ID: 1179497294

View in Genome Browser
Species Human (GRCh38)
Location 21:41780739-41780761
Sequence TCCAATTGACTTTAAAACGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179497288_1179497294 12 Left 1179497288 21:41780704-41780726 CCATTTGGTAGCCTGACTAACCA No data
Right 1179497294 21:41780739-41780761 TCCAATTGACTTTAAAACGTAGG No data
1179497292_1179497294 1 Left 1179497292 21:41780715-41780737 CCTGACTAACCAGAGGGGAGCTA No data
Right 1179497294 21:41780739-41780761 TCCAATTGACTTTAAAACGTAGG No data
1179497293_1179497294 -8 Left 1179497293 21:41780724-41780746 CCAGAGGGGAGCTATTCCAATTG No data
Right 1179497294 21:41780739-41780761 TCCAATTGACTTTAAAACGTAGG No data
1179497287_1179497294 24 Left 1179497287 21:41780692-41780714 CCAAATGTGTATCCATTTGGTAG No data
Right 1179497294 21:41780739-41780761 TCCAATTGACTTTAAAACGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179497294 Original CRISPR TCCAATTGACTTTAAAACGT AGG Intergenic
No off target data available for this crispr