ID: 1179497295

View in Genome Browser
Species Human (GRCh38)
Location 21:41780740-41780762
Sequence TCCTACGTTTTAAAGTCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179497295_1179497297 13 Left 1179497295 21:41780740-41780762 CCAATTGACTTTAAAACGTAGGA No data
Right 1179497297 21:41780776-41780798 TACTAGTGGAAAATGCACTAAGG No data
1179497295_1179497298 14 Left 1179497295 21:41780740-41780762 CCAATTGACTTTAAAACGTAGGA No data
Right 1179497298 21:41780777-41780799 ACTAGTGGAAAATGCACTAAGGG No data
1179497295_1179497296 -1 Left 1179497295 21:41780740-41780762 CCAATTGACTTTAAAACGTAGGA No data
Right 1179497296 21:41780762-41780784 AATTTAAAAGTAACTACTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179497295 Original CRISPR TCCTACGTTTTAAAGTCAAT TGG (reversed) Intergenic
No off target data available for this crispr