ID: 1179510403

View in Genome Browser
Species Human (GRCh38)
Location 21:41869200-41869222
Sequence TCACAAGCATAGTCTGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179510403_1179510405 14 Left 1179510403 21:41869200-41869222 CCTTTCACAGACTATGCTTGTGA 0: 1
1: 0
2: 1
3: 10
4: 161
Right 1179510405 21:41869237-41869259 ACCTCTCTTCACCAAGCCCAAGG 0: 1
1: 0
2: 0
3: 27
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179510403 Original CRISPR TCACAAGCATAGTCTGTGAA AGG (reversed) Intronic
900475432 1:2874252-2874274 GCAGAAGCATAGTCTGTGCCAGG + Intergenic
901561080 1:10071289-10071311 TTACAAGCATAGGCTGGGCATGG + Intronic
901892606 1:12280395-12280417 GCAAAAGCTTAGTCTGAGAAGGG - Intronic
904886489 1:33742407-33742429 TCACAAGCAGCCTCTGGGAAAGG + Intronic
905473904 1:38212526-38212548 TCAGAAGCATGCTCTGAGAATGG + Intergenic
906847179 1:49205723-49205745 TCAGAAACATAATTTGTGAAAGG - Intronic
909250095 1:73343190-73343212 TCACAAGAATAGCATGGGAAAGG - Intergenic
909312099 1:74164693-74164715 TCAAAAGCATACTTTGTAAAAGG - Intronic
911491860 1:98579188-98579210 TAATAAGCATAGTATGTGATAGG + Intergenic
911722443 1:101206060-101206082 TGACTGGTATAGTCTGTGAAAGG + Intergenic
912330744 1:108818090-108818112 TTATTTGCATAGTCTGTGAAGGG + Intronic
919019587 1:192087256-192087278 TCATAAACATATTCTGTGTAAGG + Intergenic
920353524 1:205353449-205353471 GCACAAGCATTTTCTGTAAAGGG - Intronic
920528098 1:206683678-206683700 CCACAAGCATCTTCTGGGAAAGG + Intronic
922869069 1:228885423-228885445 CCTCAAGCATAGTCTTTGAATGG + Intergenic
923284042 1:232474060-232474082 ATACAATCAGAGTCTGTGAATGG + Intronic
923919513 1:238547479-238547501 TCACAAGAATAGCATGGGAAAGG + Intergenic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1064159214 10:12929420-12929442 TCACAAGCTGCTTCTGTGAAAGG - Intronic
1064468512 10:15611277-15611299 TCACATGCAAAATTTGTGAATGG - Intronic
1065402385 10:25320209-25320231 TCACAAGTGTAGTGTGTGAAGGG - Intronic
1070519028 10:77235812-77235834 TTACAAAAATAGTCAGTGAAGGG - Intronic
1071442703 10:85717492-85717514 TCACAAGAATAGCATGGGAAAGG + Intronic
1074001159 10:109374546-109374568 TCAGAAGCAGAGTCTATGCATGG - Intergenic
1075918283 10:126188615-126188637 TCACAGGCATCTTCTGTGAGTGG + Intronic
1080117060 11:28632966-28632988 ACAGAAGCATATTCTGTGAAGGG - Intergenic
1081634019 11:44708832-44708854 TCAAAAGCATGTTCTGTGCAAGG - Intergenic
1083403959 11:62443967-62443989 TCTCAGTCATGGTCTGTGAACGG + Intronic
1084103851 11:66967830-66967852 ACAGAAGCATAGTCAGTGATGGG - Intergenic
1089301191 11:117499637-117499659 TCACAAGCAAGGTATGGGAACGG + Intronic
1090763377 11:129856158-129856180 TAGCAAGCAGAGCCTGTGAAAGG - Intronic
1092277460 12:7072537-7072559 TTAGAAACATGGTCTGTGAAAGG + Intergenic
1092979686 12:13782000-13782022 TCACACACATACTCTGTGATGGG - Intronic
1095035040 12:37354002-37354024 TCACAAGCATATTCTACAAAAGG + Intergenic
1095035573 12:37364691-37364713 CCACAAGCATAGTCTACAAAAGG + Intergenic
1095037345 12:37401792-37401814 CCACAAGCATATTCTGCAAAAGG - Intergenic
1095037505 12:37404686-37404708 CCACAAGCATATTCTGCAAAAGG - Intergenic
1095037598 12:37406723-37406745 CCACAAGCATATTCTGCAAAAGG - Intergenic
1097593126 12:61595624-61595646 TAAGAAGCATAATCTATGAAAGG + Intergenic
1099421001 12:82460394-82460416 CCAAGAGCATAGTATGTGAATGG + Intronic
1102471966 12:113164273-113164295 TCTCAAAGATAGTCTGTGGAGGG + Exonic
1102486851 12:113264369-113264391 TCACAAACTTATTCTGGGAAAGG - Intronic
1102551965 12:113697875-113697897 TTAGAAGCAAAGCCTGTGAAGGG - Intergenic
1104155779 12:126130349-126130371 TAATAAGCATAGTCTCTGATAGG + Intergenic
1105093570 13:16331366-16331388 TCTCAAACCTACTCTGTGAAAGG - Intergenic
1105106218 13:16538248-16538270 TTTCAAACATACTCTGTGAAAGG - Intergenic
1105116993 13:16714075-16714097 TTTCAAACCTAGTCTGTGAAAGG - Intergenic
1105126567 13:16870651-16870673 TCTCAAACCTACTCTGTGAAAGG - Intergenic
1105129160 13:16912940-16912962 TCTCAAACCTACTCTGTGAAAGG - Intergenic
1105143929 13:17153918-17153940 TTTCAAGCCTACTCTGTGAAAGG - Intergenic
1105146266 13:17191964-17191986 TTTCAAACCTAGTCTGTGAAAGG - Intergenic
1105150937 13:17268386-17268408 TTACAAACCTACTCTGTGAAAGG - Intergenic
1105155608 13:17344812-17344834 TTTCAAACATACTCTGTGAAAGG - Intergenic
1110814691 13:79848414-79848436 TTGCAAGCACAGTCTGAGAAAGG + Intergenic
1114936486 14:27545013-27545035 TCACAATTTTAGTCTGTGATAGG - Intergenic
1115213919 14:30996091-30996113 TCAGAATCAGTGTCTGTGAAAGG - Intronic
1115947162 14:38675205-38675227 TCACAAGCATTGTCTGAGGCAGG + Intergenic
1115990270 14:39143372-39143394 TCACAAGAATAGCATGGGAAAGG + Intergenic
1117584735 14:57189372-57189394 ACACAAGCATAGTCTGCTGAAGG - Intergenic
1117981544 14:61346955-61346977 TCACAAGCATTGTTTAGGAATGG + Intronic
1118864970 14:69695585-69695607 TCACACCCATAATCTGTCAAGGG - Intronic
1126233020 15:46349559-46349581 ACAGAAGCAGAGTCTGAGAATGG - Intergenic
1131964301 15:97823668-97823690 TCAAAAGCTTATTCTTTGAAAGG - Intergenic
1140648425 16:77060529-77060551 TCACAAAAATAGTATGTGATAGG + Intergenic
1141318240 16:82981844-82981866 TGAGAAGCATACACTGTGAATGG - Intronic
1148255666 17:46129640-46129662 TAGCAAGCAAAGTCTGTTAAAGG + Intronic
1149085235 17:52708960-52708982 TCATAAGCAATGTCTATGAAAGG + Intergenic
1150310266 17:64122543-64122565 TCAAAAGTATATTCTTTGAAGGG - Intronic
1152272780 17:79334776-79334798 TCACAAGCATCCTCTGAGATGGG - Intronic
1152654002 17:81511614-81511636 TCTCAAACATAATCTGAGAAGGG + Exonic
1155691834 18:28634259-28634281 ACAGAACCAAAGTCTGTGAAAGG + Intergenic
1155951951 18:31923120-31923142 ATCCAAGCATAGTCTTTGAATGG - Intronic
1157428882 18:47606977-47606999 GCACAATTTTAGTCTGTGAAAGG - Intergenic
1164227621 19:23259828-23259850 TCACTAGCAGACTCTGTCAATGG + Intergenic
1164545099 19:29154004-29154026 ACACCAGCATAATCAGTGAACGG - Intergenic
1166175898 19:41069409-41069431 TCTCAAGCATACCCTGAGAATGG - Intergenic
925211917 2:2056672-2056694 TCACAAGCAGCATCTGTGACAGG - Intronic
927003571 2:18824743-18824765 TCACAGGCTGAGTCTGAGAATGG - Intergenic
931476009 2:62588239-62588261 TTTCTAGCATATTCTGTGAAAGG + Intergenic
931526063 2:63155716-63155738 TGACAAACATTTTCTGTGAAGGG - Intronic
937161260 2:119764064-119764086 TCACAAGCATTATGTCTGAAAGG + Intronic
939572785 2:143860860-143860882 CCACAAGCAATGACTGTGAATGG + Intergenic
940472688 2:154118848-154118870 TCAAAAACATAAACTGTGAAGGG - Intronic
940822537 2:158372895-158372917 TCACAAGCATTGTCCGTTCAGGG - Intronic
946798619 2:223384899-223384921 TAATAAGCATAGTATGTGATAGG - Intergenic
947121127 2:226816349-226816371 TAACAAGAATAGTATGGGAATGG + Intergenic
947709417 2:232303156-232303178 ACACAACCAAAGGCTGTGAACGG - Intronic
1169912433 20:10657958-10657980 TTAGAAGCAGAGTCTGAGAAGGG + Intronic
1170471468 20:16672404-16672426 TTCCAAGCCTAGTCTGTGGAGGG + Intergenic
1172822789 20:37752979-37753001 TCACAAGCAGACTCTGGGCATGG - Intronic
1173311508 20:41900232-41900254 TCCCAAGCATAGTCTTCAAATGG - Intergenic
1179003672 21:37488840-37488862 TCACAATCATGGTCTGTGGATGG - Intronic
1179510403 21:41869200-41869222 TCACAAGCATAGTCTGTGAAAGG - Intronic
1182807430 22:33086073-33086095 TCCGAAGCATATTCTGTGAAAGG - Intergenic
1182907704 22:33952376-33952398 TGAGAAGGATACTCTGTGAAAGG - Intergenic
949942585 3:9166108-9166130 TCACAGGCAAAGGCTGTGATGGG - Intronic
950130734 3:10544637-10544659 GCAGAAGCATCGTTTGTGAAGGG - Intronic
952521349 3:34161063-34161085 TTACATGCATAGTCTGTGTTTGG - Intergenic
953964346 3:47291451-47291473 TAACAAGCATTTTCTGTAAAGGG + Intronic
955426269 3:58794651-58794673 ACAAAAGCAGAGTCTGTGAGTGG + Intronic
955922087 3:63967893-63967915 GCACAACCAAATTCTGTGAATGG + Intronic
956974804 3:74567068-74567090 GCACAAGCACAGTCTGTACAAGG + Intergenic
957737147 3:84216778-84216800 TCACAAGAATAGCATGGGAAAGG + Intergenic
958998871 3:100938795-100938817 TCAGAAGGAGAGTCTGTGTAAGG + Intronic
959080411 3:101795134-101795156 TCAGAAGCATAGTATGGAAAGGG - Intronic
960293214 3:115912181-115912203 TCAAAAGCATGGTCCGTAAAAGG - Intronic
962916231 3:139906308-139906330 TCTCAAGCCTAGGCTCTGAAAGG - Intergenic
966080039 3:175989477-175989499 TCACAAGCCTGGTCTGGGAAGGG - Intergenic
973040628 4:45465485-45465507 TTAAAAGCACAGTCTTTGAAAGG - Intergenic
975463616 4:74684176-74684198 CCAAAAGCATAATCTGTCAAAGG - Intergenic
977335033 4:95687095-95687117 CCACAAGCACAGGCTGAGAAAGG - Intergenic
977523468 4:98115328-98115350 TCACAAGCAAAGTTTGTGATTGG - Intronic
980152519 4:129064356-129064378 TCACAAGCATGGTCCATAAAAGG - Intronic
983319528 4:166178245-166178267 TCACAAACATTATATGTGAATGG + Intergenic
983523846 4:168739635-168739657 TCACATGCATAGAATGTGTAAGG - Intronic
984955573 4:185042422-185042444 TCACTACCATATTCTTTGAAGGG - Intergenic
984979547 4:185266272-185266294 TGACAAGCTTAGTCTGCCAAAGG - Intronic
987854361 5:23400230-23400252 TCACAATCATAGTAGGTGAAAGG + Intergenic
988809303 5:34768632-34768654 TCATAAGGATAGTCTGGAAATGG - Intronic
990783531 5:59394282-59394304 TCACTGTCATAGTTTGTGAAAGG + Intronic
994018194 5:94992856-94992878 TCAGAAGCATACTCTGAGACAGG - Intronic
994361738 5:98858620-98858642 ACAAAAGTATAGTCTGAGAAAGG - Intronic
995158167 5:108940954-108940976 TCCCCAGCCTAGTCTTTGAAGGG - Intronic
995235107 5:109820054-109820076 TCACATGTATAGTCTGTGGGTGG + Intronic
996814647 5:127561569-127561591 TCACAAGCATACTCAGTGTGGGG - Intergenic
997824009 5:137090435-137090457 ACACAAGCATAGACTGTTCAGGG + Intronic
998638557 5:143984113-143984135 TCACCAGCTTAATCTGTGAAAGG - Intergenic
998692899 5:144606814-144606836 TGATAAGCATAGTATCTGAAAGG + Intergenic
998749643 5:145305568-145305590 TCACCAGCATAGTCTATCAGTGG + Intergenic
1004681798 6:17903101-17903123 TCACAAGCATAGAAATTGAACGG + Intronic
1004853690 6:19727064-19727086 TCACAAGCATACTGTCTAAATGG + Intergenic
1006742390 6:36318736-36318758 TGACAAGCATCATCTCTGAAGGG + Intronic
1014069751 6:117167849-117167871 ACAGAAGCATGGTCTGAGAAAGG + Intergenic
1014847744 6:126299509-126299531 TGATAAGCACAGTCTGTAAAGGG - Intergenic
1016133730 6:140511562-140511584 TTACAAGCATAATCTATAAAAGG - Intergenic
1016554024 6:145314940-145314962 TCACAAGAATAGCATGGGAAAGG + Intergenic
1017141007 6:151189957-151189979 TTAAAAGTAGAGTCTGTGAAAGG - Intergenic
1021358136 7:19679350-19679372 TCACAAGGATAGAGTGTGAGAGG - Intergenic
1023780287 7:43648781-43648803 AAACAAGCCTTGTCTGTGAAAGG + Exonic
1025315871 7:58027763-58027785 TCACAAGCAGATTCTGCAAAAGG - Intergenic
1031170163 7:118283356-118283378 TCACAAGAATAGCATGCGAAAGG - Intergenic
1031550658 7:123108083-123108105 TAATAAGCATAGTATCTGAATGG + Intergenic
1031722622 7:125194816-125194838 TCACAAGCATAGTGTCTGAAAGG + Intergenic
1032260726 7:130334366-130334388 TCAAAAACATTGTCTGTAAATGG + Intergenic
1032892251 7:136209878-136209900 CCAAAAGCATAGTCTATAAAAGG + Intergenic
1035039208 7:155915302-155915324 TCAAAAGGAAGGTCTGTGAAGGG + Intergenic
1037445873 8:18965405-18965427 TTACCAGCACAGCCTGTGAATGG - Intronic
1038913193 8:31990331-31990353 TCAAAAGCATATCCTGTGATTGG - Intronic
1039319694 8:36414553-36414575 TCACAAACATTTTCTGTAAAGGG - Intergenic
1040954633 8:52967345-52967367 TAATAAGCATAGTCCCTGAAAGG + Intergenic
1041016553 8:53597457-53597479 TAACAAGCAAAGTCAGGGAAAGG - Intergenic
1041598333 8:59683878-59683900 TTAGAGGCATAGTTTGTGAATGG - Intergenic
1042464670 8:69114444-69114466 TCACAAGCACATTATGTGTAAGG + Intergenic
1042881776 8:73500506-73500528 AAACAAGCATAGTTTGTTAAAGG - Intronic
1044178556 8:89160440-89160462 GCACAAGCATATTCTGGGAGAGG - Intergenic
1045730449 8:105233019-105233041 TCAGAAGCACAATCTATGAAAGG - Intronic
1045786435 8:105926627-105926649 TCACAAGAATAGCATGGGAAAGG - Intergenic
1045864092 8:106845058-106845080 TCAGAAGCAAAGTCTTTGAAGGG + Intergenic
1046024667 8:108707805-108707827 CCAAAAGCACAGGCTGTGAAAGG + Intronic
1047601993 8:126434843-126434865 TCACAAGGAAAGTGTGAGAAAGG + Intergenic
1055344549 9:75321485-75321507 CCACAACCATAGTTGGTGAATGG - Intergenic
1058172504 9:101699669-101699691 GCTCATGCATAGTCTGGGAAGGG - Intronic
1060224249 9:121781719-121781741 TCACTAGGACAGGCTGTGAAAGG + Intronic
1062433075 9:136534704-136534726 TCGCAATCACAGTCTGTGAGTGG - Intronic
1187406280 X:19007171-19007193 TTACAAGCATAGTTTGTACAAGG + Intronic
1188001093 X:24982751-24982773 TCACAAGCAAAGCCAGTGGAGGG - Intronic
1188137408 X:26505923-26505945 CCACCAGCATACTCTGTGGATGG + Intergenic
1191586421 X:62832112-62832134 CCAAAAGCACAGTCTCTGAAAGG + Intergenic
1192670779 X:73138497-73138519 GCAGAAGCATTGTTTGTGAAAGG - Intergenic
1195529764 X:105940635-105940657 TCACAACCATCCACTGTGAAAGG + Intronic
1199575604 X:149311239-149311261 GCACAAGGAAAGTCTTTGAATGG + Intergenic
1200319081 X:155166406-155166428 TCAAAAACACAGTCTATGAATGG - Intergenic
1201693666 Y:16799124-16799146 TCAGAGGCACAGTGTGTGAACGG + Intergenic