ID: 1179497296

View in Genome Browser
Species Human (GRCh38)
Location 21:41780762-41780784
Sequence AATTTAAAAGTAACTACTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179497295_1179497296 -1 Left 1179497295 21:41780740-41780762 CCAATTGACTTTAAAACGTAGGA No data
Right 1179497296 21:41780762-41780784 AATTTAAAAGTAACTACTAGTGG No data
1179497292_1179497296 24 Left 1179497292 21:41780715-41780737 CCTGACTAACCAGAGGGGAGCTA No data
Right 1179497296 21:41780762-41780784 AATTTAAAAGTAACTACTAGTGG No data
1179497293_1179497296 15 Left 1179497293 21:41780724-41780746 CCAGAGGGGAGCTATTCCAATTG No data
Right 1179497296 21:41780762-41780784 AATTTAAAAGTAACTACTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179497296 Original CRISPR AATTTAAAAGTAACTACTAG TGG Intergenic
No off target data available for this crispr