ID: 1179490381

View in Genome Browser
Species Human (GRCh38)
Location 21:41737281-41737303
Sequence GCACCTTGGTTTGCTCCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179490378_1179490381 7 Left 1179490378 21:41737251-41737273 CCTGGATGTCAGGGCATGCGGAC No data
Right 1179490381 21:41737281-41737303 GCACCTTGGTTTGCTCCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179490381 Original CRISPR GCACCTTGGTTTGCTCCAGC CGG Intergenic
No off target data available for this crispr