ID: 1179490889

View in Genome Browser
Species Human (GRCh38)
Location 21:41740990-41741012
Sequence CATTGACCTGTTCGACGAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 23}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179490889_1179490894 22 Left 1179490889 21:41740990-41741012 CCTGCTCGTCGAACAGGTCAATG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1179490894 21:41741035-41741057 CCACCACCTCCGAGTGCCCGTGG 0: 1
1: 0
2: 1
3: 20
4: 136
1179490889_1179490897 26 Left 1179490889 21:41740990-41741012 CCTGCTCGTCGAACAGGTCAATG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1179490897 21:41741039-41741061 CACCTCCGAGTGCCCGTGGGCGG 0: 1
1: 0
2: 0
3: 9
4: 81
1179490889_1179490895 23 Left 1179490889 21:41740990-41741012 CCTGCTCGTCGAACAGGTCAATG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1179490895 21:41741036-41741058 CACCACCTCCGAGTGCCCGTGGG 0: 1
1: 0
2: 1
3: 7
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179490889 Original CRISPR CATTGACCTGTTCGACGAGC AGG (reversed) Exonic
1073796230 10:106991309-106991331 CAGTGACATGTTTGACAAGCTGG + Intronic
1075977069 10:126705291-126705313 CACTGACCTGTTGGAGAAGCTGG - Intergenic
1084032271 11:66487934-66487956 CATCGACCTCTTTGAAGAGCCGG - Exonic
1107264027 13:38529665-38529687 CATTCACCTGTTCCACAAGTGGG - Intergenic
1114831277 14:26144771-26144793 GATTGACCTGTCCCACGATCAGG + Intergenic
1126396272 15:48221194-48221216 CATTCACCTGTTTGGCAAGCTGG - Intronic
1128033132 15:64499524-64499546 CATTGACCTGGACGCCGATCTGG + Exonic
1136383921 16:29911124-29911146 CATCGAGCTGTTCGACAAGCTGG - Exonic
1146359467 17:32161996-32162018 CATTGACCTGTTCACCAACCAGG + Intronic
1147562218 17:41516223-41516245 CATTGACCTGGCCGGCCAGCTGG + Exonic
1161863987 19:6820785-6820807 CTTTGACCTCTTCGATGTGCAGG + Exonic
939598671 2:144161153-144161175 CATTGTCATGTTCTACTAGCTGG + Intronic
947557203 2:231104505-231104527 AATTGACCTGTTTAAAGAGCTGG + Intronic
1179490889 21:41740990-41741012 CATTGACCTGTTCGACGAGCAGG - Exonic
954105862 3:48409626-48409648 CTTTGACCTGCTGGATGAGCAGG - Exonic
969995976 4:11313680-11313702 CACTGGCCTGTTCTAGGAGCAGG + Intergenic
1011586258 6:88928475-88928497 CACTGATGTGTTCCACGAGCTGG + Intronic
1023683673 7:42714243-42714265 CATTGACCTGTTCCAAGGCCTGG - Intergenic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1053534605 9:38913292-38913314 CATTGACCTGTGCTATGATCTGG + Intergenic
1054206824 9:62137712-62137734 CATTGACCTGTGCTATGATCTGG + Intergenic
1054631528 9:67450635-67450657 CATTGACCTGTGCTATGATCTGG - Intergenic
1057691646 9:97291512-97291534 CATTGACATGTTCTGAGAGCTGG + Intergenic
1059082814 9:111267843-111267865 TAATGACTTGTTCGACAAGCTGG - Intergenic
1196443719 X:115734886-115734908 GTTTGACCTGTTGGTCGAGCTGG + Intergenic