ID: 1179494183

View in Genome Browser
Species Human (GRCh38)
Location 21:41761265-41761287
Sequence CCAACCGGTGTTCCCAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179494183_1179494188 4 Left 1179494183 21:41761265-41761287 CCTCCTCTGGGAACACCGGTTGG 0: 1
1: 0
2: 1
3: 6
4: 75
Right 1179494188 21:41761292-41761314 GGCCCTCATTTGTTATTTAAAGG 0: 1
1: 0
2: 1
3: 10
4: 142
1179494183_1179494191 29 Left 1179494183 21:41761265-41761287 CCTCCTCTGGGAACACCGGTTGG 0: 1
1: 0
2: 1
3: 6
4: 75
Right 1179494191 21:41761317-41761339 TACCAGCACAACTTCCAACCCGG 0: 1
1: 0
2: 1
3: 7
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179494183 Original CRISPR CCAACCGGTGTTCCCAGAGG AGG (reversed) Intronic
900389743 1:2428790-2428812 CCAGCCCGGGTTCCCCGAGGCGG - Intronic
905423291 1:37863010-37863032 CCACCCCGTGTCCCCAGTGGGGG + Intronic
905647631 1:39635419-39635441 CCAACAGATGGTCCCAGCGGAGG - Intronic
907826656 1:58023802-58023824 CTAAGCAGTTTTCCCAGAGGTGG + Intronic
911672503 1:100622722-100622744 CCAACAGCTGTTCCCAGGGTAGG + Intergenic
912764520 1:112396419-112396441 CCTCCCGGTATTCCCCGAGGAGG + Intronic
1064091760 10:12391433-12391455 GCAACCGGTGATCCCAGCTGGGG - Intronic
1067293244 10:44959587-44959609 CCTACCGGCGTTCCCAGAGCGGG + Intronic
1075481114 10:122782614-122782636 CGAGCCAGTGTTCCCAGAGATGG + Intergenic
1075710011 10:124525888-124525910 CCCACCGGTTTTCCCACAGGCGG - Intronic
1076131783 10:128018568-128018590 CCAACAGCTGTTCCCAGAGGAGG + Intronic
1076790738 10:132775458-132775480 ACAACCGCTGTACCCACAGGTGG - Intronic
1080076696 11:28158226-28158248 CCAACGGGTGATCCCAGCAGAGG + Intronic
1084767522 11:71322470-71322492 GCAACCGGTCTTCCCAGCCGGGG - Intergenic
1085636658 11:78164469-78164491 CCCACCAGAGTTCCCAGGGGAGG + Intergenic
1091711244 12:2742101-2742123 GCAACTGATGCTCCCAGAGGAGG + Intergenic
1092391236 12:8081864-8081886 CCAGCCGGTAGTCCCAGACGAGG - Intergenic
1092713422 12:11362946-11362968 CACACCGGTGTTTCCAGAGATGG + Intronic
1104955741 12:132465069-132465091 CCTGCAGGTGCTCCCAGAGGCGG + Intergenic
1109950931 13:69501501-69501523 CCAACCGGTGACCTCAGCGGAGG - Intergenic
1110840162 13:80132995-80133017 CCCAGCTATGTTCCCAGAGGAGG + Intergenic
1113484654 13:110645349-110645371 CCCCCAGGTGTTTCCAGAGGTGG + Intronic
1114051106 14:18920432-18920454 CCAACCCCTGCCCCCAGAGGTGG - Intergenic
1114111453 14:19481490-19481512 CCAACCCCTGCCCCCAGAGGTGG + Intergenic
1121810251 14:96880463-96880485 CTAACTGCTGTACCCAGAGGTGG + Intronic
1122204481 14:100141729-100141751 CCAACAGGAGATCCTAGAGGAGG + Exonic
1122540544 14:102495589-102495611 CCAACCGGTCTTCCCAGACATGG - Intronic
1123008058 14:105333857-105333879 CCCACAGGCCTTCCCAGAGGGGG + Intronic
1132863216 16:2081586-2081608 CCAGCTGGTGTTCCCTGCGGAGG - Exonic
1134226345 16:12394030-12394052 CTGACCTGTGTTCCCAGAGATGG + Intronic
1135567591 16:23523791-23523813 CCAACTGGTGTTCTTAGAAGAGG + Exonic
1135612241 16:23878603-23878625 CCAACATGTGTTCCCAGCTGAGG - Intronic
1136630059 16:31484801-31484823 CCAACCTGGGTGGCCAGAGGAGG - Exonic
1138348832 16:56335723-56335745 CCATCCTGTGCTCCCAGTGGGGG - Intronic
1143476608 17:7206951-7206973 CCATCCTGTGTCCCCAGAAGAGG + Intronic
1149543354 17:57485106-57485128 CAAATGGGTGTTCCCAGAGTGGG + Intronic
1152457397 17:80424106-80424128 CCAACATGGGGTCCCAGAGGAGG - Intronic
1163145232 19:15375091-15375113 CCACCCGGTGTTTCAGGAGGAGG - Intronic
1166428320 19:42699533-42699555 CAAACAGGTGTTTCTAGAGGTGG - Intronic
1167593173 19:50415189-50415211 GACACCTGTGTTCCCAGAGGAGG - Intronic
937160319 2:119754951-119754973 CCAAGCTGTGTTCCTTGAGGAGG - Intergenic
937868034 2:126768520-126768542 CCACCAGGTCTTCCCAGATGAGG + Intergenic
946293346 2:218763029-218763051 GCAGCCTGTGTTCCCAGAGTGGG - Intergenic
948877833 2:240839618-240839640 CCATCAGGGGTTCTCAGAGGCGG + Intergenic
948907921 2:240988655-240988677 CAACCCTGTGCTCCCAGAGGAGG + Intronic
949042125 2:241854293-241854315 CCTGGTGGTGTTCCCAGAGGTGG + Intronic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1179494183 21:41761265-41761287 CCAACCGGTGTTCCCAGAGGAGG - Intronic
1180059481 21:45377202-45377224 CCAAGGGCTGCTCCCAGAGGGGG - Intergenic
1180469581 22:15642807-15642829 CCAACCCCTGCCCCCAGAGGTGG - Intergenic
1182417247 22:30229298-30229320 CCTTCCTGTGTTCCCAGAAGGGG - Intergenic
1184098794 22:42330754-42330776 CCAGGAAGTGTTCCCAGAGGAGG + Intronic
1184112351 22:42402676-42402698 CAAAGTGGTGTTCCCAGAGCAGG - Intronic
1184930194 22:47675178-47675200 CCAACCTCTGTTCGCACAGGTGG - Intergenic
955391176 3:58523511-58523533 CCAACCTGTGGTCCCAGGGATGG - Intronic
963830553 3:150003749-150003771 TCAGCCAGTGTTCTCAGAGGAGG - Intronic
984431911 4:179661092-179661114 CCAGCCGGGGATCACAGAGGTGG - Intergenic
985779992 5:1865553-1865575 CCAACCGGAAGCCCCAGAGGAGG + Intergenic
997731987 5:136188286-136188308 CCAACAGGTATGCCCAGAGTTGG - Intronic
1005042822 6:21614829-21614851 TCACCCTGTCTTCCCAGAGGTGG + Intergenic
1015952654 6:138569146-138569168 CCAACCAGAGATCCCACAGGGGG + Intronic
1018807815 6:167274967-167274989 TCAACTGGTGTTACCAGACGTGG + Intronic
1019163907 6:170086889-170086911 CCAGGCGGCTTTCCCAGAGGAGG - Intergenic
1025034873 7:55587762-55587784 CCACCCGATGTTCCCTGTGGAGG - Intergenic
1028241629 7:88427987-88428009 CCAAAAGGTGTTTCCAAAGGAGG - Intergenic
1031549408 7:123089857-123089879 ACAATCGGTTTTCCCCGAGGAGG - Intergenic
1032710180 7:134454351-134454373 CCAGCCGGTGTTATCAAAGGAGG - Intronic
1039555332 8:38471101-38471123 CCAACCTGGGTTACCAGAGGAGG + Intergenic
1047641351 8:126824893-126824915 CCAGCAGGAGTTCCCACAGGGGG - Intergenic
1049566431 8:143341495-143341517 CCACCCGGAGACCCCAGAGGAGG + Intronic
1058420933 9:104832723-104832745 CCAACTGCTGTTCCCAAAAGTGG + Exonic
1059374137 9:113869187-113869209 CCATCTGGTGCTCCCAAAGGAGG - Intergenic
1060512342 9:124243116-124243138 GAAGCCTGTGTTCCCAGAGGAGG - Intergenic
1061408491 9:130405607-130405629 CCAACAGGGGCTCCAAGAGGAGG - Intronic
1062432385 9:136531939-136531961 GCGAGCGGTGTTCCGAGAGGAGG - Intronic
1203759816 EBV:6421-6443 CCAACACGGGTTCCCAGAGAGGG + Intergenic
1203697014 Un_GL000214v1:108759-108781 CCAGGCGGTCTTCCCAGGGGTGG - Intergenic
1192358810 X:70425772-70425794 CCATCCAGTGTCCCCAGCGGCGG - Exonic
1192631479 X:72781091-72781113 CCCACGGGTGCTCCCAGAGTGGG - Intronic
1192650230 X:72939710-72939732 CCCACGGGTGCTCCCAGAGTGGG + Intronic
1200697813 Y:6376558-6376580 CCTACCTGTGTTCCCAGGGGTGG - Intergenic
1201036299 Y:9788141-9788163 CCTACCTGTGTTCCCAGGGGTGG + Intergenic
1201147514 Y:11073057-11073079 CCAGCCCATGCTCCCAGAGGAGG + Intergenic