ID: 1179503730

View in Genome Browser
Species Human (GRCh38)
Location 21:41825820-41825842
Sequence GTGCTCAGGTTGTCTTAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 61}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179503730 Original CRISPR GTGCTCAGGTTGTCTTAAAC TGG (reversed) Intronic
908302863 1:62779361-62779383 ATTTACAGGTTGTCTTAAACTGG + Intergenic
918521515 1:185420208-185420230 GTCCTCAGGTGGTCTGAAGCAGG + Intergenic
922341387 1:224658374-224658396 TTGCTCAGCTGGTCTTGAACTGG + Intronic
924536394 1:244939511-244939533 GCACTCTGGTTGTCTTAAGCTGG + Intergenic
1065796765 10:29315135-29315157 ATGCTCTGGATGTCTAAAACTGG + Intronic
1067389884 10:45854007-45854029 GTGATCCTGTTGTCTTAAAATGG - Intergenic
1067501587 10:46809840-46809862 GTGATCATGTTGTCTTAAAATGG + Intergenic
1067519766 10:46989843-46989865 CTGTTCAGGTTTTCTTGAACAGG + Intronic
1067592988 10:47530069-47530091 GTGATCCTGTTGTCTTAAAATGG - Intronic
1067640103 10:48038172-48038194 GTGATCCTGTTGTCTTAAAATGG - Intergenic
1067642482 10:48061998-48062020 CTGTTCAGGTTTTCTTGAACAGG - Intergenic
1067873381 10:49982038-49982060 GTGATCCTGTTGTCTTAAAATGG + Intergenic
1079366362 11:19813628-19813650 GTGGTCAGATTTTCTTACACAGG - Intronic
1080402292 11:31947396-31947418 GAGCTCAGGTTGTCTTGGGCGGG - Intronic
1086901714 11:92375024-92375046 GTGCGCATGTTTTATTAAACAGG - Intronic
1106154801 13:27144286-27144308 TTGCCCAGGTGGTCTCAAACTGG - Intronic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1110879812 13:80558052-80558074 GTCCTCAGTCTGTCTTAAAGGGG - Intergenic
1112808570 13:103189986-103190008 GTGCTAAAGTTGTCTGAATCAGG + Intergenic
1114035919 14:18627013-18627035 CTGCTCAGGTTGTTGTCAACGGG + Intergenic
1119603046 14:75990288-75990310 GTGATTAGGTTTTCTTAATCAGG - Intronic
1120765626 14:88324305-88324327 GTGCTGAGGTGCTCTTGAACGGG + Intronic
1121886401 14:97546775-97546797 TTTTTCATGTTGTCTTAAACAGG - Intergenic
1131784775 15:95900317-95900339 GTGTTCTTGTTGTCTTCAACAGG - Intergenic
1140718008 16:77744401-77744423 GTGCTCAGATTGACTTCAGCTGG - Intergenic
1141396877 16:83713032-83713054 GTGCTCAGATCATTTTAAACAGG - Intronic
1145115402 17:20205456-20205478 GTGCACAGGTATTCTTGAACAGG + Exonic
1152401528 17:80069433-80069455 TTCCTCAGGTCGACTTAAACAGG - Intronic
1155400588 18:25434829-25434851 GTGCTCAGGGTGCCTGGAACTGG + Intergenic
1155490070 18:26392409-26392431 TTGCCCAGGTTGTCTCAACCTGG - Intergenic
1155815287 18:30300239-30300261 GTGCTTAGGGAGTCTTAGACAGG - Intergenic
1158235802 18:55312170-55312192 GTGTTTAGGTTTTCTTAAATTGG + Intronic
927055339 2:19361236-19361258 GTGATCAATTTCTCTTAAACAGG - Intergenic
929356112 2:41026628-41026650 GTGCTCAGGTTGTTTTTCACAGG + Intergenic
931503223 2:62894564-62894586 GTGCTCATGGTCTCTTGAACTGG - Intronic
940078853 2:149776991-149777013 GTGCTCAGGTGGGCGTAAGCTGG + Intergenic
948496086 2:238350835-238350857 GGGCACAGGCTGTATTAAACAGG + Intronic
1170359822 20:15533870-15533892 TTGCTCAGGTTGTCTAAATGTGG + Intronic
1173010582 20:39178086-39178108 ATGATCAGGTTGTCATAAACAGG + Intergenic
1179503730 21:41825820-41825842 GTGCTCAGGTTGTCTTAAACTGG - Intronic
1180460043 22:15554067-15554089 CTGCTCAGGTTGTTGTCAACGGG + Intergenic
1180972016 22:19820723-19820745 CTGCTCGGCTTGTCTGAAACAGG - Exonic
1183558908 22:38554223-38554245 GAGCTGAAGTAGTCTTAAACTGG + Intronic
1184076238 22:42180384-42180406 ATGGTCAGGTTTTCTTAAAGTGG + Intronic
951211968 3:19985141-19985163 GTGCTCAGGTTGGAATAAAGTGG + Exonic
956989720 3:74749580-74749602 GTGCTGAGCTTGGCTTAACCAGG + Intergenic
961339278 3:126206329-126206351 GTGCTGAGGTTGTGATAAAATGG - Intergenic
961857295 3:129885225-129885247 TTGGTCAGGTTGTCCCAAACTGG + Intronic
966679868 3:182630461-182630483 GTTCTCTTGTTGTCTTAAAATGG - Intergenic
985276983 4:188246618-188246640 GTGCTCAGTATGTCTTAACAGGG + Intergenic
985931812 5:3064284-3064306 CAGCTCTGGTTGTCTTTAACAGG - Intergenic
991993172 5:72361663-72361685 GTCCTCAGGAGGTTTTAAACAGG - Intergenic
994158113 5:96525823-96525845 GTGCTGAGGTTGTCTTCCAAAGG + Intronic
994414455 5:99450428-99450450 GTGCTACGGTTCTTTTAAACAGG + Intergenic
1002794982 6:465100-465122 CTGCTCAGTTTGTTTTAAAAAGG - Intergenic
1022356567 7:29620596-29620618 GTGCTCAGGTTGCCTGGAATGGG + Intergenic
1028697310 7:93730017-93730039 GTTCTCAATTTGTCTGAAACTGG + Intronic
1032569128 7:132981218-132981240 GGGCTCAAGTGGTCTTGAACTGG + Intronic
1038770568 8:30475513-30475535 GTGCTCAGGAAGTCTTAAGTTGG + Intronic
1045915014 8:107458997-107459019 ATGCTCAGGTTGTCTTAAGATGG - Intronic
1048844256 8:138591611-138591633 GTGCTCAGGGTGGTTTAGACTGG - Intronic
1049089261 8:140502012-140502034 GTGCTCAGGTTGTCCGTGACAGG + Intergenic
1057303253 9:93898586-93898608 ATGCTCAGGTTGTCTTCGACAGG - Intergenic
1186198905 X:7136746-7136768 GTGCTCATGTTGTATTTTACTGG + Intronic
1192244627 X:69362269-69362291 GTGCTCGGGTTGTCTGAAGCTGG + Intergenic
1192593789 X:72385255-72385277 GTGCCCAGGTGATCTAAAACTGG - Intronic
1194403309 X:93463830-93463852 TTTCTCATGTTGTCTTAACCTGG + Intergenic
1199331815 X:146569831-146569853 ATGCTAAGGTTGTGTTAATCTGG - Intergenic