921014 CCCTCTTACAGGAGGGGTGCGGG - Intronic
1062606110 9:137349593-137349615 CCCACTCACACCAGCCCTGCGGG + Intronic
1185433794 X:25480-25502 CCCAACCTCAGGTGAGCTGCTGG - Intergenic
1185443000 X:237547-237569 CCCAACCTCAGGTGAGCTGCTGG - Intergenic
1185605253 X:1365239-1365261 CCCACTCACCGAAGCGCTGGGGG - Exonic
1189299414 X:39941877-39941899 CCCACCCACAGCAGAGCTGAGGG + Intergenic
1190244406 X:48681745-48681767 CCCACTCACAGCTAAGCTTCGGG - Intronic
1190309454 X:49106535-49106557 CCCACTCACAGCTAAGCTTCGGG - Intergenic
1192146792 X:68687915-68687937 CCCACTGACATGGGAGCTCCAGG + Intronic
1195677029 X:107514424-107514446 GCAACTCACAGGAGAGATGATGG + Intergenic
1199450755 X:147976689-147976711 CCCACTCACAGGTGATCTGTAGG + Intergenic
1199679806 X:150216678-150216700 CCCACACACAGTAGACCTGGGGG + Intergenic
1199695422 X:150340371-150340393 CCCACACACAGTAGACCTGGGGG - Intergenic
1201621339 Y:15962150-15962172 CCGAAACCCAGGAGAGCTGCGGG - Intergenic