ID: 1179495928

View in Genome Browser
Species Human (GRCh38)
Location 21:41771306-41771328
Sequence CCTTGCACGCAGCTTTCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179495928_1179495933 -5 Left 1179495928 21:41771306-41771328 CCAAGAGAAAGCTGCGTGCAAGG No data
Right 1179495933 21:41771324-41771346 CAAGGGCCATGGGCAGAGCTCGG No data
1179495928_1179495936 8 Left 1179495928 21:41771306-41771328 CCAAGAGAAAGCTGCGTGCAAGG No data
Right 1179495936 21:41771337-41771359 CAGAGCTCGGCCTGAAGCCCGGG No data
1179495928_1179495935 7 Left 1179495928 21:41771306-41771328 CCAAGAGAAAGCTGCGTGCAAGG No data
Right 1179495935 21:41771336-41771358 GCAGAGCTCGGCCTGAAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179495928 Original CRISPR CCTTGCACGCAGCTTTCTCT TGG (reversed) Intergenic
No off target data available for this crispr