ID: 1179499322

View in Genome Browser
Species Human (GRCh38)
Location 21:41797148-41797170
Sequence CAGTTTTCCACCACACTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179499321_1179499322 0 Left 1179499321 21:41797125-41797147 CCGTATTCAGACTGTGTGCTTGT No data
Right 1179499322 21:41797148-41797170 CAGTTTTCCACCACACTGCATGG No data
1179499320_1179499322 19 Left 1179499320 21:41797106-41797128 CCTAATGCTTGTGAAAAGGCCGT No data
Right 1179499322 21:41797148-41797170 CAGTTTTCCACCACACTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179499322 Original CRISPR CAGTTTTCCACCACACTGCA TGG Intergenic
No off target data available for this crispr