ID: 1179500168

View in Genome Browser
Species Human (GRCh38)
Location 21:41803656-41803678
Sequence TTGGCAAGTCACAGGCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 213}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179500168_1179500182 9 Left 1179500168 21:41803656-41803678 CCCCCATGCCTGTGACTTGCCAA 0: 1
1: 0
2: 2
3: 11
4: 213
Right 1179500182 21:41803688-41803710 TGGCCTGTGGGTTCTGGGGCTGG 0: 1
1: 1
2: 3
3: 73
4: 484
1179500168_1179500177 -4 Left 1179500168 21:41803656-41803678 CCCCCATGCCTGTGACTTGCCAA 0: 1
1: 0
2: 2
3: 11
4: 213
Right 1179500177 21:41803675-41803697 CCAAGGGTAGAAATGGCCTGTGG 0: 1
1: 0
2: 0
3: 19
4: 198
1179500168_1179500186 15 Left 1179500168 21:41803656-41803678 CCCCCATGCCTGTGACTTGCCAA 0: 1
1: 0
2: 2
3: 11
4: 213
Right 1179500186 21:41803694-41803716 GTGGGTTCTGGGGCTGGGGCTGG 0: 1
1: 0
2: 18
3: 198
4: 1889
1179500168_1179500178 -3 Left 1179500168 21:41803656-41803678 CCCCCATGCCTGTGACTTGCCAA 0: 1
1: 0
2: 2
3: 11
4: 213
Right 1179500178 21:41803676-41803698 CAAGGGTAGAAATGGCCTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 122
1179500168_1179500180 4 Left 1179500168 21:41803656-41803678 CCCCCATGCCTGTGACTTGCCAA 0: 1
1: 0
2: 2
3: 11
4: 213
Right 1179500180 21:41803683-41803705 AGAAATGGCCTGTGGGTTCTGGG 0: 1
1: 0
2: 0
3: 24
4: 260
1179500168_1179500181 5 Left 1179500168 21:41803656-41803678 CCCCCATGCCTGTGACTTGCCAA 0: 1
1: 0
2: 2
3: 11
4: 213
Right 1179500181 21:41803684-41803706 GAAATGGCCTGTGGGTTCTGGGG 0: 1
1: 0
2: 2
3: 25
4: 266
1179500168_1179500184 11 Left 1179500168 21:41803656-41803678 CCCCCATGCCTGTGACTTGCCAA 0: 1
1: 0
2: 2
3: 11
4: 213
Right 1179500184 21:41803690-41803712 GCCTGTGGGTTCTGGGGCTGGGG 0: 1
1: 1
2: 5
3: 70
4: 662
1179500168_1179500183 10 Left 1179500168 21:41803656-41803678 CCCCCATGCCTGTGACTTGCCAA 0: 1
1: 0
2: 2
3: 11
4: 213
Right 1179500183 21:41803689-41803711 GGCCTGTGGGTTCTGGGGCTGGG 0: 1
1: 0
2: 17
3: 71
4: 509
1179500168_1179500179 3 Left 1179500168 21:41803656-41803678 CCCCCATGCCTGTGACTTGCCAA 0: 1
1: 0
2: 2
3: 11
4: 213
Right 1179500179 21:41803682-41803704 TAGAAATGGCCTGTGGGTTCTGG 0: 1
1: 0
2: 1
3: 20
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179500168 Original CRISPR TTGGCAAGTCACAGGCATGG GGG (reversed) Intronic
900641793 1:3691105-3691127 GAGGCAGGTCCCAGGCATGGAGG + Intronic
901379499 1:8863462-8863484 TTGACAAAGCCCAGGCATGGAGG - Intronic
903163755 1:21507193-21507215 AGGGCAAATCACAGACATGGGGG + Intergenic
903320476 1:22540206-22540228 TCAGGAAGTCTCAGGCATGGTGG - Intergenic
903962635 1:27066269-27066291 TTAGCCAGGCATAGGCATGGTGG - Intergenic
905035029 1:34912659-34912681 ATGGCTTATCACAGGCATGGAGG - Intronic
905825256 1:41021816-41021838 TTGGCCAGCCACAGGCAGGCTGG + Exonic
906144467 1:43551630-43551652 CTGGCAAGTCAGAGGGATGCAGG - Intronic
908994308 1:70133166-70133188 TTGGCAATTCTCTGGCTTGGGGG + Intronic
910693115 1:89984760-89984782 TTGGGGAGGCTCAGGCATGGCGG + Intergenic
916243300 1:162661145-162661167 TTGGAAAGTCACAGGCTCTGTGG - Intronic
921442243 1:215201181-215201203 TTGGAAAGGCAAAGGCATCGAGG + Intronic
921812705 1:219532675-219532697 TTAGCAAGTAAAAGGCATGGAGG + Intergenic
921886807 1:220315219-220315241 TTGGCATGTCATTGCCATGGGGG + Intergenic
923538906 1:234874233-234874255 TTGCCAAGACCCAGGCGTGGTGG - Intergenic
1064987404 10:21225302-21225324 TAGGGAAGTCCCAGTCATGGTGG - Intergenic
1066068522 10:31780140-31780162 TTGGCCAGGCACAGGCACAGTGG + Intergenic
1069416459 10:68204990-68205012 GTGGAAACTCACAGGGATGGTGG - Intronic
1070639588 10:78158180-78158202 TGGGCCACTCACAGGCCTGGTGG - Intergenic
1072681426 10:97509936-97509958 AAGGCCAGGCACAGGCATGGTGG - Intronic
1074140475 10:110667856-110667878 TGGGCAGGTCACATGCATGGGGG - Intronic
1075008900 10:118851594-118851616 TTTACAGGACACAGGCATGGAGG - Intergenic
1075776610 10:124993172-124993194 TTGGCAGGCCAGAGGCACGGAGG + Intronic
1076608799 10:131707543-131707565 TAGGGAAGTAACAGGCATGTGGG + Intergenic
1076902693 10:133347709-133347731 TTGGGCAGTCACAGGCCTGCTGG - Intronic
1077244411 11:1529241-1529263 TTGGTAAGTCCCAGGCAGTGTGG + Intergenic
1080107470 11:28525899-28525921 GTGGGGAGTCTCAGGCATGGTGG + Intergenic
1081982458 11:47276572-47276594 TTGGGAGGTGGCAGGCATGGTGG + Intronic
1083301336 11:61740989-61741011 TGGGCAAGTCTCAGGCCTTGGGG + Intronic
1084025790 11:66448466-66448488 ATGGCAAAACCCAGGCATGGTGG - Intronic
1089748267 11:120632118-120632140 TTGGGAGGTCATAGGCGTGGAGG + Intronic
1092127736 12:6086696-6086718 AGGGAAATTCACAGGCATGGAGG - Intronic
1092364087 12:7862447-7862469 GTGGGAAGGCTCAGGCATGGCGG - Intronic
1093715554 12:22377168-22377190 TGGGGAAGGCTCAGGCATGGCGG - Intronic
1094196088 12:27751556-27751578 CTGGGAAGCCGCAGGCATGGGGG - Intronic
1094674480 12:32605496-32605518 CTGGCAAGTTAAAGGCATGTGGG - Intronic
1095668477 12:44831270-44831292 TGGGAAAGACACAAGCATGGTGG - Intronic
1096407603 12:51355059-51355081 TGGGCCAGTCACAGACATGCTGG + Intronic
1096993622 12:55825211-55825233 TTGGTAAGTTACAGGTGTGGTGG + Intronic
1097165618 12:57084502-57084524 ATGGCAAGGCACTGGCATGGGGG - Intronic
1102175762 12:110873312-110873334 CTGGGAAGTCACAAGGATGGAGG + Intronic
1102885416 12:116518111-116518133 TCTGCAAGTCACAGGCAGGTGGG - Intergenic
1103222698 12:119259070-119259092 TTGGCCAGTTCCAGGCATCGTGG + Intergenic
1104420645 12:128631906-128631928 CTGGCCAGTCACAGTCAGGGTGG - Intronic
1104860814 12:131922507-131922529 TGGGCAAGGCAGAGGCAGGGAGG - Exonic
1105511844 13:21058541-21058563 TTAGCAAATCACAGGGTTGGTGG - Intronic
1107710606 13:43146967-43146989 TTGGGATGTCACAGGGTTGGAGG + Intergenic
1112226530 13:97545538-97545560 TTGGGGAGGCTCAGGCATGGAGG - Intergenic
1112635403 13:101212107-101212129 ATGGAGAATCACAGGCATGGAGG - Intronic
1114271208 14:21101410-21101432 TGGGCAAGGCACAGGCAGAGTGG + Exonic
1115791843 14:36888406-36888428 GTGGCAAATCACAGGCATGTTGG - Intronic
1116500236 14:45612115-45612137 TGGGAAAGGCACAGGCATGATGG + Intergenic
1119111011 14:71973866-71973888 TTGGCAGGAGACAGGCATGCAGG + Intronic
1119193705 14:72701927-72701949 TCGGCAGATGACAGGCATGGTGG - Intronic
1119432304 14:74576182-74576204 CTAGCAAGTCACTGACATGGAGG - Intronic
1120067013 14:80054233-80054255 TTGGCAAGTCATTGGCCTCGTGG + Intergenic
1120722491 14:87903952-87903974 TGGGCATGTCACAGGCAGGCTGG + Intronic
1121623760 14:95369824-95369846 TGGGTAAGGCACAGGTATGGTGG - Intergenic
1124387829 15:29224891-29224913 TTGGGGAGGCTCAGGCATGGCGG + Intronic
1125885511 15:43226650-43226672 TTGGGGAGGCTCAGGCATGGCGG + Intergenic
1126805697 15:52346563-52346585 TTGGTGGGTCACAGGTATGGTGG - Intronic
1130507946 15:84563921-84563943 TAGGATTGTCACAGGCATGGAGG - Intergenic
1131478690 15:92763592-92763614 TTAGGAAGTCACAGAGATGGGGG - Intronic
1131690709 15:94824461-94824483 CTGGGAAGTCACTGTCATGGTGG - Intergenic
1132506020 16:309476-309498 TTGCCCAGTCTCGGGCATGGGGG - Intronic
1132569701 16:638698-638720 ATGGCAAGCCACAGCCAGGGAGG - Intronic
1134662279 16:15993163-15993185 TGGGCTAGTCACAGGCATGGGGG - Intronic
1135929474 16:26724525-26724547 AGGGAAAGTCACAGGCATGAAGG + Intergenic
1135948900 16:26893661-26893683 TTGGTAAGTCCAAGGCATGATGG - Intergenic
1136031783 16:27508296-27508318 TTGAAAAGTGCCAGGCATGGTGG - Intronic
1138680694 16:58681807-58681829 CTGGAGAGTCTCAGGCATGGTGG - Intronic
1140925025 16:79574391-79574413 TTATCAAGTCACAAGGATGGAGG - Intergenic
1141347687 16:83262268-83262290 TGGGCAAATCAGAGACATGGAGG - Intronic
1141873314 16:86804541-86804563 CTGGCAAGGCAGAGGCAAGGTGG + Intergenic
1143320602 17:6066334-6066356 CTGACTAGTCATAGGCATGGGGG - Intronic
1145291515 17:21550364-21550386 TTAGAAATTAACAGGCATGGTGG + Intronic
1145388568 17:22436670-22436692 TTAGAAATTAACAGGCATGGTGG - Intergenic
1147376203 17:40023697-40023719 TTGGCAGGGCCCAGGCCTGGGGG - Intronic
1147692937 17:42329099-42329121 TTGGAAAGCCCCAGGCAAGGTGG + Intronic
1148173914 17:45548072-45548094 ATGGCAAGTCCCAGGTCTGGAGG + Intergenic
1148275354 17:46297375-46297397 ATGGCAAGTCCCAGGTCTGGAGG - Exonic
1148297460 17:46514954-46514976 ATGGCAAGTCCCAGGTCTGGAGG - Exonic
1149662490 17:58342181-58342203 TGGGAAAGTCACAGGGTTGGTGG + Intergenic
1152109595 17:78350387-78350409 TTGTCCAGCAACAGGCATGGTGG + Intergenic
1152317568 17:79589809-79589831 TCGGCAAGGCCCAGGCATGCTGG + Intergenic
1152631651 17:81413294-81413316 TGGCCAAGTCACAGGGAAGGAGG - Intronic
1155611676 18:27673963-27673985 TTGGGGAGACTCAGGCATGGCGG + Intergenic
1155771106 18:29701005-29701027 CTGGCATTTCCCAGGCATGGAGG - Intergenic
1161099831 19:2416084-2416106 TTGGAGATTCCCAGGCATGGTGG + Intronic
1161506321 19:4645803-4645825 TTGGCAGGCCCCATGCATGGGGG - Intronic
1161644235 19:5443483-5443505 TGGGGGAGTCACAGGCACGGTGG + Intergenic
1163005339 19:14393832-14393854 TGGCCAAGTCACATGCATGTGGG - Intronic
1163824175 19:19513844-19513866 TTGGCAAGTGACATCCATGTGGG + Intronic
1164771024 19:30809093-30809115 TTGGCAAGCCAGAGGCACTGGGG + Intergenic
1165858219 19:38893009-38893031 CTGGCCAATCAGAGGCATGGGGG + Intronic
1167814204 19:51865382-51865404 TTGGGAAGGCGCGGGCATGGTGG - Intronic
1168294539 19:55372456-55372478 TGGGCCAGCCCCAGGCATGGGGG + Intergenic
1168538900 19:57194022-57194044 GTGGCAGGTCACCTGCATGGTGG - Intronic
925915211 2:8599998-8600020 CTGGGAAGGGACAGGCATGGTGG - Intergenic
926814165 2:16784016-16784038 TTTACAAGTCCCAGGAATGGGGG - Intergenic
928106381 2:28472890-28472912 GTGGCGAGGCTCAGGCATGGCGG - Intronic
928405208 2:31009498-31009520 TTGTCAAGGCACAGGAATGGAGG - Intronic
930217446 2:48711038-48711060 TTGGTAAGTCCCAGGAATTGAGG - Intronic
930261659 2:49154091-49154113 TTGGAAAGCCACAGGCAGGAGGG + Intronic
930755937 2:54972818-54972840 TTGGCAAGTTGCAGAGATGGTGG - Exonic
931216613 2:60250882-60250904 CTGGCATGACACAGGCGTGGGGG - Intergenic
932147668 2:69337350-69337372 TTGGCAACTGCCAGGCATGGTGG - Intronic
933442056 2:82326348-82326370 TTGGGGAGGCTCAGGCATGGCGG + Intergenic
936581488 2:113704503-113704525 CTGGGAAGGCTCAGGCATGGCGG + Intergenic
937815654 2:126247888-126247910 CAGGCAAATGACAGGCATGGAGG + Intergenic
938674037 2:133612912-133612934 TTGGTAAGTAGCAGGCATTGAGG + Intergenic
938968950 2:136414880-136414902 GTGGCAAGAGACAGGCAGGGTGG + Intergenic
940797389 2:158094990-158095012 ATGGCCAGTCACAGGCAGTGAGG + Intronic
940909590 2:159198473-159198495 GGGTCAAGTCACAGGTATGGAGG - Intronic
942833576 2:180265614-180265636 TTGGCAACTCAGAGGCCTGAGGG - Intergenic
943713930 2:191129299-191129321 ATGTCAATGCACAGGCATGGTGG + Intronic
944352140 2:198741859-198741881 TTAGCCAGTGGCAGGCATGGTGG - Intergenic
944944476 2:204667413-204667435 TTGGTAAGTTATATGCATGGAGG - Intronic
948470669 2:238175833-238175855 GTGGCTATTCACAGACATGGTGG + Intronic
948626665 2:239273603-239273625 TTGGCAAGACTGTGGCATGGGGG - Intronic
1171411509 20:24951301-24951323 CGGGGAAGGCACAGGCATGGAGG + Intronic
1172671837 20:36640018-36640040 CTGGCAAGGGCCAGGCATGGTGG + Intronic
1172827011 20:37797716-37797738 TTGGACAGTAACAGGGATGGGGG - Intronic
1175094443 20:56530222-56530244 TTGGCAAGGAGCAGGAATGGAGG + Intergenic
1175236319 20:57514770-57514792 TTGGCAAGGATCAGGCCTGGAGG - Intronic
1175792011 20:61745758-61745780 CTTGGAAGTCACAGGCATGATGG - Intronic
1177777341 21:25582935-25582957 CTCACAAGTCACAGGCGTGGAGG + Intergenic
1179500168 21:41803656-41803678 TTGGCAAGTCACAGGCATGGGGG - Intronic
1179586084 21:42375138-42375160 TTGGCAGGACCCGGGCATGGAGG - Intronic
1179994235 21:44966647-44966669 ATGGCAAGTCACAGCCTGGGAGG - Intronic
1180223563 21:46375723-46375745 TGGGCAGGTCACAGGCATGCAGG - Intronic
1183718463 22:39548183-39548205 CAGGGAATTCACAGGCATGGGGG + Intergenic
1185045839 22:48528370-48528392 TTGGCTATACACAGGCATCGGGG - Intronic
1185392318 22:50569260-50569282 GTGGCAGCTCACAGGCATGAGGG - Exonic
950337969 3:12214445-12214467 TTGGTAAGACACTGGCATGTAGG - Intergenic
951022609 3:17797416-17797438 TTGGAAAGTCACAGGTATTATGG - Intronic
951235316 3:20228605-20228627 TTGTAAAGTGGCAGGCATGGTGG + Intergenic
951342426 3:21504913-21504935 TTGTCAAGACACAGGTGTGGAGG + Intronic
954710635 3:52503604-52503626 TGGGCAAGTCACAGGCCTTCTGG + Intronic
955343236 3:58141866-58141888 TGGGGAAGTCACAGCCGTGGAGG + Exonic
956482471 3:69687105-69687127 CTGTCAAGTCACAGACACGGGGG + Intergenic
956994437 3:74808103-74808125 TTGGGAAGTGATAGGAATGGGGG + Intergenic
957921067 3:86748875-86748897 TAGGAAAGTTACAGTCATGGTGG - Intergenic
958809256 3:98840777-98840799 GTAGCAAATAACAGGCATGGGGG - Intronic
959670313 3:108970086-108970108 TGGGGAAGTCACTGGCATGTGGG + Intronic
960146692 3:114211415-114211437 TCTGAAAGTCACAGGCTTGGTGG + Intergenic
960230979 3:115227103-115227125 GTGGGGAGTCTCAGGCATGGTGG - Intergenic
960356694 3:116662602-116662624 TTGGGAAGTCACAAGCCTGATGG - Intronic
961435994 3:126916977-126916999 TTGGCAGGTGACAGGCATTATGG - Intronic
961575772 3:127834989-127835011 TAGGCAGGTCACAGGCAGAGTGG - Intergenic
962402964 3:135077385-135077407 ACTGCAAGTCAAAGGCATGGTGG - Intronic
962606402 3:137035996-137036018 TGGGCTATTCTCAGGCATGGGGG + Intergenic
964375075 3:156041538-156041560 TTGGGGAGGCTCAGGCATGGTGG - Intronic
967241194 3:187441264-187441286 TTGGGAAGTCACAGCCATGCTGG - Intergenic
967863353 3:194170148-194170170 TTGGCAAGGCGGAGGGATGGGGG + Intergenic
969486499 4:7475202-7475224 CTGCCAAGTCCCAGGCACGGCGG - Intronic
969620525 4:8276634-8276656 TTGGTAAATCACAGGCAGGCTGG + Intronic
971968844 4:33595655-33595677 GTGGCAAGACACAGGCATGGTGG - Intergenic
972999421 4:44927468-44927490 CTGGCTAGTCTCAGGCATGCAGG + Intergenic
977140266 4:93362445-93362467 TTGGCAGGTCTCATGCTTGGGGG + Intronic
977470672 4:97438183-97438205 TTGGGGAGGCTCAGGCATGGTGG + Intronic
981753658 4:148118258-148118280 TTTGCAAGTCCCTGGCATGCTGG + Intronic
985678695 5:1245097-1245119 TGGGCAGGACACAGGCAGGGAGG - Intronic
986761642 5:10885398-10885420 TTGTCAAGAGGCAGGCATGGTGG + Intergenic
988217840 5:28299997-28300019 TTGACAAAACACAGGCAAGGTGG - Intergenic
990992970 5:61703057-61703079 TGGGCAGGAGACAGGCATGGAGG - Intronic
993672961 5:90784616-90784638 CTGGCATGTTTCAGGCATGGAGG + Intronic
995325290 5:110882692-110882714 ATGGCAAGTGACAGTTATGGGGG + Intergenic
995859031 5:116622675-116622697 TTGGTAAATCAAAGACATGGGGG - Intergenic
997082939 5:130762472-130762494 TTTCCAAGTCACAGTCATGTTGG + Intergenic
997651522 5:135525152-135525174 TTGGCAAGTCCTAGGCATCTTGG + Intergenic
1000366810 5:160499513-160499535 ATGGCAAGTAACTGGCATGTGGG + Intergenic
1001239245 5:170055723-170055745 TGGGCAAGTGATAGGCAGGGTGG + Intronic
1002029500 5:176417204-176417226 TTGGCAAAGCGCAGGCAGGGAGG - Intergenic
1002466186 5:179410048-179410070 CTGGAAAGTCACAGAGATGGTGG + Intergenic
1002590322 5:180286759-180286781 TTCGGAAGTCACAGAAATGGTGG - Intronic
1002606054 5:180383394-180383416 TAGGCAGGCCACAGGCAGGGAGG + Intergenic
1004452358 6:15758855-15758877 GGGGCAAGGCTCAGGCATGGCGG + Intergenic
1007843504 6:44735700-44735722 TTGGGAAAACACAGGCATGGAGG + Intergenic
1008615194 6:53219557-53219579 TTGGACAGTGACAGGCATGCTGG + Intergenic
1008661387 6:53671582-53671604 TTTCTAAGTCACAGCCATGGGGG - Intergenic
1011497560 6:87951555-87951577 TAGCCCAATCACAGGCATGGGGG - Intergenic
1012897568 6:104967829-104967851 GTGGCATGTGCCAGGCATGGTGG - Intronic
1015296725 6:131603164-131603186 TTTTCAAATCACATGCATGGGGG - Exonic
1016235111 6:141855012-141855034 TTGGAAAATCAGAGGCAAGGAGG - Intergenic
1016905986 6:149151363-149151385 TTGGAAGGTCAGAGGCAAGGGGG + Intergenic
1017996515 6:159535891-159535913 TTGGCCTGGAACAGGCATGGAGG + Intergenic
1018185697 6:161264012-161264034 TTGGCAACCCACAGGGCTGGGGG + Intronic
1020662170 7:10995649-10995671 TGGGTAAGGCTCAGGCATGGTGG + Intronic
1023082116 7:36535648-36535670 TGGGCAAGTCACAGGCATTCAGG - Intronic
1024037638 7:45522348-45522370 TTGGCCAGTGCCAGCCATGGAGG - Intergenic
1025924523 7:65946254-65946276 ATGGCAAGTCAAAGGCCTTGAGG - Intronic
1025931844 7:66001483-66001505 ATGGCAAGTCAAAGGCCTTGAGG - Intergenic
1027205676 7:76096182-76096204 TTGGCAACACAGAAGCATGGCGG + Intergenic
1028413744 7:90558317-90558339 GAGGCAAGTCAAGGGCATGGTGG + Intronic
1029646889 7:101862565-101862587 TAGGCAAGTCAGAGGAAAGGGGG - Intronic
1029988192 7:104940416-104940438 TGGGGGAGTCTCAGGCATGGTGG - Intergenic
1030650351 7:112110591-112110613 CTGGCAAGTGTCATGCATGGGGG + Intronic
1032192279 7:129771955-129771977 TCAGCAAGTCCCAGGCTTGGGGG - Intergenic
1039450668 8:37672500-37672522 TTTGGAAGTCAGGGGCATGGTGG - Intergenic
1040012800 8:42676359-42676381 CAGGCAAGACAAAGGCATGGAGG - Intergenic
1042277215 8:67018473-67018495 GTGGCTATTCACAGGCATGTAGG + Intronic
1045278500 8:100728218-100728240 TTGGCCAGGCACGGGCATGGTGG + Intergenic
1046983853 8:120365739-120365761 ACAGAAAGTCACAGGCATGGTGG + Intronic
1047202277 8:122777304-122777326 TTTGCAAGTCACAAGTATAGTGG + Intergenic
1048174812 8:132141947-132141969 GTGGCAAGTCTCAGGCATTTAGG - Intronic
1048767882 8:137863812-137863834 ATGCAAAGTTACAGGCATGGGGG - Intergenic
1048934327 8:139342556-139342578 TTGCAAAGTCAGGGGCATGGGGG + Intergenic
1049344731 8:142132752-142132774 TTGGCCAATCAATGGCATGGTGG + Intergenic
1050718084 9:8552839-8552861 TTGGCAAGTCACTAGCACTGGGG + Intronic
1053564679 9:39236711-39236733 TTTGCCAGTCACAGTGATGGAGG + Intronic
1053830461 9:42074612-42074634 TTTGCCAGTCACAGTGATGGAGG + Intronic
1054132473 9:61382323-61382345 TTTGCCAGTCACAGTGATGGAGG - Intergenic
1054600098 9:67112843-67112865 TTTGCCAGTCACAGTGATGGAGG - Intergenic
1055824202 9:80304335-80304357 TTGGCAGGTGGCAGACATGGAGG + Intergenic
1059872434 9:118592868-118592890 TTTCCAAGCCACAGGCTTGGAGG + Intergenic
1061960726 9:133987666-133987688 TGGGCAAGTCAGAGGCTGGGCGG + Intronic
1185811231 X:3112414-3112436 TTGGTAGGTCACAGGCACGATGG - Exonic
1187650789 X:21403218-21403240 TTTGCAGGTAACAGGCATAGGGG + Intronic
1189911056 X:45810854-45810876 TTGTGAAGTCCCTGGCATGGTGG - Intergenic
1190221701 X:48516086-48516108 TTGACAAGACACAGGCACTGAGG - Exonic
1190464120 X:50708725-50708747 TTGGCAAGTCAGATACATGCGGG + Intronic
1191729212 X:64315295-64315317 GTAACAAGTCCCAGGCATGGTGG + Intronic
1194149850 X:90310143-90310165 TTGTCCCATCACAGGCATGGAGG - Intergenic
1196695141 X:118603252-118603274 ATGGCAAGTGACAGGTTTGGCGG + Intronic
1197727113 X:129783657-129783679 TTGGCAGGACACGGGCATGCGGG + Intronic
1198715205 X:139551303-139551325 CTGGCAAGACACAGGCCAGGTGG + Intronic