ID: 1179506654

View in Genome Browser
Species Human (GRCh38)
Location 21:41845526-41845548
Sequence GGCCGGGCTGCCCGAGTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179506647_1179506654 2 Left 1179506647 21:41845501-41845523 CCCCTCCGGTAATCTGGGTGGCA No data
Right 1179506654 21:41845526-41845548 GGCCGGGCTGCCCGAGTACCTGG No data
1179506651_1179506654 -3 Left 1179506651 21:41845506-41845528 CCGGTAATCTGGGTGGCAGAGGC No data
Right 1179506654 21:41845526-41845548 GGCCGGGCTGCCCGAGTACCTGG No data
1179506640_1179506654 28 Left 1179506640 21:41845475-41845497 CCGTCACCTGGAAGGAATGCTCA No data
Right 1179506654 21:41845526-41845548 GGCCGGGCTGCCCGAGTACCTGG No data
1179506642_1179506654 22 Left 1179506642 21:41845481-41845503 CCTGGAAGGAATGCTCAGGACCC No data
Right 1179506654 21:41845526-41845548 GGCCGGGCTGCCCGAGTACCTGG No data
1179506648_1179506654 1 Left 1179506648 21:41845502-41845524 CCCTCCGGTAATCTGGGTGGCAG No data
Right 1179506654 21:41845526-41845548 GGCCGGGCTGCCCGAGTACCTGG No data
1179506649_1179506654 0 Left 1179506649 21:41845503-41845525 CCTCCGGTAATCTGGGTGGCAGA No data
Right 1179506654 21:41845526-41845548 GGCCGGGCTGCCCGAGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179506654 Original CRISPR GGCCGGGCTGCCCGAGTACC TGG Intronic