ID: 1179497293

View in Genome Browser
Species Human (GRCh38)
Location 21:41780724-41780746
Sequence CAATTGGAATAGCTCCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179497293_1179497294 -8 Left 1179497293 21:41780724-41780746 CCAGAGGGGAGCTATTCCAATTG No data
Right 1179497294 21:41780739-41780761 TCCAATTGACTTTAAAACGTAGG No data
1179497293_1179497296 15 Left 1179497293 21:41780724-41780746 CCAGAGGGGAGCTATTCCAATTG No data
Right 1179497296 21:41780762-41780784 AATTTAAAAGTAACTACTAGTGG No data
1179497293_1179497298 30 Left 1179497293 21:41780724-41780746 CCAGAGGGGAGCTATTCCAATTG No data
Right 1179497298 21:41780777-41780799 ACTAGTGGAAAATGCACTAAGGG No data
1179497293_1179497297 29 Left 1179497293 21:41780724-41780746 CCAGAGGGGAGCTATTCCAATTG No data
Right 1179497297 21:41780776-41780798 TACTAGTGGAAAATGCACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179497293 Original CRISPR CAATTGGAATAGCTCCCCTC TGG (reversed) Intergenic
No off target data available for this crispr