ID: 1179489223

View in Genome Browser
Species Human (GRCh38)
Location 21:41729447-41729469
Sequence GTGGATACACCCTTCAAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179489223_1179489228 14 Left 1179489223 21:41729447-41729469 CCGTGTTTGAAGGGTGTATCCAC No data
Right 1179489228 21:41729484-41729506 CAGAACTTCATTCCTTTTTATGG 0: 42
1: 415
2: 1598
3: 4490
4: 8753

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179489223 Original CRISPR GTGGATACACCCTTCAAACA CGG (reversed) Intergenic
No off target data available for this crispr