ID: 1179506654

View in Genome Browser
Species Human (GRCh38)
Location 21:41845526-41845548
Sequence GGCCGGGCTGCCCGAGTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 183}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179506642_1179506654 22 Left 1179506642 21:41845481-41845503 CCTGGAAGGAATGCTCAGGACCC 0: 1
1: 0
2: 1
3: 26
4: 187
Right 1179506654 21:41845526-41845548 GGCCGGGCTGCCCGAGTACCTGG 0: 1
1: 0
2: 1
3: 12
4: 183
1179506649_1179506654 0 Left 1179506649 21:41845503-41845525 CCTCCGGTAATCTGGGTGGCAGA 0: 1
1: 0
2: 1
3: 6
4: 101
Right 1179506654 21:41845526-41845548 GGCCGGGCTGCCCGAGTACCTGG 0: 1
1: 0
2: 1
3: 12
4: 183
1179506647_1179506654 2 Left 1179506647 21:41845501-41845523 CCCCTCCGGTAATCTGGGTGGCA 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1179506654 21:41845526-41845548 GGCCGGGCTGCCCGAGTACCTGG 0: 1
1: 0
2: 1
3: 12
4: 183
1179506651_1179506654 -3 Left 1179506651 21:41845506-41845528 CCGGTAATCTGGGTGGCAGAGGC 0: 1
1: 0
2: 15
3: 715
4: 16939
Right 1179506654 21:41845526-41845548 GGCCGGGCTGCCCGAGTACCTGG 0: 1
1: 0
2: 1
3: 12
4: 183
1179506640_1179506654 28 Left 1179506640 21:41845475-41845497 CCGTCACCTGGAAGGAATGCTCA 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1179506654 21:41845526-41845548 GGCCGGGCTGCCCGAGTACCTGG 0: 1
1: 0
2: 1
3: 12
4: 183
1179506648_1179506654 1 Left 1179506648 21:41845502-41845524 CCCTCCGGTAATCTGGGTGGCAG 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1179506654 21:41845526-41845548 GGCCGGGCTGCCCGAGTACCTGG 0: 1
1: 0
2: 1
3: 12
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179506654 Original CRISPR GGCCGGGCTGCCCGAGTACC TGG Intronic
900616423 1:3567611-3567633 GGCCAGGCTGGCCGTGTCCCCGG - Intronic
900642917 1:3695844-3695866 GGCGGGGCTGCCCCATTCCCTGG - Intronic
901594069 1:10370844-10370866 GCCCTGGCTTCCTGAGTACCTGG - Intronic
901632927 1:10656718-10656740 GTGCTGGCTGCCCGAGAACCTGG + Exonic
904270944 1:29349651-29349673 GGTCGGGCAGCCCGAGTGTCAGG - Intergenic
908951401 1:69567468-69567490 CGCCGCGCTGCCCGAGCGCCCGG + Intergenic
912776458 1:112509016-112509038 GGGCGCGCTGCCTGAGGACCGGG - Exonic
913172210 1:116243172-116243194 GGCCTTGCTGTCCGAGTCCCCGG - Intergenic
915886186 1:159723524-159723546 GGCCTGGCTGCCTGAGAGCCGGG - Intergenic
916414462 1:164579547-164579569 GGCTGGTCTGCCCCAGTAACTGG - Intronic
923111128 1:230890997-230891019 GGCTCAGCTGCCCGAGTAGCTGG - Intergenic
1062950112 10:1492711-1492733 GGCCGGGGTCCCCCAGCACCCGG - Intronic
1071236707 10:83657703-83657725 TGCCAGGCTGCCCCAGTAGCAGG - Intergenic
1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG + Exonic
1076864401 10:133160025-133160047 GGCGGGGCTGCCGCAGTCCCGGG - Intergenic
1079081130 11:17414439-17414461 GGCCAGCCTGCCCCAGTTCCGGG - Intronic
1079296773 11:19241478-19241500 GGCCCGGGAGCCCGCGTACCTGG + Exonic
1081865915 11:46360669-46360691 GGCCCAGCTTCCCGAGTAGCTGG - Intronic
1085100504 11:73796381-73796403 GGCCAGGCTGCGACAGTACCTGG - Intronic
1085459791 11:76686690-76686712 GGCCGGGCTGCTCGCGGCCCAGG - Intergenic
1089256264 11:117195912-117195934 GGCCGGGAGGCCCGCTTACCAGG - Exonic
1091263636 11:134253660-134253682 GGCCGGTCTGGACGAGGACCCGG - Exonic
1092759318 12:11795315-11795337 GGCCGGAGTGCCCCAGCACCGGG + Intronic
1096840911 12:54378939-54378961 GGCCGGACAGCCCGAGGACTAGG + Intronic
1097046198 12:56189316-56189338 GGCCGGGCCGCGCGGGGACCGGG - Intronic
1097490928 12:60269837-60269859 GGCCGGCCAGCCCGCGTCCCCGG + Intergenic
1098024671 12:66189277-66189299 GGCTCGGCTGCCCGAGCCCCGGG - Exonic
1098500532 12:71187099-71187121 GGCAGGGCTGCCAGAGGAACTGG + Intronic
1101131772 12:101697690-101697712 GGCCGGCCTGCCCGGCTGCCGGG - Exonic
1103613617 12:122138724-122138746 GGCAGGGCTGGCCCAGTGCCGGG - Intronic
1104595393 12:130116968-130116990 TGCTGGGCTGGCAGAGTACCAGG + Intergenic
1107468101 13:40666983-40667005 ACCCGGGCTTCCCGAGTACTCGG - Intergenic
1107851489 13:44576807-44576829 GGCCGTGCTCCGCGAGGACCCGG - Intronic
1113494227 13:110714700-110714722 GGCCGGGGTTCCCGCGGACCCGG + Intronic
1119695077 14:76706986-76707008 GGCGGGCCAGCCCGAGTTCCGGG - Intergenic
1121605085 14:95234614-95234636 GGCCAGGATGCCCAAGTGCCGGG + Intronic
1122130748 14:99603533-99603555 GGCCCTGCTGCGCGAGAACCTGG - Exonic
1122663491 14:103313134-103313156 GGCTGGGCCTCCCGAGTAGCTGG - Intergenic
1124251890 15:28112307-28112329 GGCCTGGCTGGCGGAGGACCAGG + Intronic
1128548798 15:68584604-68584626 GTCAGGGCTGCCCGGGTGCCAGG - Intronic
1128745862 15:70113715-70113737 CGCAGGGCTGCCCAAGTACAGGG + Intergenic
1129823700 15:78620802-78620824 GGCCGGGCTGGCCGCGGACCCGG + Exonic
1132146643 15:99433322-99433344 GGCCAGGCTGCCCCTGTGCCTGG - Intergenic
1133045109 16:3083596-3083618 GGCAGAGCTGCCCGAGGCCCTGG - Intergenic
1134023510 16:10937959-10937981 GGACAGGCTGCCTGAGTGCCAGG - Intronic
1136172796 16:28498512-28498534 GGCCTGGCTCCCAGAGCACCGGG - Exonic
1139390771 16:66605272-66605294 GTCCGAGTTGCCCGAGTCCCCGG - Intronic
1139592544 16:67941634-67941656 GGCGGGGCTTCCTGAGGACCAGG + Intronic
1141660876 16:85440867-85440889 GGCCTGGCTTCCCGAGGACGCGG + Intergenic
1141671094 16:85492038-85492060 GGCCTGGCTGCCCGTGTCCAGGG - Intergenic
1143272123 17:5683529-5683551 GGCTGGGCTGCCTGAGGACTGGG + Intergenic
1144849423 17:18236567-18236589 GTCAGGGCTACCCGAGTTCCTGG - Intronic
1144945038 17:18965485-18965507 GGCCGGGCAGCCAGAGTACCAGG + Intronic
1147263509 17:39222316-39222338 GTCGGGGCTGCCCTGGTACCCGG - Intronic
1148125334 17:45233687-45233709 GGATGTGCTGCTCGAGTACCTGG + Exonic
1148929916 17:51120182-51120204 GGCCTGGCTCCCGGGGTACCTGG + Intronic
1151919079 17:77140645-77140667 GGCTGGGCTTCGCGAGTAGCGGG - Intronic
1152321278 17:79609979-79610001 GGCCGCGCTGCTCGAGGCCCTGG + Intergenic
1152568728 17:81111934-81111956 GGCCTGGCTGCCCGTGGGCCAGG - Intronic
1152739152 17:82011473-82011495 CCCCGGGCTGCCCCAGCACCTGG - Intronic
1152864723 17:82716025-82716047 AGCCCGGCTACCCGAGTCCCGGG - Intergenic
1153542784 18:6173836-6173858 GGCTGGACTGCCCATGTACCAGG + Intronic
1153767230 18:8386054-8386076 GTCCAGGCTGCCCGTGTAACCGG + Intronic
1157550201 18:48576071-48576093 GGCGCCGCTGCCCGAGGACCGGG - Intronic
1158976586 18:62715993-62716015 GGCGGGGCTGCCCCCGTACCCGG + Exonic
1160560058 18:79750606-79750628 GCCCCGGCTTCCCGAGTAGCTGG + Intronic
1160992301 19:1864706-1864728 GGCCGGGAGGCCCGAATACCTGG - Intergenic
1161483751 19:4523875-4523897 GGCCGCGCTGGCCGAGGGCCGGG - Exonic
1161701700 19:5799438-5799460 GCCCGGGCTGCCCTAATCCCAGG - Intergenic
1162100196 19:8334572-8334594 GGCCGCGCAGACCGAGTCCCCGG - Exonic
1162145579 19:8610879-8610901 GGCGGGGCGGCCCGAGTTCCCGG - Intergenic
1163248428 19:16111558-16111580 GGCCGGGCCGCCCGAGTCGGGGG + Intergenic
1165850538 19:38847973-38847995 GGCCTGGCTGCCCCAGTTTCTGG - Intronic
1167514598 19:49915786-49915808 GGCAGGGTTGCCCCAGCACCAGG - Intronic
1167722029 19:51185728-51185750 GGCCGGGATGCCTGGGTCCCTGG + Intergenic
1167779634 19:51590745-51590767 GGCCGGCCAGCCCTTGTACCTGG - Exonic
926083344 2:10006300-10006322 CTCTGGGCTGCCGGAGTACCTGG - Intergenic
926151063 2:10425804-10425826 GGAGGGGCTGCCCCAGGACCAGG + Intronic
927852218 2:26506512-26506534 GGCCCTGCTGCCTGAGTCCCGGG + Intronic
931461932 2:62457150-62457172 GGCTGGGCTGGCCGAGAGCCGGG + Intergenic
931968631 2:67561494-67561516 GGCCGGGCTGGCCCAGTGCCTGG - Intergenic
933959791 2:87400706-87400728 GCCTGGGCCTCCCGAGTACCTGG - Intergenic
934244356 2:90294756-90294778 GTCTGGGCCTCCCGAGTACCTGG - Intergenic
934264494 2:91502673-91502695 GCCTGGGCCTCCCGAGTACCTGG + Intergenic
938017523 2:127879780-127879802 AGCCGGGCTGCTGGAGGACCAGG - Intronic
938460511 2:131493232-131493254 CGCCGGGCCGCCCGAGTCCTGGG - Intergenic
941929280 2:170924462-170924484 GGCTGGGTTGCACCAGTACCTGG + Intergenic
948140484 2:235669524-235669546 AGCCGGGCTGGCCGAGTCCCGGG - Intronic
948140600 2:235669908-235669930 CGCCGCGCCGCCCGAGTGCCGGG - Intronic
948461074 2:238130328-238130350 GGCCCTGCTGCCCGAGCCCCTGG + Exonic
948888777 2:240896916-240896938 GGCGGGGCTGGCAGGGTACCTGG - Intergenic
948894555 2:240922136-240922158 GGCTGGGCTGCCCAGGTAGCTGG + Intronic
1169229585 20:3878723-3878745 GCCCCGGCTTCCCGAGTAGCTGG - Intergenic
1172955440 20:38754701-38754723 GGGCGAGCCTCCCGAGTACCTGG + Intronic
1175429011 20:58889801-58889823 GGCCGGGCAGCCCGAGGCCGGGG + Intronic
1175442359 20:59000941-59000963 GCCTCAGCTGCCCGAGTACCTGG + Intronic
1176088130 20:63307259-63307281 GGCAGAGGTGCCCGAGCACCAGG + Intronic
1179009747 21:37547013-37547035 TGCCGTGCTGCCCGAGTGCACGG + Intergenic
1179506654 21:41845526-41845548 GGCCGGGCTGCCCGAGTACCTGG + Intronic
1181041310 22:20193962-20193984 GGCCGGGCAGCCTGAGGGCCAGG + Intergenic
1184606114 22:45575803-45575825 GGCTGTGCTGCCCGTGTGCCCGG + Intronic
1185049113 22:48544420-48544442 GGACGGGCTGACGGAGTCCCTGG - Intronic
1185127854 22:49021765-49021787 GGCCTGACTGCCAGAGCACCGGG + Intergenic
1185182113 22:49369565-49369587 GGCAAGGCTGCCCGAGTCCGAGG - Intergenic
949908308 3:8877996-8878018 GGCAGGGCTGCCCTAGCACTTGG + Exonic
951709598 3:25574850-25574872 GCCCGAGCTCCCCGAGTTCCAGG - Intronic
951981993 3:28576066-28576088 GGCCGGGGTGCGCGAGGAGCGGG - Intergenic
953879825 3:46685889-46685911 GGCAGGGGTGGCCGAGTACTGGG - Intronic
954028655 3:47802939-47802961 GCCCGGGATGCCCCAGCACCCGG - Exonic
954200856 3:49022290-49022312 GGCCGGGCAGCCCGAGAGGCCGG - Intronic
961449392 3:126995592-126995614 GGCCTGACTGCCTGAGCACCCGG + Intronic
961474020 3:127135897-127135919 GGCAGGGCCGCCCGAGTGCAGGG - Intergenic
968726722 4:2251306-2251328 GGCCTGGGTGCCCCAGTGCCTGG - Intronic
968898436 4:3418786-3418808 GGCCAGGCCTCCCGAGTACCTGG + Intronic
968922582 4:3530368-3530390 GGCCTGCCTGCCATAGTACCAGG + Intronic
969240309 4:5892915-5892937 GGACGACCTGCCCGTGTACCTGG - Exonic
969258671 4:6020386-6020408 GGCCAGGCTGCCTGGGTTCCAGG + Intergenic
969463268 4:7340062-7340084 GGCCTGGCAGCCCCAGCACCTGG - Intronic
975788917 4:77926366-77926388 GGCCTGGCTGCCAGAGTTCTGGG - Intronic
976389736 4:84496455-84496477 GGCCCGGCTGCCACAGTCCCCGG + Intronic
984701250 4:182820000-182820022 GGCCGCACTGTCCGAGTGCCTGG - Intergenic
984954623 4:185033206-185033228 AGCAGGGCTGCACGTGTACCGGG + Intergenic
987708975 5:21485674-21485696 GGCGGGGCTGCCCAAGACCCTGG - Intergenic
988750639 5:34188472-34188494 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
989067735 5:37481083-37481105 GGCGGGGCTGCCCAAGACCCTGG - Intronic
991735780 5:69630397-69630419 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
991738908 5:69651685-69651707 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
991759290 5:69904746-69904768 GGCGGGGCTGCCCAAGACCCTGG - Intergenic
991788046 5:70213376-70213398 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
991790483 5:70231426-70231448 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
991812274 5:70486036-70486058 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
991815233 5:70506513-70506535 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
991818369 5:70527802-70527824 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
991838519 5:70779812-70779834 GGCGGGGCTGCCCAAGACCCTGG - Intergenic
991880493 5:71213740-71213762 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
991882930 5:71231761-71231783 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
994421096 5:99527019-99527041 GGCGGGGCTGCCCAAGACCCTGG - Intergenic
994485945 5:100387295-100387317 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
998037720 5:138930974-138930996 GGCTGGGCTGCCTGAGCCCCAGG - Intronic
1002045100 5:176537084-176537106 AGCCGGGCTGCCCCCGGACCCGG - Exonic
1002317161 5:178350691-178350713 GACCAGGCTGCCCGAGACCCTGG + Intronic
1003551757 6:7107485-7107507 GGCCGGGCTGCCCGAGGGGAAGG - Intergenic
1005548711 6:26894777-26894799 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
1006078714 6:31551515-31551537 GGCAGGGCTGGCAGAGGACCAGG - Intronic
1006313563 6:33277701-33277723 GGGCGGGCTGCGCGAGGCCCGGG + Exonic
1006922446 6:37635636-37635658 TGCAGTGCTGCCCGAGTTCCAGG + Exonic
1007809999 6:44478805-44478827 GGCCAGGCTGGCCGTGTCCCAGG + Intergenic
1009019465 6:57935889-57935911 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
1009307049 6:62103419-62103441 GGCTGGGCTGCCACAGTGCCTGG + Intronic
1010378962 6:75205435-75205457 GGCCCTGCTGCCCCAGAACCCGG + Intronic
1014169832 6:118266697-118266719 GGCAGAGCTGCCCCAGCACCTGG + Intronic
1016041585 6:139437245-139437267 GCCCAGCCTGCCCGAGTAGCTGG + Intergenic
1016611898 6:145999483-145999505 GGCAGAGCTGCCCAAGTCCCTGG - Intergenic
1018930826 6:168239378-168239400 GGCCGGGCTGCCCCAGTGAGAGG + Intergenic
1019163713 6:170085644-170085666 GGCGGAGCTGCCCGAGTGCTGGG + Intergenic
1019232987 6:170584440-170584462 GGCCGGGCTGCCGGGGCCCCAGG - Exonic
1019409375 7:899938-899960 GGCCGGGGTCCCCGAGGACTCGG - Intronic
1019626941 7:2020589-2020611 GCCCGGGCTGCCCTGGTACCCGG + Intronic
1020278270 7:6637419-6637441 GGCCGGGCTGGCCGAGCCACGGG - Exonic
1020834840 7:13136327-13136349 GGTCTGGCTGCCTGAGAACCAGG + Intergenic
1023812945 7:43926498-43926520 GGCCGGGCCGCCCGGGTCCCCGG + Exonic
1023858520 7:44201367-44201389 GGGCGGGGTGGCCGAGTGCCCGG + Intronic
1023913757 7:44573471-44573493 GGCCGGCCTGCACGGGTACAGGG + Intronic
1023940965 7:44768150-44768172 GGCTGGGCTGCCAGAGCTCCAGG - Exonic
1025196753 7:56940220-56940242 AGCCGGGCTGGCTGAGTGCCAGG - Intergenic
1026958955 7:74396633-74396655 GCCTCAGCTGCCCGAGTACCTGG + Intronic
1026964614 7:74431247-74431269 GGCCGGGCTGCCCCAGGGCCAGG + Intergenic
1029559376 7:101292324-101292346 GCCCGGCCTGCCCCAGTCCCAGG - Intergenic
1031520651 7:122761295-122761317 GGCCTGGCTGCCCATGTTCCAGG - Intronic
1031574066 7:123394575-123394597 GCCTTAGCTGCCCGAGTACCTGG + Intergenic
1033342474 7:140502744-140502766 GGCCCCCCTGCCCGAGTAGCTGG - Intergenic
1034468924 7:151245585-151245607 GGCGGGGCTGCCCATGTACGGGG + Exonic
1034522528 7:151632007-151632029 GGCCCGGCCGCCCGAGGACCGGG - Intronic
1037099976 8:15032759-15032781 GTCAGGCCTGCCCTAGTACCAGG + Intronic
1038612428 8:29068923-29068945 GGCCGGGCTGGCAGAGGGCCCGG - Exonic
1039887778 8:41665041-41665063 GCCCTGGCTGCCAGAGGACCGGG - Intronic
1049148604 8:141019980-141020002 CGCAGGGCTGCCCTAGTTCCTGG + Intergenic
1049368485 8:142252310-142252332 GGCCGGGCCCCCCCGGTACCAGG + Intronic
1049628791 8:143639818-143639840 GGCAGGGCAGCCAGAGTCCCTGG - Intronic
1049681252 8:143919437-143919459 TGCCGTGCTGCCGGAGAACCAGG + Exonic
1050457655 9:5849135-5849157 GACTGGGCTTCCCGAGTAGCTGG + Intergenic
1056766696 9:89448515-89448537 AGCCGGGCTGCCCCAGCACCAGG + Intronic
1057361202 9:94374944-94374966 GGCCCGGCTGCCTGAATCCCGGG + Intronic
1060931967 9:127494828-127494850 GGCTGGAGTGCCCGAGTAGCTGG - Intronic
1061212887 9:129203695-129203717 GGCCACTCTGCCCGAGAACCCGG - Intergenic
1061319133 9:129816657-129816679 GCCAGGGCTGCCCGACTCCCAGG + Intronic
1061422185 9:130478414-130478436 GGCAGCCCTGCCCGAGGACCAGG + Intronic
1061727652 9:132590181-132590203 GGCCTGGCTGCCCCCGGACCGGG - Exonic
1062425762 9:136505530-136505552 GTGCGAGCTGCCCGAGTGCCAGG - Exonic
1062592022 9:137278518-137278540 GCCCGGGCTGCCCCAGGGCCAGG - Intronic
1062646834 9:137552020-137552042 GGCGGGGCTGGCCGGGTTCCCGG + Intronic
1186881878 X:13874593-13874615 GCCCTGGCTTCCCAAGTACCTGG - Intronic
1186898270 X:14027232-14027254 GGCAGGGCTGCCCAAGTAGGTGG - Intronic
1189321475 X:40090151-40090173 GGCCGGGAAGCCCGAGTGTCCGG - Intronic
1195179140 X:102339757-102339779 GGCCGGGCTGCAACAGTGCCTGG + Intergenic
1197800204 X:130340040-130340062 GGCCGGGCTGGCCTGGTTCCCGG + Intronic
1198724184 X:139659171-139659193 TGCCGGGCCTCCCGAGTAGCTGG - Intronic