ID: 1179511479

View in Genome Browser
Species Human (GRCh38)
Location 21:41876894-41876916
Sequence CTGTGTGTGGGGAATGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 562
Summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 504}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179511479_1179511489 25 Left 1179511479 21:41876894-41876916 CCAGCTCCATTCCCCACACACAG 0: 1
1: 0
2: 6
3: 51
4: 504
Right 1179511489 21:41876942-41876964 CACTGCTCAAAGCCCCTCAGTGG 0: 1
1: 0
2: 6
3: 50
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179511479 Original CRISPR CTGTGTGTGGGGAATGGAGC TGG (reversed) Intronic
900035297 1:402694-402716 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
900056918 1:638447-638469 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
900341484 1:2191379-2191401 CTGCGTGTGGGCAGGGGAGCAGG + Intronic
900998181 1:6134079-6134101 CTCTCTGTGGGGTGTGGAGCCGG + Intronic
901079717 1:6577069-6577091 TGGTGAGTGGGCAATGGAGCAGG + Exonic
901089110 1:6629671-6629693 CTGGGTGTGGGGCCTGAAGCAGG - Intronic
901161201 1:7177687-7177709 CTGTGTGTGGGGAGGGGTACTGG - Intronic
901436545 1:9250406-9250428 GTGTGTGTGGGGTAGGGAGTGGG - Intronic
901460050 1:9385990-9386012 CTGTGCCTGGGGCCTGGAGCAGG - Intergenic
901637583 1:10677457-10677479 CTGTGTGTGGGGCATGGCAGGGG + Intronic
902373015 1:16017223-16017245 CTGTGAGCGAGGCATGGAGCAGG + Intronic
902968908 1:20032505-20032527 TGGTGTGTGGGGAAAGGAGGTGG + Intronic
904295340 1:29516643-29516665 CTGTGTGTTGGGAGTGAAGTGGG + Intergenic
904435431 1:30491914-30491936 CTGGGTCTGGGGAAGGAAGCTGG - Intergenic
905290829 1:36920737-36920759 GTGGGTGTGGGGAATGGCACTGG - Intronic
906057086 1:42925697-42925719 GTGTGTGTGGGGAGGGGTGCAGG + Exonic
906078315 1:43068133-43068155 CTGCGACTGGGGAAGGGAGCAGG + Intergenic
906688807 1:47779340-47779362 GTGTGTGTGGGGAGAGGGGCTGG + Intronic
906948155 1:50313301-50313323 GTGAGGGTGGGGACTGGAGCTGG - Intergenic
907705835 1:56831677-56831699 CTGTGTATGGGGGGTGGAGGCGG - Intergenic
908250729 1:62263656-62263678 CTGTGTGAGGGGGAAGGAGAGGG - Intronic
908571558 1:65416709-65416731 CTGTAGGTGGGTATTGGAGCTGG + Intergenic
908797136 1:67841708-67841730 CTGTGTGTAGGGGTTGGGGCAGG + Intergenic
908819180 1:68065920-68065942 ATGGGGGTGGGGAAGGGAGCAGG - Intergenic
909427157 1:75538900-75538922 CTGTGACTGGGGCATGGAGGGGG - Intronic
910340999 1:86187309-86187331 GTGTGTGTGTGTAAGGGAGCTGG - Intergenic
910468268 1:87523608-87523630 CTGTGTGTGGGGAATTTTCCTGG + Intergenic
910526901 1:88189946-88189968 CAGTGTGTGGGAAATGAAGGAGG - Intergenic
910535754 1:88295697-88295719 CTGCGTCAGGGGAAAGGAGCAGG - Intergenic
910737673 1:90479467-90479489 GTGTGTGTGTGGATTGGAGGGGG - Intergenic
910925970 1:92398592-92398614 CTGAGGGTGGGGCAAGGAGCAGG + Exonic
911311109 1:96293091-96293113 GTGTGTGTGGGCAGTGGAGAGGG + Intergenic
911583613 1:99664157-99664179 GGGTGTGTGTGGCATGGAGCAGG + Intronic
912137479 1:106679661-106679683 CTGTGTTTGGGGAAAGGATTTGG - Intergenic
912507064 1:110163674-110163696 CTGTGTGTGAGGACTGGGGCAGG - Intronic
912552417 1:110492714-110492736 CTGTGGGGGTGAAATGGAGCAGG + Intergenic
912671492 1:111632085-111632107 CAGTCTGTGGGGAGTGGGGCAGG + Intronic
912727250 1:112069195-112069217 ATGTGTGTGGGGAAGTGAGGAGG - Intergenic
912764463 1:112396219-112396241 CTGTGGATGGGGAGTGGAGGCGG + Exonic
913376275 1:118156291-118156313 CAGTGAATGGGAAATGGAGCAGG + Intronic
913687140 1:121243107-121243129 CTGTGTGTTGGGGATGGGGGAGG + Intronic
913973147 1:143431922-143431944 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
914038998 1:144030745-144030767 CTGTGTGTTGGGGATGGGGGAGG + Intergenic
914067531 1:144257529-144257551 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
914111622 1:144708825-144708847 CTGTCTCTGGGGAGAGGAGCAGG + Intergenic
914150455 1:145037182-145037204 CTGTGTGTTGGGGATGGGGGAGG - Intronic
915287349 1:154861504-154861526 GAGTGTGTAGGGAATAGAGCAGG - Intronic
915440575 1:155942966-155942988 CTGGGTGTGGTGAATGGGGGAGG + Intergenic
915977937 1:160402660-160402682 CTGTGTGTCGGGAAAGGGCCAGG + Intronic
918039960 1:180907984-180908006 GTGTGTGTGTGGAGTGAAGCAGG + Intergenic
918321576 1:183370064-183370086 CCGTGTGTTGGGAATGCAGGAGG - Intronic
918558758 1:185838405-185838427 CTTTGAGTGGGGCATGGAGGTGG - Intronic
919791333 1:201292690-201292712 CTGTCTGTGGGGAAGAGAGTTGG - Intronic
920247486 1:204599503-204599525 GTGTGTGTGTGTGATGGAGCAGG + Intergenic
920444606 1:206006420-206006442 AGATGTGTGGTGAATGGAGCAGG + Intergenic
920474468 1:206261628-206261650 CTGTGTGTTGGGGATGGGGGAGG + Intronic
920562095 1:206946241-206946263 CTGGGAGTTGGGAATGGAGGGGG + Intronic
922222398 1:223618609-223618631 CTGGGTGTGGGGAGGGGAGTGGG + Intronic
922257827 1:223908254-223908276 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
923050967 1:230391147-230391169 CTGAGTGTGGGGGGTGGGGCGGG + Intronic
923202262 1:231724168-231724190 CTCTGTGTGGGGAAGGGGGCAGG + Intronic
923386291 1:233468016-233468038 TTGTGTGTGGGGAAGGGATGGGG + Intergenic
924339025 1:243011033-243011055 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
924592521 1:245417097-245417119 CTGTGTCTGAAAAATGGAGCAGG + Intronic
924786001 1:247200466-247200488 CTGTGTGAGGTAAATAGAGCAGG - Intergenic
924845392 1:247763695-247763717 CAGTCTGTGGGGGATGCAGCTGG + Intergenic
1062841955 10:679207-679229 CTGGGTGTGGGGAGTAGAGATGG - Intronic
1063649390 10:7918197-7918219 CTGGGAGTGGGGAAAGGAGAAGG + Intronic
1063979911 10:11444727-11444749 GTGAGTGTGGGGGAGGGAGCCGG - Intergenic
1064305559 10:14162923-14162945 GTGTGTGGAAGGAATGGAGCAGG - Intronic
1064635146 10:17357673-17357695 CTGTGTGAGGACACTGGAGCAGG - Intronic
1067785667 10:49244150-49244172 ATGTGTGTGGGGGTGGGAGCGGG + Intergenic
1067942435 10:50668120-50668142 CTGGGGGTCGGGAATGGAGTGGG - Intergenic
1068185763 10:53583915-53583937 GTGTGTGTGCTGAATGGAGGAGG + Intergenic
1068300736 10:55135431-55135453 TTGTGTTTAGGGAGTGGAGCTGG - Intronic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1070863679 10:79693078-79693100 CTGGGGGTCGGGAATGGAGTGGG - Intergenic
1071381095 10:85061024-85061046 ATGTGTGTTGTGAATGGAGGAGG - Intergenic
1072058841 10:91788434-91788456 CTGTGCCTGGGGAAAGGAGAGGG + Intergenic
1072806669 10:98427719-98427741 CTGTGTGCTGGGAATTGAGGTGG + Intronic
1074122080 10:110500085-110500107 CTGTCTCTGGGGAGTGGAACTGG - Intronic
1074132653 10:110595307-110595329 CTGGGTGGGGAGAAGGGAGCAGG - Intronic
1074719321 10:116250896-116250918 CTGTTTCTGGGGAATGCACCAGG + Intronic
1075065905 10:119288696-119288718 GTGTGTGTGGGGAGTGGGGGTGG + Intronic
1075626196 10:123966007-123966029 GTGGGTGTGGGGCATGGAGAGGG - Intergenic
1075863312 10:125696322-125696344 ATGTGGGTGGGGAAAGGAGAGGG + Intergenic
1076199028 10:128543361-128543383 CTGTGTGCTGGGAACGCAGCTGG - Intergenic
1076824024 10:132958253-132958275 CTGTGTCTGGGGGCTGCAGCAGG + Intergenic
1076856925 10:133121346-133121368 CTGTGTGTGTGGAATGTGCCAGG + Intronic
1077009120 11:372396-372418 CTGTGTCTGGGGGCTGCAGCAGG + Intronic
1077172327 11:1172678-1172700 GGGGATGTGGGGAATGGAGCTGG - Intronic
1077376626 11:2208290-2208312 CAGTGAGTGGGGAAAGGTGCAGG + Intergenic
1078469416 11:11575202-11575224 CTGTGGGTGGGGTGTGGGGCTGG + Intronic
1079117196 11:17647401-17647423 CTGTGAGTGGGGCATAGTGCTGG - Intergenic
1079668187 11:23134398-23134420 CTGTTTGTGGGGCACGGAGAAGG - Intergenic
1081618673 11:44605487-44605509 CTGAGTGTGGGGGATGGACAAGG + Intronic
1082894609 11:58176735-58176757 ATGTGTGTGAGGAATGTAGGAGG + Intronic
1082911715 11:58384471-58384493 CTGTTTGTAGGTAATGGGGCTGG - Intergenic
1083171837 11:60927805-60927827 CAGGGTGTGTGGCATGGAGCCGG - Exonic
1083691151 11:64409662-64409684 TTGTGAGTGGGGAAGGGAGTGGG + Intergenic
1083758127 11:64802184-64802206 CCGTGTGTGGGAAAAGCAGCAGG + Intronic
1083876908 11:65529079-65529101 CCGTGTGTGGGGAAGACAGCGGG + Intronic
1083944275 11:65915475-65915497 CTGGCTGTGGAGAACGGAGCGGG + Intergenic
1084029677 11:66473934-66473956 ATAGGGGTGGGGAATGGAGCGGG - Intronic
1084173600 11:67412121-67412143 CAGTGTGTGGGGACTGAAGCTGG + Intronic
1084413829 11:69019046-69019068 CCCTGTGTGGGTACTGGAGCTGG + Intergenic
1084935703 11:72585505-72585527 CTGTGTGTGGGCATGGGGGCTGG - Intronic
1085745163 11:79108919-79108941 GTTTGTGTGGGGAATGGGGAAGG - Intronic
1085991742 11:81856177-81856199 CTGTGTGTGGGAATGGGAACAGG - Intergenic
1087042443 11:93815098-93815120 CTATGTGTGTGAGATGGAGCCGG + Intergenic
1087500331 11:98944026-98944048 ATGTTGGTGGGGAATGGAACAGG + Intergenic
1089636240 11:119814281-119814303 CTGTGGGTGAGGAATGCAGCAGG - Intergenic
1089805843 11:121088086-121088108 GTGTGTGTGGGGAATGAAGTTGG + Exonic
1089897871 11:121950381-121950403 CTGTGTGTGGGGTATTGTGTTGG + Intergenic
1090429149 11:126631522-126631544 CTGTGTGTTGGAAATTGAGATGG + Intronic
1090560413 11:127926394-127926416 GTGTGTGTAGGGGATGGATCAGG - Intergenic
1090739064 11:129640729-129640751 CTGGGAGTGGGTACTGGAGCAGG + Intergenic
1090761598 11:129841516-129841538 CTCTGTGTGGGGGTTGGAGAAGG - Intronic
1090803554 11:130189003-130189025 CAGTGTGTGGGGCAGGAAGCGGG + Intronic
1090972532 11:131655623-131655645 TTCTGAGTGGGGAATGGACCCGG - Intronic
1091016950 11:132059852-132059874 GTGTGGCTGAGGAATGGAGCTGG - Intronic
1091057389 11:132431517-132431539 CTCTGTGTGGGGAAGGCAACCGG + Intronic
1091820222 12:3470577-3470599 CTGGGTGGGGGGCATGGGGCAGG + Intronic
1092046630 12:5435536-5435558 TTGTGTATTGGGAAGGGAGCTGG + Intronic
1092774377 12:11929584-11929606 CTATGTGTGGTGTCTGGAGCTGG - Intergenic
1092818727 12:12333573-12333595 GTGGGTGAGGCGAATGGAGCAGG - Intronic
1093000298 12:13988628-13988650 CTGTCAGTGGGGAAGGGTGCAGG - Intergenic
1093880650 12:24400731-24400753 GTGTGTGTGGAGCATGGAGGGGG - Intergenic
1094286442 12:28799371-28799393 ATGTGTCTTGGGAGTGGAGCGGG + Intergenic
1096170476 12:49464889-49464911 CTGTGGCTGGGGTAGGGAGCAGG - Intronic
1096514450 12:52148358-52148380 CTGTGTGTGTGGGATGGGGCAGG + Intergenic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097264995 12:57739357-57739379 GTGTGAGTGGGAAAGGGAGCTGG - Intronic
1099440962 12:82699189-82699211 CGGTGTATGGGGGATGGAGCAGG - Intronic
1100385106 12:94098741-94098763 TGGTGTGTTGGGGATGGAGCTGG + Intergenic
1100959448 12:99946172-99946194 CTCTGAGTGGGGAAAGGAGGAGG + Intronic
1101132871 12:101707284-101707306 CTTTGTGGGTGGAATGGAGCTGG + Intronic
1101536182 12:105618820-105618842 CTGTGTGGGGGGACAGGAGTGGG - Intergenic
1102753149 12:115313808-115313830 CAGTGAGTGGGGATGGGAGCTGG - Intergenic
1102923072 12:116807590-116807612 GTGCGAGTGGGGAATGGTGCGGG - Intronic
1103791720 12:123476884-123476906 CTGTGTGTGGGGAACGAAGAAGG + Intronic
1103941977 12:124506166-124506188 TTGTGTTTGGTGAATGGAACTGG - Intronic
1104476270 12:129073009-129073031 CTGTGGGTGGGGGAGGGAGAGGG - Exonic
1104574801 12:129957312-129957334 CTGTGTGTAGGGGATGTAGCTGG + Intergenic
1104963308 12:132498240-132498262 CTGTGTCGGGGGCATGGGGCCGG + Intronic
1105435897 13:20378161-20378183 CAGTGAGTGGGGAAGGGAGGAGG - Intergenic
1105443948 13:20436669-20436691 CAGTGAGTGGGGAAAGGCGCTGG - Intronic
1105518927 13:21114246-21114268 CTGTGTGCAGGCGATGGAGCTGG + Intergenic
1105958387 13:25305636-25305658 CACTGTGAGGGGAATGGAGGTGG - Intronic
1106621419 13:31374399-31374421 CTCTGTGAGGGGAATGGAGCAGG - Intergenic
1108003544 13:45925839-45925861 CTGTGTGTGTGGTAAGGGGCTGG + Intergenic
1108147473 13:47494754-47494776 CTGTGTGAGGAGAATGAAACAGG + Intergenic
1109067704 13:57720759-57720781 CTGTGTGTGGTTTATGGTGCAGG + Intronic
1111112622 13:83734191-83734213 CTGTGGGTGGAGATTGGAGAAGG + Intergenic
1112462915 13:99618706-99618728 CTGGGTGGGGGGAAGGGAACAGG - Intronic
1113955573 13:114098565-114098587 GTGTGTGTGTGGAATGGGGCTGG + Intronic
1114328380 14:21612418-21612440 CTGCCTGAGGGGAGTGGAGCCGG - Intergenic
1115127983 14:30019046-30019068 CAGACTGTGGGGAATGGAGGAGG - Intronic
1115510026 14:34129788-34129810 CTATGGGTGGGGAAGGGAGGTGG + Intronic
1116128049 14:40814395-40814417 CTGTGTATGAGGAACAGAGCAGG - Intergenic
1116718251 14:48455831-48455853 CTGTGTGTGGGGATGGGGGGTGG + Intergenic
1118056780 14:62087271-62087293 CTGTGAGTGGGGAAAGGCGGAGG + Intronic
1118925327 14:70186655-70186677 TTGTGTGTGGGGACTGCTGCTGG + Intronic
1119416904 14:74477025-74477047 GTGTGTGTTGGGAATGGGGCTGG - Intronic
1119416916 14:74477104-74477126 GTGTGTGTTGGGAATGGGGCTGG - Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1120049518 14:79849040-79849062 CTGGGTGTGGGGAAGAGAGTTGG - Intronic
1120536768 14:85705972-85705994 CTGTGTGTGGGGGATGTATGAGG + Intergenic
1120633130 14:86915807-86915829 CTTGATGTGGGGACTGGAGCTGG + Intronic
1121642805 14:95497141-95497163 CTGTGTGGGGGGACAGGGGCTGG - Intergenic
1121863464 14:97340631-97340653 TTGGGGGTGGGGAATGGAGAAGG + Intergenic
1121885388 14:97538294-97538316 CTGTGTGAGGGGAGAGGAGTAGG + Intergenic
1122273995 14:100581836-100581858 CTGTCTGCTGGGATTGGAGCAGG + Intronic
1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG + Intergenic
1122406723 14:101505261-101505283 CTGCCTGTGAGGGATGGAGCCGG - Intergenic
1123039462 14:105484465-105484487 GTGTGGGTGGAGAAAGGAGCTGG + Intergenic
1124399396 15:29335117-29335139 CTGTGAGTGAGGAATTTAGCAGG - Intronic
1124499709 15:30216637-30216659 CTGTATGTGGGGAATGAAATGGG + Intergenic
1124743870 15:32322030-32322052 CTGTATGTGGGGAATGAAATGGG - Intergenic
1125622173 15:41073266-41073288 CTGTGTGTAGGGGGTGGAGCTGG - Intronic
1126437068 15:48646574-48646596 CTGTGTGTGGGGGAGGGCGAGGG - Intergenic
1126954524 15:53917664-53917686 CTGCGTGTGGTGAGTGGAGTGGG - Intergenic
1128579351 15:68797940-68797962 GTGTGGGTGGGGAATGGCTCTGG + Intronic
1129705423 15:77791471-77791493 TGGTGTGTGGGGGATGGAGGAGG + Intronic
1129883613 15:79023417-79023439 ATGTGTGTGAGGGATGGAGCTGG + Intronic
1130079721 15:80721940-80721962 CTTTGTGTTGGGAAGGGAGTTGG + Intronic
1130764743 15:86858486-86858508 GTGTGTGTGTGTAAGGGAGCAGG + Intronic
1130971866 15:88739937-88739959 CTGTGTGTGGCTAGTGGAGAAGG + Intergenic
1131150486 15:90044423-90044445 CTGAGTGTGAGGAAGGGGGCCGG + Intronic
1131645395 15:94336783-94336805 CTGTGTGTTTGGAATGGAGCAGG + Intronic
1131671354 15:94623061-94623083 CTGTTTGTGTAGAATGGAGGAGG + Intergenic
1131927156 15:97397676-97397698 CATCGTGTTGGGAATGGAGCAGG - Intergenic
1132207298 15:99995002-99995024 CTGTGTGTGGAGTGTAGAGCTGG + Intronic
1132302929 15:100787685-100787707 GGGTGTGTGGGGAAGGCAGCAGG - Intergenic
1132482907 16:175508-175530 CTGTGGTTGGAGAATGGAGGTGG - Intergenic
1133437768 16:5794629-5794651 CTGTGGATGGGGGATGCAGCTGG + Intergenic
1138432078 16:56975453-56975475 CTATGCCTGGGAAATGGAGCAGG - Intronic
1138514699 16:57529512-57529534 CTGGGTGAAGGGATTGGAGCAGG - Intronic
1138628186 16:58269471-58269493 TGGAGTGTGGGGAATGGAGAAGG - Intronic
1139512698 16:67436411-67436433 GTGGGGGTGGGGAATGGGGCTGG + Intronic
1139592216 16:67939652-67939674 CTGGGCGCGGGGACTGGAGCTGG - Intergenic
1140338309 16:74132740-74132762 CAGTGTGTGGGAAATGGGTCAGG - Intergenic
1140485525 16:75290213-75290235 CTGTGGCTGCAGAATGGAGCAGG - Intergenic
1140873439 16:79128028-79128050 CTGGATGTGAGGAATGGAGCAGG + Intronic
1141802657 16:86321684-86321706 CTGCGTGTGGTGAAGGGGGCTGG - Intergenic
1142080915 16:88148360-88148382 GTGTGTGTCCGGCATGGAGCAGG - Intergenic
1142195562 16:88737843-88737865 CTCTGGGTGGGGTGTGGAGCTGG - Intronic
1142307711 16:89294859-89294881 CTGTGTGGAGGGCAGGGAGCAGG - Intronic
1142342442 16:89532335-89532357 CTGTTTGTAGGGAATGGAGCTGG + Intronic
1142903975 17:3030846-3030868 CTGTGTGTGGGGACTGGCTAGGG - Intronic
1143687176 17:8526986-8527008 CACTGTGTGAGGCATGGAGCAGG + Intronic
1143951166 17:10633451-10633473 CTGTGTGACGGGAAAGCAGCAGG + Intronic
1144834183 17:18148344-18148366 CTGTGTGTGGGGGTGGGACCTGG + Intronic
1144951686 17:18997845-18997867 CTCTGTGTCTGGCATGGAGCTGG - Intronic
1145320530 17:21764709-21764731 CTGTGGGAGGGGAATAGAGGTGG - Intergenic
1146184720 17:30717366-30717388 CTGTGTGTGGGGAGGGTTGCTGG - Intergenic
1146211679 17:30948090-30948112 AGGTGTGTGTGGGATGGAGCGGG + Intronic
1146446770 17:32938257-32938279 CTGTGTGGGATAAATGGAGCAGG - Intronic
1146489392 17:33269474-33269496 GTGTGTTTGGGGGATGGAGGAGG - Intronic
1146709974 17:35032554-35032576 CTGTGTGTGGAGAATAGGGACGG + Intronic
1147131363 17:38411405-38411427 CTGTGTGTGGAGGATGAGGCAGG + Intergenic
1147647646 17:42043426-42043448 CTGTGTGTGGGGGAGGCAGGGGG - Intronic
1148778862 17:50110590-50110612 CCGTGAGTGGGGAATGAGGCTGG + Exonic
1149560533 17:57604955-57604977 TTGTGTGTGGGGAGGGGGGCGGG + Intronic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151575251 17:74949883-74949905 AGGTGTGTGGGGAGAGGAGCTGG - Exonic
1151745964 17:76011929-76011951 CTGGGTGTGGGGGATAGGGCTGG + Intronic
1152130379 17:78472624-78472646 CTGTGTGTGGGGTGTGGGGAGGG + Intronic
1152271596 17:79328177-79328199 CTGTGTGTCTGGAACGGAGATGG + Intronic
1152299654 17:79487616-79487638 CTGGGTGAGTGGCATGGAGCTGG + Intronic
1153246138 18:3074252-3074274 CTGTGTATGTGGACTGCAGCTGG - Intronic
1153603556 18:6807841-6807863 CTGAGTTTAGGAAATGGAGCTGG - Intronic
1154029992 18:10745216-10745238 CTATGGGTGGGGAAGGGACCTGG - Intronic
1156191858 18:34729409-34729431 CTGTGTGTGAGAAATGGCACAGG + Intronic
1156470693 18:37375738-37375760 CTGAGTGTGTGGGATGCAGCCGG + Intronic
1158617313 18:59000239-59000261 TTGTGTTTGGGGATTGGAGGTGG - Intergenic
1158661483 18:59392481-59392503 CAGTGTGTGAGGAACAGAGCTGG + Intergenic
1158832388 18:61294365-61294387 TTGTGGTTAGGGAATGGAGCTGG - Intergenic
1158920434 18:62186563-62186585 CTGTGGGTGGGGACGGGGGCTGG - Intronic
1160939182 19:1612154-1612176 CTGGGTGTGGGGAAGGGAGAGGG + Intronic
1161202897 19:3025668-3025690 GTGTGGGTGGGGAAGGGGGCGGG + Intronic
1161447478 19:4326769-4326791 GTGTGTGTGGGGGAGGGGGCGGG - Intronic
1161973187 19:7595352-7595374 GTGTGTGTGGGGTATGTATCTGG - Intergenic
1162332296 19:10037737-10037759 GTGAGTCTGGGGAATGGAGGGGG + Intergenic
1162566742 19:11448819-11448841 CTGTGTGTGGGGACTGGAGGAGG + Intronic
1162788840 19:13052777-13052799 CTGTGTGTGTGGACGGGTGCAGG - Intronic
1162793573 19:13075417-13075439 CTCTGGGTGGGGAGTGGTGCCGG - Intronic
1162974063 19:14198327-14198349 CTGTGTGTGGGGAGGGTTGCTGG + Intronic
1163263214 19:16203796-16203818 ATGGGTGTGGGGAGAGGAGCAGG + Intronic
1163523617 19:17807134-17807156 GTGTGTGTGTGTATTGGAGCAGG + Intronic
1163633050 19:18426775-18426797 CAATGTCTGGGGAATGGAGGTGG - Intronic
1164553991 19:29235623-29235645 GTGTGAGTGGGGCATAGAGCTGG + Intergenic
1164670030 19:30067187-30067209 CAGGGTGTGGGGCCTGGAGCTGG + Intergenic
1165151612 19:33763928-33763950 CTGTGGATGGTGAAAGGAGCTGG + Intronic
1165258701 19:34595822-34595844 CTGGGGGTGGGGAAGGCAGCAGG + Exonic
1166409500 19:42547167-42547189 CTGTGTCTGGGGGAAGGGGCTGG + Intronic
1166477223 19:43137986-43138008 CTGAGTGTGGGGTGTGGAGTGGG + Intronic
1167620469 19:50557322-50557344 CTGTGAGTGGAGATTGGGGCTGG - Intronic
1167931906 19:52872835-52872857 CTTGGTGAGGGGAATGTAGCAGG + Intronic
1168116624 19:54224471-54224493 CTGTGTGTGTGGACAGGCGCTGG + Intronic
1168119607 19:54244254-54244276 CTGTGTGTGTGGACAGGCGCTGG + Intronic
1168168613 19:54572171-54572193 CTGTGTGTGTGGACAGGCGCTGG - Intergenic
1168184981 19:54694893-54694915 CTGTGTGTGTGGACAGGCGCTGG - Intronic
1168338934 19:55612978-55613000 CTGTGGGTGGGGTAGGGTGCAGG + Intronic
1168475668 19:56673424-56673446 CTGTGTGTGTGGATGGGAGGAGG + Intergenic
925197929 2:1942321-1942343 CTGTGTGTTGGGAATGTTCCCGG - Intronic
925300241 2:2806670-2806692 CTTTGTGTGGGGTGTGGACCTGG + Intergenic
926420412 2:12691138-12691160 CAGAGTCTGGGGAATGGAGTGGG + Intergenic
926821367 2:16855024-16855046 CTGGGTGGGGGGACTGGATCTGG - Intergenic
927000161 2:18786612-18786634 CTGTCTGTGGGGAAAAGAGACGG + Intergenic
927249218 2:20982907-20982929 CTGTGAGTGGGGAAAGAATCAGG + Intergenic
927541768 2:23918511-23918533 CAGTGTGTAGGGAGAGGAGCAGG - Intronic
927683903 2:25157914-25157936 CTGTGTATGGGAAAGGGGGCTGG - Exonic
928645174 2:33344596-33344618 TTGAGAGTGAGGAATGGAGCAGG - Intronic
930453867 2:51580755-51580777 ATGTGTGTGCGGCATGTAGCGGG + Intergenic
930738481 2:54803825-54803847 CTGTGTGTGTGAAATACAGCTGG + Intronic
931819042 2:65933323-65933345 CTGTGTATGTGAAATGGAGCAGG + Intergenic
932460452 2:71878850-71878872 CTGTGTGTGGGGAGCACAGCTGG - Intergenic
932805318 2:74778182-74778204 GTGGGTGTGGGGAGTGGGGCAGG + Intergenic
933647621 2:84825331-84825353 CCGTGTGTGAGGAAGGGAGGAGG + Intronic
933694862 2:85210235-85210257 ATGTGTGTGGGGAAGGGGCCAGG - Intronic
934177843 2:89592879-89592901 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
934288141 2:91667180-91667202 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
934952007 2:98582555-98582577 CTGTGTCTGGCGTATGGAGTAGG - Intronic
934952014 2:98582644-98582666 CTGTGTCTGGCGTATGCAGCAGG - Intronic
934952016 2:98582675-98582697 CTGTGTCTGGCGTATGCAGCAGG - Intronic
935649555 2:105370570-105370592 TTGTGTGGGGGGTGTGGAGCTGG + Intronic
935796943 2:106651871-106651893 CAGTCTGTGGGAAATGGTGCAGG + Intergenic
935820052 2:106885967-106885989 CCGTGTGTGGGGAATGTTGAAGG - Intronic
936043014 2:109164074-109164096 CTGGCTGTGGGGGATGGAGGAGG + Intronic
936650601 2:114422042-114422064 CTGGGGGTGGGGACTGGGGCAGG + Intergenic
937420963 2:121755194-121755216 CTGTGAGTAGGGAATGGATTGGG - Intronic
937818232 2:126276683-126276705 GTGTGTGTTGGGATGGGAGCAGG + Intergenic
937906656 2:127055860-127055882 CTTTGGGTGGGGCATGGGGCAGG - Intronic
938249616 2:129804573-129804595 CTGTCTGTGGGGCATGGTGGTGG - Intergenic
938739265 2:134215629-134215651 ATGTGTTTGGGTCATGGAGCCGG - Intronic
940153044 2:150624020-150624042 CCGGATGTGGGGATTGGAGCAGG - Intergenic
944759641 2:202801096-202801118 CTGGTTGTGGGGAAGGGAACAGG + Intronic
945943789 2:215974785-215974807 CTGTGTTTAGGAACTGGAGCAGG - Intronic
946212629 2:218159750-218159772 CTGTTTCTGGAGAATGGAGAAGG + Intergenic
946439696 2:219684969-219684991 CTGTCTGTGGTGAATTGATCGGG - Intergenic
946889897 2:224264443-224264465 GTGTGTTTGGGGAGAGGAGCTGG + Intergenic
947039905 2:225905386-225905408 CTGTGTGTGGGGCAGGGATGAGG - Intergenic
947049886 2:226030642-226030664 CTGTGTGTGGGGGGTGGGGTGGG + Intergenic
947083269 2:226422134-226422156 CTTTGAGTGGGGCCTGGAGCAGG - Intergenic
947175557 2:227363484-227363506 CTGTGTGTAGAGAAAGGAGAAGG - Exonic
947700356 2:232229295-232229317 AGGTGGGTTGGGAATGGAGCAGG - Intronic
948271446 2:236676932-236676954 GTGTGTGTGCGGAGGGGAGCAGG + Intergenic
948326917 2:237131860-237131882 CTGAGGGTGGGGAGGGGAGCAGG - Intergenic
948759460 2:240181845-240181867 CGGTGGGTGGTGATTGGAGCAGG - Intergenic
948803132 2:240441812-240441834 CTGGGTGTGGGGCCTGGAGGTGG - Intronic
948929440 2:241122700-241122722 CTGTGGGGGGGGAGTGGCGCCGG - Intronic
948931072 2:241132720-241132742 CAGTGTGTGTGGAAGAGAGCAGG + Intronic
1169208948 20:3755024-3755046 CTGGGAGTGGGGCATGGGGCAGG + Intronic
1171428735 20:25065310-25065332 ATGTGTGTGGGGACTGGTTCAGG - Intergenic
1171473472 20:25390317-25390339 CGGTGCCTGGGGAAGGGAGCGGG + Intronic
1172362355 20:34322163-34322185 CTGTGTGTGGGTAAGTTAGCTGG + Intergenic
1172587198 20:36092974-36092996 GTGTGTGTGGGGACTGTCGCGGG + Intronic
1172588747 20:36102992-36103014 CAGTGATTGGGGAATGGAGGGGG - Intronic
1173054229 20:39595731-39595753 ATGTGTGTGGTGTAAGGAGCTGG - Intergenic
1173164073 20:40673947-40673969 CTGGCTGTGGAGACTGGAGCTGG - Intergenic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1173851397 20:46220631-46220653 CTCTGAGTGGGGGCTGGAGCAGG + Intronic
1174149541 20:48476433-48476455 CTGTTTGAGGGTCATGGAGCTGG - Intergenic
1175001764 20:55636796-55636818 CTTTGTGTGTGGGAGGGAGCAGG - Intergenic
1175242287 20:57558690-57558712 CAGTGGGTGGGGCATGGAGGTGG - Intergenic
1175348718 20:58302481-58302503 CTGTGTGTGAGGGAGGGAGTGGG - Intergenic
1175422472 20:58843216-58843238 CTGGGGGAGGGGAATTGAGCGGG - Intronic
1175936792 20:62517813-62517835 CTGTGTTTGGGGCATGGGGGAGG - Intergenic
1175936829 20:62517921-62517943 CTGTGTGGGGGGCATGGGGGAGG - Intergenic
1176010056 20:62888434-62888456 CTGAGGCTGTGGAATGGAGCTGG + Intronic
1176179971 20:63745194-63745216 CGGAGTGTGGGGATAGGAGCCGG - Exonic
1178228638 21:30754566-30754588 CTGAGTGTCTAGAATGGAGCTGG - Intergenic
1179255320 21:39710843-39710865 CTGTGTGGGAGGGAGGGAGCAGG + Intergenic
1179511479 21:41876894-41876916 CTGTGTGTGGGGAATGGAGCTGG - Intronic
1180059125 21:45375611-45375633 CTGCATTTGGGGAATGGAGGAGG + Intergenic
1181489920 22:23255275-23255297 CTGTGTGTGCTGCACGGAGCAGG - Intronic
1182509293 22:30807574-30807596 CTGTGTGAGAGGCAGGGAGCTGG - Intronic
1182973479 22:34599772-34599794 CTGTGTCTGAGGAGTGGAGAGGG - Intergenic
1183080446 22:35452426-35452448 TTGTGTCTGGAGCATGGAGCCGG + Intergenic
1183405347 22:37627796-37627818 CTGGGCCTGGGGAATGGAGGAGG + Intronic
1183590293 22:38775895-38775917 CTGTCTGTGGGGGACGGGGCAGG + Intronic
1183964615 22:41434341-41434363 CTGTGTGTGTGGATGGGAGGAGG + Exonic
1184189414 22:42885076-42885098 CTGTGTGAGGGGGATGGAGTGGG - Intronic
1184239805 22:43206135-43206157 GGGTGTGTGGTGAATGGAGGCGG - Intronic
1184268003 22:43360301-43360323 CTGTGGGTGGGGAGTGAAGCGGG + Intergenic
1184348353 22:43926452-43926474 CTCTATGTGGGGCATGGAGGTGG + Intronic
1185225663 22:49650610-49650632 CTGTGTGTGGAGAAGGGTGGAGG + Intronic
950252182 3:11475055-11475077 CACTGTGTGGGGAATGGATTGGG + Intronic
950421428 3:12901879-12901901 CTGTGTGTGGCGAGTGCAGAGGG + Intronic
950702153 3:14758068-14758090 CTGTGTGCTGGGCATGGACCGGG + Intronic
951038655 3:17963715-17963737 CTGTGTGTGTGGATTGGACATGG + Intronic
951345146 3:21538744-21538766 CTGTGGTTGGGGCATGGAGGGGG + Intronic
952020202 3:29009706-29009728 CTGTGTCTGAGGGATGGAGAAGG + Intergenic
953004857 3:38968954-38968976 CTGTGTGTGGGGTAGGGACATGG - Intergenic
953479221 3:43235105-43235127 CAGGGAGTGGGGAATGGAGATGG + Intergenic
953699598 3:45185556-45185578 GTGTGTGTGTGGAAGGAAGCTGG + Intergenic
953977822 3:47395593-47395615 CTGTGTGAGGAGAATGGCCCAGG - Intronic
954038085 3:47863930-47863952 GTGTGTGTGGGGAGTGGTGGGGG + Intronic
954088860 3:48269022-48269044 ATGTGTGTGGGGAATGTGGGCGG + Exonic
954088917 3:48269442-48269464 ATGTGTGTGGGGAATGTGGGCGG + Exonic
954419553 3:50411453-50411475 CACTGTGTCTGGAATGGAGCTGG - Intronic
955466130 3:59238873-59238895 CCCTTTGTGGGGAATGGAACTGG - Intergenic
955468334 3:59259412-59259434 TTGTGTGTGAGAAAAGGAGCAGG - Intergenic
955479472 3:59374791-59374813 CTCTGTGTGAGGAATTGGGCTGG - Intergenic
956876423 3:73468412-73468434 CTGTATTTGGGGCATGGAGAGGG - Intronic
958033390 3:88142013-88142035 GTGTGTGTGGGGAGGGGGGCTGG + Exonic
958151014 3:89695536-89695558 CTGTGTGTAGGGAGAGGGGCAGG - Intergenic
960855534 3:122098533-122098555 CAGTGTGAGGGGAAGGGATCTGG + Intronic
961330637 3:126135947-126135969 CTGGGTGTGGTGAGGGGAGCCGG + Intronic
961378690 3:126483259-126483281 CTGGGTGTGGGGATGGGGGCCGG - Intronic
961530547 3:127537458-127537480 CTGAGGGTTGGGAATGGAACAGG + Intergenic
962269521 3:133967817-133967839 ATGTGTGGGGGGTATGGAGGTGG - Intronic
962269555 3:133967917-133967939 ATGTGTGGGGGGTATGGAGGTGG - Intronic
964092059 3:152889015-152889037 TTGTGTGTGGGGCAGGGAGGGGG + Intergenic
964967575 3:162515899-162515921 CTGAGTGTGGTAAGTGGAGCTGG - Intergenic
967227399 3:187305188-187305210 TTGTGGGTGGGGAATTGAGCAGG - Intergenic
967553815 3:190831471-190831493 CAGTGGATGGGGAATGGAGGCGG - Intergenic
968480301 4:830257-830279 CTGAGTGTGGGGTGTGGATCTGG + Intergenic
969153035 4:5186629-5186651 CTGTGTGTTGGGGATGGACCAGG - Intronic
969227426 4:5808031-5808053 CTGCCTGTGGGGACTGGAGCTGG + Intronic
970454125 4:16205098-16205120 CTTTCTGTGGGGAATGAAGCAGG + Intronic
971713002 4:30141323-30141345 GTGTGTGTGGGGCAGGGGGCAGG + Intergenic
972290613 4:37686714-37686736 CTGTGGGTGGGGAAAAGGGCGGG - Intergenic
972775059 4:42232657-42232679 CTGTGAGTAGCGAAGGGAGCCGG + Intergenic
973534404 4:51867038-51867060 CTGTGTGCAGTGATTGGAGCGGG - Intronic
976470568 4:85423978-85424000 CTGTGTGTGTGGAAGGGGGGCGG + Intergenic
977540929 4:98317711-98317733 CTTAGTGTGGGGTATGGAGAGGG + Intronic
979238095 4:118424201-118424223 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
980132814 4:128832544-128832566 ATGTGTGATGGGAAAGGAGCTGG + Intronic
982452237 4:155566805-155566827 CTGTGGGTGGGGAGTGTGGCTGG - Intergenic
983153934 4:164320792-164320814 GTGTGTGGGGGGAGTGGGGCTGG + Intronic
983403366 4:167294293-167294315 CTCGGTGTGGGGAATGGGGTGGG - Intergenic
985174400 4:187186085-187186107 CTGTGTGTGGGTAGTGGTGATGG - Intergenic
985579440 5:689231-689253 CCGTGTATGGGGTATGGAGGTGG - Intronic
985594286 5:781290-781312 CCGTGTATGGGGTATGGAGGTGG - Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
985754027 5:1702482-1702504 CTCTGTGTGGGGGTGGGAGCAGG + Intergenic
987067617 5:14304745-14304767 GTGTGTGTGGGGAGTGGGGTGGG + Intronic
988798324 5:34673306-34673328 CTGTGTGAGGGCAATGGGGCAGG + Intronic
988920197 5:35934430-35934452 ATGTGGGTGGGGAATGGATCAGG - Intronic
989164922 5:38424420-38424442 CTCTGTCTGGGGTAGGGAGCAGG - Intronic
989189696 5:38658804-38658826 CAGGGTGTGGGGAATTGACCAGG + Intergenic
989776896 5:45219696-45219718 CTGTATGTGGGTAGTGGGGCTGG + Intergenic
991493605 5:67207267-67207289 CTGTGTGGGTGCAGTGGAGCTGG + Intergenic
991512580 5:67396196-67396218 CTGGGTGTGGGGATGGGAGATGG + Intergenic
991776126 5:70087641-70087663 CTGTGTTGGTGGAATGGAGGAGG + Intergenic
991855414 5:70963095-70963117 CTGTGTTGGTGGAATGGAGGAGG + Intergenic
992087258 5:73289107-73289129 TGGTGTGTGGGTAATGGAGGAGG - Intergenic
992187680 5:74259888-74259910 CTGAGGGTAGGGAATGGAGGTGG - Intergenic
992831178 5:80594971-80594993 CTGTGTGTGGACATTTGAGCGGG + Intergenic
993457382 5:88141758-88141780 CTGTGTGTGGGGGGTGGGGGCGG - Intergenic
993606155 5:89992876-89992898 CTTTGTGTGGGGCCTGGAACAGG - Intergenic
993777015 5:92012348-92012370 CTGTGTGTGGGGGGGGGAGGCGG - Intergenic
993889410 5:93455147-93455169 CTGTGTGTGGGGATTGTCACAGG - Intergenic
996360620 5:122641443-122641465 GTGTGTGTGGGGAGGGGAGGGGG - Intergenic
997247181 5:132359684-132359706 TTGTGTGTGGTGAATGGTCCAGG - Intergenic
997335487 5:133106154-133106176 GTGTGTGTGGGGAAGGGTGTGGG + Exonic
997597139 5:135114629-135114651 CTGTGTGTGGGGGGGGGAACAGG - Intronic
998378561 5:141708005-141708027 CTGTGTGTGGAGAATAGACTGGG + Intergenic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
998812339 5:145978880-145978902 CTGTGTGTGGGGAGAGGCCCTGG + Intronic
999276423 5:150333685-150333707 CTGTGTGGGGTGAAGGGAGCAGG - Intronic
999361385 5:150989240-150989262 TGGTGTGTGGGGAAAGGAGGTGG + Intergenic
999418836 5:151422941-151422963 TTGTGTGTGGGGAGTGGAGTGGG - Intergenic
999499881 5:152136234-152136256 CTGTGTTTGGGGAATGTGGGTGG - Intergenic
1000029336 5:157388819-157388841 CTGAGTGTGGGTAATAAAGCAGG - Intronic
1000935359 5:167299472-167299494 ATGTGTGTAGGGAAGGGAGGGGG + Intronic
1001210781 5:169808312-169808334 GTGTGTTTGGGGAATGGGACAGG + Intronic
1001309661 5:170601896-170601918 CTGGCAATGGGGAATGGAGCAGG + Intronic
1002058879 5:176614461-176614483 CTGTGTGTGGGGGGGGGAGGGGG + Intergenic
1002090596 5:176803223-176803245 CTGTGTGGTGGCCATGGAGCAGG + Intergenic
1002738522 5:181416177-181416199 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1004570527 6:16840344-16840366 CTGACTTTGGGGAAAGGAGCAGG + Intergenic
1004942637 6:20576797-20576819 CTCTGTGTGTGGCGTGGAGCAGG + Intronic
1004966493 6:20857817-20857839 TGGTGTGGGAGGAATGGAGCTGG - Intronic
1005712561 6:28515858-28515880 GTGTGTGTAGGGAGTGGAGGTGG - Intronic
1006030179 6:31172117-31172139 CTGTGTGAGGGGATTGGGACTGG - Intronic
1006083749 6:31581960-31581982 GTGTGTGTTGGGGATGGTGCTGG - Intronic
1006583334 6:35089084-35089106 GTGGGTGAGGGGAACGGAGCAGG + Exonic
1007110235 6:39309454-39309476 CTGTGTGTGTGGGGTGGGGCAGG + Intronic
1007227020 6:40322207-40322229 CTGTCTGTTGGGAACGGAGCGGG - Intergenic
1007693672 6:43718460-43718482 CTGTGTGTGGTGTAGGGAGATGG + Intergenic
1007843010 6:44731981-44732003 CTGTGTGTAGAGAGTGGTGCAGG + Intergenic
1009524670 6:64728880-64728902 CTCTCTGTGGGGAGGGGAGCTGG + Intronic
1012412213 6:98971419-98971441 CAGTGTGAGTGGAGTGGAGCAGG + Intergenic
1012541118 6:100363046-100363068 GTGTGTGTGGGGAGAGGGGCAGG - Intergenic
1013524131 6:110958882-110958904 CTGTGTGTGGGGAAGGGAGTTGG + Intronic
1013734056 6:113205353-113205375 GTGTGTGTGGTGAAGGGTGCAGG + Intergenic
1015270840 6:131337258-131337280 GTGTATGTGGGGAATTGAGGTGG + Intergenic
1015445469 6:133299034-133299056 CTGTGGTGGGGGAATGAAGCAGG + Intronic
1016167485 6:140965269-140965291 AAGTGTGTGAGGAATGGAGGTGG + Intergenic
1017280185 6:152614980-152615002 CTGTCTGTGGGGGCTGGAGGAGG + Intronic
1018051506 6:160012914-160012936 CTGTGTGTGGGGCCAGGCGCAGG - Intronic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1018750341 6:166798765-166798787 CTGTCTGTGGAGAAGGGGGCAGG - Intronic
1018995665 6:168708337-168708359 CTGTTTCTGGGTAATGGATCTGG + Intergenic
1019154256 6:170028744-170028766 CTGTCTGTGGGGACAGGACCAGG + Intergenic
1019243625 6:170691729-170691751 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1019911401 7:4102504-4102526 CTGCGTGTGGGGAAGGGAGGAGG - Intronic
1019928469 7:4208344-4208366 CTGTGTGAGGGGACCTGAGCTGG - Intronic
1021513481 7:21458780-21458802 GTGTGTGGGGGGAGGGGAGCGGG - Intronic
1021767992 7:23968402-23968424 CAGTGTGTGGGTAAGGGAGTGGG + Intergenic
1023020984 7:36011593-36011615 CAGTGTGTGGGGGCTGCAGCTGG + Intergenic
1024854333 7:53760129-53760151 CAGTGGATGGGGAATGCAGCAGG + Intergenic
1026042274 7:66878072-66878094 CTATGTGTTGGGGATGGAGGAGG + Intergenic
1026197826 7:68188241-68188263 GTGTGTGTTGGGAAGGGAGAGGG - Intergenic
1026590400 7:71689845-71689867 CTGTGAGAGGCGAATGCAGCTGG + Intronic
1027056470 7:75053119-75053141 CTGGGGGTGGTGCATGGAGCTGG + Intronic
1027056487 7:75053164-75053186 CTGGGGGTGGTGCATGGAGCTGG + Intronic
1027056519 7:75053254-75053276 CTGGGGGTGGTGCATGGAGCTGG + Intronic
1027200857 7:76063144-76063166 TTGTGCATGGGGAGTGGAGCCGG + Intronic
1027219511 7:76204956-76204978 CTGAGTGAGGAGAAAGGAGCTGG - Intronic
1027430206 7:78104162-78104184 GTGCTTGTGAGGAATGGAGCAGG + Intronic
1027955951 7:84880243-84880265 GTGTGTGTGGGGTGTGGAGTGGG + Intergenic
1028357407 7:89926056-89926078 GTGTGTGTGGGAAATGTACCGGG + Intergenic
1029775922 7:102684009-102684031 CTGTCTGCCTGGAATGGAGCAGG + Intergenic
1030231493 7:107212674-107212696 CTGTGGGTGGGCAATGAAGCCGG - Intronic
1032115182 7:129110871-129110893 CTGTGAGTGGGCAGTGGAGGAGG + Intergenic
1032485750 7:132286234-132286256 CTCTGTGTGGGGCATGCAGTGGG + Intronic
1032590895 7:133191531-133191553 CAGTGTGTGGGGACATGAGCAGG - Intergenic
1032795281 7:135271353-135271375 CTGTCTTTGGGGAATAGATCTGG - Intergenic
1033088932 7:138367456-138367478 CGGTGTGTAGGGAAGGGAGGGGG - Intergenic
1033756512 7:144401347-144401369 CTGAGTCTGGGGCCTGGAGCGGG + Exonic
1034347886 7:150398144-150398166 GTGTGTGTGGGGAGTGGGGGTGG + Exonic
1034560310 7:151876043-151876065 CGGTGGGTGGGGAAAGCAGCGGG - Intronic
1034581923 7:152050938-152050960 CTGTGTTTGGGGGAGGGAGAGGG - Intronic
1034841883 7:154405643-154405665 CAGTGTGAGGGGACTGGAGCTGG + Intronic
1035290507 7:157834969-157834991 CTGTGGGTGGTGAATGGAGCTGG + Intronic
1035504497 8:116431-116453 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
1035649973 8:1256941-1256963 CTGTGTGAAAGGAATGGGGCAGG - Intergenic
1036140243 8:6200981-6201003 CTCTGTGTTGGCTATGGAGCTGG - Intergenic
1037002948 8:13743129-13743151 GTGTGTGTGGGGAGGGGGGCTGG + Intergenic
1037130648 8:15404380-15404402 GTGTGTGTGTGGAATGGTGGGGG + Intergenic
1037544116 8:19900840-19900862 CTGTTTGTGGGGAAGGGTGGAGG + Intergenic
1038248797 8:25883773-25883795 CTGGATGTGGGTGATGGAGCTGG - Intronic
1038397068 8:27254596-27254618 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1038397087 8:27254674-27254696 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1038397093 8:27254710-27254732 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1038397099 8:27254746-27254768 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1038397121 8:27254831-27254853 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1038397127 8:27254867-27254889 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1038397133 8:27254901-27254923 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1038397139 8:27254931-27254953 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1039920842 8:41893478-41893500 CTGTGTGCGGGGGGTGGAGGAGG - Intronic
1041255436 8:55976477-55976499 CTGTGTGAGTGAAAGGGAGCGGG - Intronic
1041406226 8:57502184-57502206 CTGTGTGTGGGGTTGGGGGCAGG + Intergenic
1043393984 8:79818569-79818591 CTGTCTCTGGGGATTGGAGTAGG - Intergenic
1044747709 8:95386746-95386768 GTATGTGTGGGGAATGGATGTGG + Intergenic
1046303956 8:112337280-112337302 ATGTGTGTGGGGAAGGGAAGGGG - Intronic
1047898771 8:129397334-129397356 CTGTCAGTGGTGAATGGGGCAGG - Intergenic
1047980964 8:130181659-130181681 CTGTGTGTGGGGAGGGGGCCAGG + Intronic
1048063501 8:130944878-130944900 CTGAGTCTGAGGAATGGAGCTGG + Intronic
1048296426 8:133217923-133217945 GTGTGTGTGGAGAAGGGAGTGGG - Intronic
1048326284 8:133441892-133441914 ATGTGTGTGAGGAATTGAACTGG - Intergenic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1049913145 9:289725-289747 CTGTGTGTGTGATATGGAGTGGG - Intronic
1050131885 9:2421405-2421427 CTGTGTGCTGGGAATGGAAATGG + Intergenic
1051357748 9:16255102-16255124 CAGGGAGTGGGGAGTGGAGCAGG - Intronic
1051815180 9:21096314-21096336 GTTTGTGAAGGGAATGGAGCTGG - Intergenic
1051816903 9:21119498-21119520 GTTTGTGGAGGGAATGGAGCTGG + Intergenic
1052608172 9:30732552-30732574 CTGGGAGTGGGGAATGGAGTGGG + Intergenic
1053011440 9:34635941-34635963 CTAGGGGTGGGGAATGGAGAGGG + Intronic
1053313188 9:37032345-37032367 GTATGTGTGGGGAATGAGGCGGG - Intronic
1056139058 9:83656894-83656916 CAGTGTGTGGGGCATGGGGGAGG - Intergenic
1056420928 9:86425481-86425503 GTGTGTATGCGGAATGGGGCAGG - Intergenic
1056958785 9:91103685-91103707 ATGTGTCTGGTGATTGGAGCTGG - Intergenic
1057147042 9:92765195-92765217 CTGAGTGTGGGGAAGGCCGCGGG - Intergenic
1057211623 9:93203814-93203836 CTGTGTGTGGTGATTGAAGCCGG + Intronic
1057517277 9:95732408-95732430 CTGAGTGTGGGGAGTGGTGAGGG + Intergenic
1057851201 9:98568201-98568223 ATGTGTGTGAGGGATGGAGGGGG - Intronic
1057995965 9:99821943-99821965 CTGTGTATGGGGAGCGGAGGAGG - Exonic
1059921528 9:119165917-119165939 CTGTGTGTGGGGAACGGGAGTGG + Intronic
1060237050 9:121871856-121871878 CTTTGAGTGTGGAAGGGAGCTGG - Intronic
1061162248 9:128902134-128902156 GTGTGTCTGGGGAGTGGAGGAGG - Intronic
1061320201 9:129823688-129823710 CTGGGGCTGGGGGATGGAGCGGG - Intronic
1061431758 9:130535706-130535728 GTGGGGGTGGGGAATGAAGCTGG + Intergenic
1061620598 9:131808976-131808998 CTGTGGCTGGGGCCTGGAGCGGG + Intergenic
1061978791 9:134087918-134087940 CTGGATGTGGGGAGTGGGGCTGG - Intergenic
1203603814 Un_KI270748v1:40952-40974 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1186250379 X:7659745-7659767 CTGTGTGTGGGTAATGATGTGGG + Intergenic
1188182697 X:27075335-27075357 CTGTCAGTGGAGAAAGGAGCTGG - Intergenic
1188776337 X:34224182-34224204 CTGTGTTTGGGGAATAGGGGTGG - Intergenic
1189496986 X:41517553-41517575 CTTGCTGTGGGGAATGGAGTTGG + Intronic
1189883529 X:45515977-45515999 CTGTGTGGGTGAAAGGGAGCAGG + Intergenic
1190428891 X:50359320-50359342 ATGTTTGTGGGGAATGAAGTAGG - Intergenic
1190582365 X:51901692-51901714 CTGTGTCTGGGCCCTGGAGCTGG + Exonic
1191103445 X:56757886-56757908 GTGTGTGTGGGTATTGGAGGAGG + Intergenic
1192185504 X:68944265-68944287 CTGTGTGTGGGGATGAGTGCAGG + Intergenic
1192229372 X:69254617-69254639 CTGGGGGTGGGGAAGGGAGAAGG + Intergenic
1194084845 X:89513732-89513754 CTGTGTGTGGGGATAGGAACAGG - Intergenic
1195093427 X:101485297-101485319 CTGTGCGTGCGGAGTGGAGGAGG + Intronic
1196002028 X:110796163-110796185 CTGTGTGATGGGAAAGTAGCCGG - Intergenic
1197554984 X:127942084-127942106 CTGTGGGTGGGGAGTGGTGGGGG - Intergenic
1197573438 X:128178256-128178278 CTGGGTTTGGAGAATGGAGGTGG + Intergenic
1197883476 X:131193343-131193365 CTGTGTCAGGGGAACAGAGCTGG - Intergenic
1199878542 X:151954566-151954588 TTCTGTTTGGGGAATGGGGCAGG + Exonic
1200437494 Y:3169617-3169639 CTGTGTGTGGGGATAGGAATAGG - Intergenic
1200775594 Y:7167482-7167504 ATGTGTGTGGCGAGGGGAGCAGG + Intergenic
1201528332 Y:14961549-14961571 GTGTGTTTGGGGCATGGAGGTGG + Intergenic
1202385875 Y:24325997-24326019 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1202484911 Y:25344131-25344153 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic