ID: 1179493778

View in Genome Browser
Species Human (GRCh38)
Location 21:41758822-41758844
Sequence GGGAAGTGACCTTAGACCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179493778_1179493783 21 Left 1179493778 21:41758822-41758844 CCTCTGGTCTAAGGTCACTTCCC 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1179493783 21:41758866-41758888 AGACTAGAATCCCAGTGCAATGG 0: 1
1: 0
2: 0
3: 16
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179493778 Original CRISPR GGGAAGTGACCTTAGACCAG AGG (reversed) Intronic
900602817 1:3510278-3510300 GGCCAGTGACCTCAGGCCAGAGG + Intronic
901119922 1:6882955-6882977 TGGCAGTGAGCTGAGACCAGAGG - Intronic
901148930 1:7087463-7087485 GGGAAGTGACCCTGGGTCAGTGG + Intronic
903882594 1:26521750-26521772 GGGAGGTGACATTTGAGCAGAGG + Intergenic
905369588 1:37475889-37475911 GGGCAGCGACCTGAGACCAGTGG + Exonic
906402708 1:45517200-45517222 GGGAGGTGACCTGGGCCCAGGGG - Intronic
907255060 1:53172982-53173004 AGGAAGTGATTTTATACCAGGGG - Intergenic
908003847 1:59708407-59708429 TGAAAGGGACCCTAGACCAGGGG + Intronic
910920673 1:92343096-92343118 GAGAAGAGACCTAAGGCCAGAGG + Intronic
912507101 1:110163863-110163885 AGGAAGTGACATTTGAGCAGAGG - Intronic
923155303 1:231273153-231273175 GGGAAGTGACAGTAGATGAGAGG + Intronic
1063145269 10:3290171-3290193 TGGAAGTCACCTTCCACCAGAGG - Intergenic
1066004246 10:31132912-31132934 GGGAAGTGACATTTCACCTGAGG + Intergenic
1067740227 10:48889943-48889965 AGGATGTGACCTTGGACCAGGGG + Intronic
1068826652 10:61447782-61447804 GGGATGTGACCTTTGAGCTGAGG - Intronic
1070761086 10:79024836-79024858 GGGGAGTGACCTGACAGCAGAGG + Intergenic
1072228354 10:93391028-93391050 GAGAAGTGAGGTTAGACCAAAGG - Intronic
1075532322 10:123240177-123240199 GGGAGGTGACCTTAGACTTCTGG + Intergenic
1076229290 10:128806970-128806992 GTTGAGTGACCTTAGACAAGGGG - Intergenic
1077358039 11:2127665-2127687 TGGAAGTGACCTGGGGCCAGTGG + Intergenic
1078386723 11:10899122-10899144 GGGTACTCACCTGAGACCAGGGG + Intergenic
1079226622 11:18611936-18611958 GGGGAAAGACTTTAGACCAGAGG + Intronic
1082308050 11:50607885-50607907 GGGAAGTGAACTGAGACCTATGG + Intergenic
1082575224 11:54795154-54795176 TGGAAGTGACTTTAGGCCATAGG - Intergenic
1083943909 11:65913342-65913364 GGGAAGTGCCTTTGGCCCAGGGG - Intergenic
1084696747 11:70760434-70760456 GGCAGGTGACCTTAGAAGAGAGG - Intronic
1089134453 11:116238133-116238155 GGGAAGAGGCCTTAGAAAAGAGG - Intergenic
1091401213 12:181913-181935 CGCAAGTGACCTGAGAGCAGTGG - Intergenic
1093088428 12:14892752-14892774 TGGAAGTAACACTAGACCAGTGG - Intronic
1093115068 12:15198901-15198923 GGGAAGTGACCCTAGATTATTGG - Intronic
1095864518 12:46956862-46956884 AGGAAATGACCACAGACCAGTGG - Intergenic
1096217971 12:49808959-49808981 GGGAGGTGACCTCAGTGCAGGGG + Intronic
1104007607 12:124904976-124904998 GGGGAGTGACCGTAGGCAAGAGG - Intergenic
1105823011 13:24096696-24096718 GGGGAGTCACCTAAGAACAGAGG + Intronic
1106506971 13:30379087-30379109 TGGAGGTGACCTTATAGCAGAGG + Intergenic
1106561325 13:30848923-30848945 GGGAAGTGAGCCTCGAGCAGTGG + Intergenic
1113543925 13:111131671-111131693 GGGCAGTGACCTGAGGTCAGGGG + Intronic
1118490188 14:66251398-66251420 GGGAAGGGAGCTTATACAAGAGG - Intergenic
1124633909 15:31353076-31353098 GGGAAGGGACCCTGGGCCAGGGG + Intronic
1127477450 15:59348115-59348137 TGGCATTGACCCTAGACCAGAGG - Intronic
1128593664 15:68925418-68925440 AGGAAGTGACCTAAGATAAGAGG + Intronic
1128861626 15:71078920-71078942 GGGAAGTGACCTCTGATCATTGG + Intergenic
1129695820 15:77740184-77740206 AGGAAGTGTCCTTGGAGCAGAGG + Intronic
1131006472 15:88982642-88982664 GGGAACTGGCCTGAGTCCAGAGG + Intergenic
1133634801 16:7654762-7654784 AGGCAGTGGCCCTAGACCAGGGG + Intronic
1134775539 16:16850091-16850113 TGGGAGTGACTTTGGACCAGGGG - Intergenic
1136090312 16:27914906-27914928 TGGAAGGGACCATAGACAAGTGG + Intronic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1136555948 16:31008059-31008081 GGGAGGGGACATTAGCCCAGGGG - Intronic
1137536269 16:49329112-49329134 GGGAAATGACATTTGAACAGAGG + Intergenic
1137691241 16:50429557-50429579 GGTTAGTGCCCTTAGACCAGAGG + Intergenic
1142364019 16:89640305-89640327 TGGAAGTGACCTGGGCCCAGTGG - Intergenic
1146609051 17:34288521-34288543 GCTAGGTGACCTTTGACCAGAGG + Intergenic
1146833609 17:36091811-36091833 AAGAAGTGACCTTCCACCAGAGG + Intergenic
1146848192 17:36198640-36198662 AAGAAGTGACCTTCCACCAGAGG + Intronic
1151965783 17:77430496-77430518 GGGAAGTGACCTCATAGCAAGGG + Intronic
1153568998 18:6449439-6449461 GAGAAGTGACTTTTGAGCAGAGG - Intergenic
1156351181 18:36302530-36302552 GGGAAGTTATCTGAGAACAGGGG - Intronic
1157681356 18:49609779-49609801 GGGGACTGTCCTTAGAGCAGAGG + Intergenic
1161629169 19:5343247-5343269 GGGAGGTGACCTCAAACAAGTGG + Intergenic
1163488452 19:17603355-17603377 GGGAAGTGATCTGTGACCTGGGG - Exonic
1164624413 19:29716634-29716656 GGAAAGTGAACTGAGGCCAGGGG + Intergenic
1165818393 19:38658003-38658025 GGGGAGTGCCCTCATACCAGAGG + Intronic
925628303 2:5863823-5863845 GGTAAGTGATCTTGGCCCAGTGG - Intergenic
928081984 2:28319896-28319918 GGGAAGTGACCTCACTCCCGAGG + Intronic
932289598 2:70565581-70565603 GCGAAGTGACCTTTGACCTTTGG + Intergenic
932430566 2:71671610-71671632 GGCAGGTGACTTGAGACCAGTGG + Intronic
933902774 2:86861592-86861614 GGGAGGTGGCCTCAGTCCAGGGG + Intronic
934574197 2:95390184-95390206 GGGAAGTGACCTCAGGGCACAGG + Intergenic
935193873 2:100799569-100799591 GGGAAGGGCCCTTCGGCCAGGGG - Intergenic
942342068 2:174959309-174959331 GGGTAGAGACCTTAGATCACTGG + Intronic
942837229 2:180315058-180315080 GGCAGGTGACCTGAGATCAGGGG - Intergenic
945156736 2:206847513-206847535 GGGAAGTCAGTGTAGACCAGAGG - Intergenic
945534711 2:211000975-211000997 TGGAAGTGAGTTTAGACCAATGG - Intergenic
946102476 2:217337949-217337971 GGGAAGTGACCTCATACCCTGGG - Intronic
1169255189 20:4091667-4091689 GGGAATTGCCCTTTGCCCAGTGG + Intergenic
1170818044 20:19731551-19731573 TGGAAGTCACCCTTGACCAGGGG + Intergenic
1170867208 20:20168928-20168950 ACTAAGTGACCTTACACCAGTGG - Intronic
1171077282 20:22141118-22141140 GAAAAGTTACTTTAGACCAGAGG - Intergenic
1171233921 20:23509331-23509353 GGGAAGTGAGGTCAGAGCAGAGG + Intergenic
1172245186 20:33441233-33441255 GTGGAGTGACCTTGGACAAGGGG - Intronic
1173100391 20:40082428-40082450 TGGAAGTGTCCTGAGCCCAGGGG - Intergenic
1174297824 20:49561462-49561484 GAGAAGTGGCCTTAGCCCAGGGG - Intronic
1175607722 20:60324608-60324630 GCAAAGATACCTTAGACCAGGGG + Intergenic
1177817106 21:25989157-25989179 GGGAAGTTACTTTAAAACAGGGG + Intronic
1179464203 21:41560931-41560953 GAGAAGTGACTTTTGCCCAGAGG - Intergenic
1179493778 21:41758822-41758844 GGGAAGTGACCTTAGACCAGAGG - Intronic
1181596777 22:23920482-23920504 GGTAAGTGACCTTCAACCTGAGG - Intergenic
1182261290 22:29073947-29073969 GGGAGGGGACCTTGGCCCAGGGG - Intronic
952572371 3:34732264-34732286 GGGAACTGACCTGATGCCAGAGG - Intergenic
953287912 3:41630734-41630756 GGGAAGGGAACTGGGACCAGGGG - Intronic
954117417 3:48474868-48474890 GGGAAGTGACCTGAGGCCTGAGG - Intronic
954275826 3:49540877-49540899 GGGAAGTGATCCTAGACTACTGG - Intergenic
954713881 3:52517612-52517634 GGGTCCTGACCTTAGAGCAGGGG - Exonic
955048476 3:55384845-55384867 GAGAAATGGCCATAGACCAGAGG + Intergenic
958884587 3:99711580-99711602 TGGAAGTGACCTAATACCTGGGG + Intronic
971391751 4:26192637-26192659 AGGAAGTGAACAGAGACCAGTGG + Intronic
978125559 4:105131106-105131128 GGGAAATGACATAAGGCCAGTGG - Intergenic
984131087 4:175877126-175877148 GGGAAGTGACATTTGTCCTGAGG + Intronic
984140025 4:175993495-175993517 GGGAGTTAACCTTAGACCAAAGG - Intronic
987433037 5:17860138-17860160 GGAAAGTGACCATAGACCCATGG - Intergenic
988539141 5:32093486-32093508 GGGCACTGACCTTCGAGCAGTGG + Intronic
991607989 5:68422433-68422455 GAGATGTGACTTTACACCAGAGG + Intergenic
993681296 5:90881548-90881570 GGGAGGTGAACTTTGGCCAGTGG + Intronic
996210806 5:120807312-120807334 CTGAAGAGATCTTAGACCAGTGG - Intergenic
997208610 5:132064886-132064908 CTGAAGTGCCCTGAGACCAGTGG - Intergenic
997663695 5:135609678-135609700 GGGAAGTAACCTGAGACCACTGG + Intergenic
1004672983 6:17815093-17815115 GGGAAGGGACCCTTGTCCAGTGG - Intronic
1006027967 6:31159376-31159398 GGGAAGCGAACTTAAGCCAGCGG + Exonic
1007348514 6:41251287-41251309 AGCAGGTGACCTTAGGCCAGGGG - Intergenic
1008537018 6:52514090-52514112 GTCTAGTGACCTTTGACCAGGGG - Intronic
1010382745 6:75243480-75243502 GGGAAGTGACCAGAGACTCGTGG - Intronic
1010714858 6:79216774-79216796 TGGAAGTGAGCAAAGACCAGTGG - Intronic
1015522456 6:134145440-134145462 GGGAAGGGACCCTAGTCCAGGGG + Intergenic
1015827769 6:137333537-137333559 GAGAAGTCACCTTAAACCAGTGG - Intergenic
1017757596 6:157542763-157542785 GGGAAGTGACCAGAGGCCATGGG - Intronic
1018169670 6:161134775-161134797 AGGACGTGACCTTAGGCAAGAGG - Exonic
1023350452 7:39315521-39315543 GGGAACTGACCATAAACCAGTGG - Intronic
1025011897 7:55404186-55404208 GGGAAGAGAACTTAGGCCACAGG - Intronic
1030343413 7:108406267-108406289 GAGAAGTGATTTTAGGCCAGAGG + Intronic
1034875861 7:154724373-154724395 GGGAAGTGACCTGAGGTCTGGGG - Intronic
1038034396 8:23674958-23674980 GGGAAGTGAACTGAGAGCACAGG - Intergenic
1048445068 8:134487284-134487306 GAGAAGTGACTGTAAACCAGGGG - Intronic
1050660823 9:7880613-7880635 GGGAACTGACCTAATACTAGTGG - Intronic
1056372678 9:85973042-85973064 AGGAATTGACATTAGAACAGAGG + Intronic
1057241591 9:93416560-93416582 GGGCAGTGACCTTATGCCAGTGG + Intergenic
1187395037 X:18911908-18911930 GGGAAGTGACCTTGGACAAATGG - Intronic
1188197305 X:27252351-27252373 AGGGAGTGACCTTAGGCCACAGG - Intergenic
1195626025 X:107006398-107006420 GACAAGTGACCTTAGACAATGGG - Intergenic
1196550853 X:117022934-117022956 GCTAAGTGACCTTAGACAAAGGG + Intergenic
1197423971 X:126272744-126272766 GGGCAGTGACCTAATGCCAGTGG + Intergenic
1197921451 X:131598882-131598904 GAGAAGGGACCTTAAAGCAGTGG - Intergenic
1199995958 X:153026935-153026957 GGGAAGTGACGTGAGGGCAGTGG + Intergenic
1201406609 Y:13656478-13656500 GGGAAGTGCTCATAGACCTGTGG + Intergenic